Download Molecular Biology Reports

Mol Biol Rep (2014) 41:8137–8148
DOI 10.1007/s11033-014-3714-4
Down-regulation of sweetpotato lycopene b-cyclase gene enhances
tolerance to abiotic stress in transgenic calli
Sun Ha Kim • Jae Cheol Jeong • Seyeon Park •
Ji-Yeong Bae • Mi-Jeong Ahn • Haeng-Soon Lee
Sang-Soo Kwak
•
Received: 18 July 2014 / Accepted: 28 August 2014 / Published online: 12 September 2014
Ó Springer Science+Business Media Dordrecht 2014
Abstract Lycopene b-cyclase (LCY-b) is a key enzyme
involved in the synthesis of a- and b-branch carotenoids
such as a-carotene and b-carotene through the cyclization
of lycopene. IbLCY-b had a length of 1,506 bp and
approximately 80 % nucleotide sequence identity with that
of tomato LCY-b. IbLCY-b was strongly expressed in
leaves, and expression was enhanced by salt-stress and
osmotic-stress conditions. To characterize the LCY-b gene
(IbLCY-b) of sweetpotato (Ipomoea batatas), it was isolated and transformed into calli of white-fleshed sweetpotato using an IbLCY-b-RNAi vector. Transgenic IbLCY-bRNAi calli had yellow to orange color and higher antioxidant activity compared to that of white, nontransgenic
(NT) calli. Transgenic cells had significantly higher contents of total carotenoids, although lycopene was not
detected in transgenic or NT cells. All transgenic calli had
strongly activated expression of carotenoid biosynthetic
genes such as b-carotene hydroxylases (CHY-b), cytochrome P450 monooxygenases (P450), and carotenoid
S. H. Kim J. C. Jeong S. Park H.-S. Lee (&) S.-S. Kwak (&)
Plant Systems Engineering Research Center, Korea Research
Institute of Bioscience and Biotechnology (KRIBB), Gwahak-ro
125, Daejeon 305-806, Korea
e-mail: [email protected]
S.-S. Kwak
e-mail: [email protected]
J.-Y. Bae M.-J. Ahn
College of Pharmacy and Research Institute of Life Sciences,
Gyeongsang National University, Jinjudae-ro 501,
Jinju 660-751, Korea
cleavage dioxigenase 1 (CCD1). Transgenic cells exhibited
less salt-induced oxidative-stress damage compared to that
of NT cells, and also had greater tolerance for polyethylene
glycol (PEG)-mediated drought compared to that of NT
cells, due to the higher water content and reduced malondialdehyde (MDA) content. The abscisic acid content
was also higher in transgenic cells. These results show that
a study of IbLCY-b can facilitate understanding of the
carotenoid biosynthetic pathway in sweetpotato. IbLCY-b
could be useful for developing transgenic sweetpotato
enriched with nutritional carotenoids and with greater tolerance to abiotic stresses.
Keywords Sweetpotato Carotenoid RNAi Lycopene
b-cyclase Metabolic engineering Salt stress Drought
stress
Abbreviations
ABA
Abscisic acid
CHY-b
b-Carotene hydroxylases
CRTISO Carotenoid isomerase
CCD1
Carotenoid cleavage dioxigenase 1
DPPH
2, 2-Diphenyl-1-picrylhydrazyl
HPLC
High-performance liquid chromatography
PSY
Phytoene synthase
PDS
Phytoene desaturase
LCY-b
Lycopene b-cyclase
LCY-e
Lycopene e-cyclase
MDA
Malondialdehyde
NCED
9-Cis-epoxycarotenoid dioxygenase
NT
Nontransgenic
P450
Cytochrome P450 monooxygenases
Ym
Yulmi
ZDS
f-Carotene desaturase
ZEP
Zeaxanthin epoxidase
123
8138
Mol Biol Rep (2014) 41:8137–8148
Introduction
Carotenoids are a subfamily of essential isoprenoid pigments synthesized by plants, algae, bacteria, and fungi.
Carotenoids have important functions in photosynthesis
and protecting plant cells against excess light energy and
photooxidative damage [1–3]. Carotenoids are metabolites
of phytoene, which is synthesized by phytoene synthase
(PSY) from geranylgeranyl pyrophosphates (GGPP) that
originate in the isoprenoid pathway [2]. Phytoene desaturase (PDS) and f-carotene desaturase (ZDS) convert
phytoene to lycopene via phytofluene and f-carotene.
Lycopene is the substrate for two competing lycopene
cyclases, lycopene e-cyclase (LCY-e) and lycopene betacyclase (LCY-b). LCY-e introduces a single epsilon-ring
into lycopene to produce d-carotene, and LCY-b introduces
one or two beta-rings at either end of lycopene to produce
b-carotene. Two carotenoid biosynthetic pathways proceed
from lycopene, the a-branch (from a-carotene to lutein)
and the b-branch (from b-carotene to neoxanthin), which
play distinct and complementary roles in photoprotection
mechanisms (Fig. 1). Carotenoid synthesis pathways have
been targeted for transgenic studies to modify expression
of key genes such as PSY, PDS, and LCY-b [2, 3].
Lycopene is a natural carotenoid that imparts red color to
fruits and vegetables such as tomato (Solanum lycopersicum), rosehip (Rosa canina), watermelon (Citrullus lanatus), and pink grapefruit (Citrus paradisi) [4]. Tomato fruits
are considered an important source of lycopene, representing
approximately 87 % of the dietary lycopene intake. Lycopene is a powerful antioxidant and has a protective role
against cancer and heart disease [5]. However, lycopene
biosynthesis and regulation are still poorly understood.
Efforts to engineer carotenoid biosynthesis pathways in
tomato have aimed to increase the levels of b-carotene,
lycopene, and xanthophylls. Lycopene levels can be elevated
by up-regulation of carotenogenic genes upstream of lycopene, such as CrtB and DXS, and down-regulation of lycopene beta-cyclases [6, 7]. Tomato mutant studies have
provided more insight into lycopene biosynthesis. Mutants
with reduced lycopene contents (yellow-fruited tomato)
have reduced expression of PSY and a deletion mutation in
the carotenoid isomerase gene (CRTISO).
The delta mutant has high expression levels of LYCE and high levels of b-carotene accumulation. For other
described mutants with increased levels of lycopene
accumulation, the molecular mechanisms are more complicated. Ronen et al. analyzed an oldgold (og) mutant and
found that higher lycopene accumulation was due to a
deletion mutation in LYC-B [6]. Pepper capsanthin-capsorubin synthase (CCS), which shares high identity with
LCY-b at the amino acid level, also has LCY-b activity and
123
Fig. 1 The carotenoid biosynthetic pathway in plants. IPI isopentenyl diphosphate isomerase, GGPS geranylgeranyl pyrophosphate,
PSY phytoene synthase, PDS phytoene desaturase, ZDS f-carotene
desaturase, CRTISO carotenoid isomerase, LCY-b lycopene b-cyclase,
LCY-e lycopene e-cyclase, CHY-b b-carotene hydroxylase, P450
cytochrome P450 monooxygenases, ZEP zeaxanthin epoxidase, NSY
neoxanthin synthase, NCED 9-cis-epoxycarotenoid dioxygenase,
CCD1 carotenoid cleavage dioxigenase, ABA abscisic acid
is strongly induced during fruit coloration [8]. Two LCY-b
genes (LCY-B1 and LCY-B2) have been isolated from
tomato, papaya, and citrus [6, 9–11]. It was reported that
the enzymes encoded by LCY-B1 and LCY-B2 could generate b-carotene from lycopene in E. coli cells [6, 9, 10].
However, the roles of LCY-B1 and LCY-B2 in the production of a-carotene are still unclear. Fruit-specific
overexpression of the native lycopene b-cyclase resulted in
increased b-carotene accumulation without a related
decrease in total carotenoids [7]. These reports suggest that
differences in LCY-b gene expression lead to different
levels of carotenoid accumulation.
Mol Biol Rep (2014) 41:8137–8148
Sweetpotato [Ipomoea batatas (L.) Lam] is a nutritious
crop that contains high levels of antioxidants such as
carotenoids, anthocyanins, and vitamin C. Its wide adaptability on marginal lands in tropical climates can be
exploited to secure the food supply. The United States
Department of Agriculture (USDA) reported that sweetpotato yields two to three times more carbohydrate that of
field corn, and has similar potential as an alternative source
of bioenergy as some varieties of sugarcane [12].
In our previous studies, the metabolic engineering of
carotenoids by silencing IbCHY-b or IbLCY-e resulted in
higher levels of b-carotene and total carotenoids in sweetpotato culture cells [13, 14]. Carotenoid biosynthesis in sweetpotato is still poorly understood, so this study characterized
the sweetpotato carotenoid biosynthetic pathway further. The
sweetpotato LCY-b (IbLCY-b) gene was isolated and characterized in transgenic calli of white-fleshed sweetpotato
using an IbLCY-b-RNAi vector. The results are discussed in
terms of carotenoid regulation and abiotic stress responses.
8139
Table 1 Primer sequences for genes involved in carotenoid biosynthesis in sweetpotato
Target name
(accession no.)
Sequence
Direction
GGPS
TAAGACGGAGAGCGTGGAGA
FOR
(HQ828090)
TGGGATGACCTTATCACCAT
REV
PSY
(HQ828092)
AAGTTCTTCGACGAGGCTGA
GCAGTTTCTTTGGCTTGCTT
FOR
REV
PDS
GTACAAAACCGTGCCAGGAT
FOR
(HQ828091)
TCCTTTAAAATCGCCTGTGC
REV
ZDS
ATAGCATGGAAGGAGCAACG
FOR
(HQ828088)
AGCTCATCAGATACAGCAGCAG
REV
CHY-b
CAAGAGAAGGACCGTTCGAG
FOR
(HQ828095)
GACGAACATGTAGGCCATCC
REV
LCY-e
ACCAGTTGGAGGATCATTGC
FOR
(HQ828096)
CACCCATACCAGGACTTCGT
REV
LCY-b
ATGGTGTGACGATTCAAGCA
FOR
(HQ828094)
GCCAATCCATGAAAACCATC
REV
P450
CAGCCAGGGAAATGGTGAGT
FOR
(JX177357)
CAGCAAGTGTGCAAAAGGAG
REV
Materials and methods
ZEP
TGGTACTTGGATCACCGACA
FOR
Plant materials
(BJ828089)
NCED
GCTGCCTGCAAAACTTTCAT
GGGAAGATCCCGGAGTGTAT
REV
FOR
(BJ563195)
GGACCAATCTATGCGTCTCC
REV
CCD1
CGGTGGAGAAACTCACGATT
FOR
(KF30658)
TCCCGATATCTTCGGCATAG
REV
ARF
CTTTGCCAGAAGGAGATGC
FOR
(JX177359.1)
TCTTGTCCTGACCACCAACA
REV
Sweetpotato (Ipomoea batatas L. Lam. cv. Yulmi) plants
were kindly provided by the Bioenergy Crop Research
Center, National Institute of Crop Science, Rural Development Administration, Korea. Nonembryogenic sweetpotato calli induced from shoot apical meristems were used
as experimental material, following the method reported by
Kim et al. [14].
Construction of RNAi vector
To clone a partial IbLCY-b cDNA from sweetpotato, primers
for LCY-b were synthesized based on the sequence of IbLCYb (accession no. JX393306). A partial IbLCY-b fragment was
amplified from cDNA isolated from the SR of sweetpotato
(cv. Shinhwangmi) by RT-PCR using advantage 2 pfu DNA
polymerase mix (Clontech, Japan). The LCY-b primer sets
were as follows: 50 -TAGATATGAAGGATATTCAGG
AAAG-30 and 50 -AGTAGAATATCCATACCAAAAC
AGA-30 . Then, a PCR product was cloned into the pGEM-T
Easy vector (Promega, USA) and sequenced. For construction of the IbLCY-b-RNAi vector, IbLCY-b primers were
designed from the sequence of a partial IbLCY-b fragment
with restriction enzyme sites [(EcoRI and XhoI, underlined)]: 50 -GAATTCGTTAAATTTCATCAAGCCAAGG
TT-30 ; 50 -CTCGAGGACGTTGATACCTAAGTGCCTT
AA-30 . PCR was performed in a 20 lL reaction containing
1 lg of cDNA template and 0.1 lM of LCY-b primers under
the following conditions: an initial denaturation step at 95 °C
for 2 min, followed by 30 cycles of denaturation at 95 °C for
20 s, annealing at 64 °C for 30 s, polymerization at 72 °C for
30 s and a final extension at 72 °C for 10 min. PCR product
was cloned into the pGEM-T Easy vector. The pGEM::IbLCY-b vector was digested with EcoRI and XhoI, and
ligated into the pENTR11 vector, which was already digested with the same enzymes. The pENTR11-IbLCY-b clones
were subjected to site-specific recombination catalyzed by
the LR Clonase enzyme mix (Invitrogen, USA) into a destination vector, (i.e. plant RNAi expression vector
pH7GWIWG2(I) containing the cauliflower mosaic virus
35S promoter). The resulting expression construct was used
to transform E. coli DH5a strains. Transformants were
selected on LB agar plates containing 50 mg/L spectinomycin/streptomycin.
Transformation into sweetpotato callus
Sweetpotato calli (Ym) were transformed with Agrobacterium. tumefaciens strain EHA105 harboring the IbLCY-bRNAi expression vector according to the method described
by Kim et al. [14]. The EHA105 strain of A. tumefaciens was
123
8140
transformed with IbLCY-b-RNAi construct using the freeze–
thaw method [15]. The transformed calli were subcultured on
fresh medium at 3 week intervals for selection.
RNA isolation and qRT-PCR analysis
Wild-type callus (Ym, NT) and transgenic callus were ground
in liquid nitrogen with a mortar and pestle, and total RNA was
extracted with the Easy-Spin total RNA extraction kit
(iNtRON, Korea), according to the manufacturer’s instructions. For quantitative expression analysis of genes involved
in carotenoid biosynthesis, first-strand cDNA was generated
from total RNA (2 lg) using MMLV reverse transcriptase
(Promega, USA), according to the manufacturer’s instructions. Quantitative RT-PCR was performed in a fluorometric
thermal cycler (DNA Engine Opticon 2, MJ Research, Waltham, MA, USA) using Evergreen fluorescent dye, according
to the manufacturer’s instructions. The expression levels of
genes related to carotenoid biosynthesis were analyzed by
quantitative RT-PCR using the gene-specific primers listed in
Table 1. The inter-experimental quality control comparisons
of repeated samples were assessed using Ct values among the
three replications. Liner data were normalized to the mean Ct
of ARF as reference gene, and the relative expression ratio was
using the 2D-Dct methods.
Analysis of carotenoid contents
Carotenoids were extracted from calli and analyzed by
HPLC, according to a method previously described by Lim
et al. [16] and following the method reported by Kim et al.
[14]. The carotenoid content was measured by HPLC
analysis with a minimum of five different calli. All contents were expressed as the mean (the average value of
content per gram DW) ± SD (standard deviation) of two
independent determinations.
Analysis of radical-scavenging activity
The DPPH radical-scavenging activity of the cells was measured as previously described [17], with some modification by
Kim et al. [14]. The absorbance of the resulting solution was
measured spectrophotometrically at 517 nm against a blank
(MeOH). L-ascorbic acid (AsA, 0.015–0.125 mM) was used
as the standard for the calibration curve, and the DPPH radical-scavenging activities were expressed as mole AsA
equivalents per gram of tested samples.
Mol Biol Rep (2014) 41:8137–8148
Fig. 2 Characterization and structural analysis of IbLCY-b. a Amino c
acid sequences were deduced from LCY-b genes of 11 plants.
b Phylogenetic analysis of IbLCY-b with other plant LCY-b. The
evolutionary history was inferred using the neighbor-joining method
and evolutionary analyses were conducted in MEGA 6. c Distribution
of the IbLCY-b gene in various sweetpotato tissues. FR fibrous root,
SR storage root. d Expression patterns of the IbLCY-b gene under
various abiotic stress conditions in sweetpotato leaves. Different
letters indicate statistically significant differences between the means
(P \ 0.05) for time 0. Data are the average of three replicates.
Statistical analyses were carried out using a one-way ANOVA with
the least-significant difference post hoc test (*P \ 0.05; **P \ 0.01)
contents, each callus was placed in a 1 mg/ml solution of
DAB-HCl (pH 3.8) for 5 h at 25 °C under continuous light,
as described previously [18]. Oxidized DABs were visualized in cells as dark-polymerization products from the
reaction of DAB with H2O2.
PEG-mediated drought stress
To produce drought stress conditions, plates infused with PEG
6,000 (polyethylene glycol) were used according to a modified
version of the method reported in Verslues et al. [19]. PEGinfused plates were prepared by dissolving solid PEG in a
sterilized solution of half-strength MS medium with 6 mM
MES buffer (pH 5.7), followed by overlaying of the PEG
solution onto agar-solidified half-strength MS medium plates
containing 7 % phytoagar. PEG water potential values were
calculated from the van’t Hoff equation. The agar medium and
PEG solution were equilibrated for at least 12 h before the
excess PEG solution was removed. The addition of high
sucrose concentrations can induce an osmotic response and
thus we used half-strength MS medium without sucrose.
Analysis of water content
The degree of dehydration in tissues was assessed by measuring the water content (WC) of transgenic calli after PEG
treatment. WC was measured using the following formula:
WC (%) = (Fresh weight - Dry weight)/Fresh weight [20].
Analysis of lipid peroxidation
Lipid peroxidation was measured using a modified thiobarbituric acid method [21], whereby the specific absorbance of extracts was recorded at A532. Nonspecific
absorbance was measured at A600 and then subtracted
from the A532 readings. The concentration of MDA was
calculated as a measure of lipid peroxidation.
DAB staining assay
Analysis of ABA content
Transgenic and nontransgenic calli were treated with
MS1D liquid medium containing 150 and 200 mM NaCl
for 24 h and then harvested. To measure cellular H2O2
123
The ABA content of sweetpotato callus was measured
using a Phytodetek ABA enzyme immunoassay test kit
Mol Biol Rep (2014) 41:8137–8148
8141
123
8142
Fig. 2 continued
Mol Biol Rep (2014) 41:8137–8148
B
C
(Agdia, USA), as described elsewhere [22], with slight
modifications. Color was detected with the Bio-Rad i-Mark
Microplate Reader at a wavelength of 405 nm (Bio-Rad,
USA). Three independent experiments were performed.
Statistical analysis
Data were analyzed by one-way analysis of variance
(ANOVA). The subsequent multiple comparisons were
examined based on the least-significant difference test. All
statistical analyses were performed using the Statistical
Package for the Social Sciences (SPSS 12). Statistical
significance was set at P [ 0.05 and P [ 0.01.
Results
IbLCY-b isolation and sequence analysis
We isolated the IbLCY-b gene (accession no. JX393306)
from leaves of sweetpotato (cv. Shinhwangmi). IbLCY-b
had a length of 1,506 bp, which encoded 502 amino acid
residues. The IbLCY-b nucleotide sequence showed
123
D
96 % homology with LCY-b of Ipomoea sp. Kenyan
(accession no. BAI47577). IbLCY-b showed 81, 81, and
80 % sequence identity with LCY-b of Solanum tuberosum (accession no. XP006364433), S. lycopersicum
(accession no. NP001234226.1), and Nicotiana tabacum
(accession no. Q43578.1), respectively. The alignment
of deduced amino acid sequence showed 98, 87, and
86 % sequence identity with LCY-b of Ipomoea sp.
Kenyan, S. tuberosum chloroplastic-like LCY-b, and S.
lycopersicum chloroplastic-like LCY-b, respectively
(Fig. 2a). IbLCY-b has conserved motifs related to
dinucleotide-binding motif in a specific protein region,
which could be involved in the enzyme-substrate interaction, in membrane association, and in catalysis, such
as the cyclase motif I, II, and a charged region in LCYbs. A domain named b-cyclase motif is fully conserved
in all plant LCY-b; this domain is essential for lycopene
b-cyclase activity [1, 23] (Fig. 2a). A phylogenetic tree
was generated for IbLCY-b and the other nine plant
LCY-bs (Fig. 2b). The phylogenic tree showed that
IbLCY-b is more closely related to S. lycopersicum and
N. tabacum LCY-b, especially the chloroplast-specific
LCY-b.
Mol Biol Rep (2014) 41:8137–8148
Fig. 3 Characterization of
transgenic IbLCY-b-RNAi
sweetpotato calli.
a Construction of the CaMV
35S promoter::IbLCY-b-RNAi
vector. b Phenotypes of
transgenic sweetpotato calli
overexpressing IbLCY-b-RNAi.
c Expression of IbLCY-b in
transgenic sweetpotato calli.
Different letters indicate
statistically significant
differences between the means
(P \ 0.05) for nontransgenic.
d 2, 2-diphenyl-1picrylhydrazyl (DPPH) radicalscavenging activity in
transgenic IbLCY-b-RNAi
sweetpotato calli. Data are the
means of three replicates.
Statistical analyses were carried
out using a one-way analysis of
variance with the leastsignificant difference post hoc
test (*P \ 0.05; **P \ 0.01)
8143
A
B
C
Tissue-specific IbLCY-b expression and response
to abiotic stress
IbLCY-b expression was investigated in leaf, stem, fibrous
root (FR), and storage root (SR) of sweetpotato (Fig. 2c).
IbLCY-b was strongly expressed in leaf tissue and was
weakly expressed in FRs. The expression of IbLCY-b under
abiotic stresses such as salt-stress (NaCl), osmotic-stress
(PEG polyethylene glycol), H2O2, and cold was investigated in leaf tissues. At 24 h after treatment (Fig. 2d), the
IbLCY-b transcript level was significantly higher in
response to NaCl and PEG treatments, whereas the transcript level was lower in response to cold temperature
(4 °C). These results suggest that IbLCY-b might be
involved in tolerance to osmotic or drought stress.
Biochemical characterization of transgenic IbLCY-bRNAi sweetpotato calli
The function of IbLCY-b in lycopene accumulation in
sweetpotato was investigated by suppressing LCY-b.
Transgenic sweetpotato calli expressing a 430 bp partial
LCY-b construct fused with the RNAi (IbLCY-b-RNAi)
under the control of the CaMV 35S promoter were prepared
by Agrobacterium-mediated transformation (Fig. 3a).
Forty-one transgenic cell lines were obtained and subsequently confirmed by genomic PCR analysis (data not
shown). The colors of transgenic IbLCY-b-RNAi calli were
yellow to orange, compared with white for nontransgenic
D
(NT) calli (Fig. 3b). Three independent transgenic lines with
low IbLCY-b expression levels (Fig. 3c) were selected for
further characterization. The expression of IbLCY-b transcripts was dramatically reduced in all transgenic lines, but
remained high in NT lines (Fig. 3c). All transgenic lines in
this study also exhibited greater 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity (Fig. 3d).
To confirm the observed color changes in transgenic
calli expressing IbLCY-b-RNAi, the carotenoid contents in
transgenic callus lines were quantitatively analyzed using
high-performance liquid chromatography (HPLC) (Fig. 4).
The contents of total carotenoids in transgenic IbLCY-bRNAi calli were approximately 4.3–5.0 times higher than
those in NT calli. The content of each carotenoid from abranch and b-branch pathways in the transgenic lines was
higher than that in NT calli. In particular, a-carotene did
not accumulate in NT calli, whereas the a-carotene content
in all transgenic lines was approximately 1.1–2.7 lg/g dry
weight (DW). The b-carotene contents in transgenic
IbLCY-b-RNAi lines were approximately 1.4–1.8 times
higher than those in NT calli. The contents of 13Z-b-carotene in transgenic calli were approximately 4.3–5.1 times
higher than those in NT calli, whereas the contents of 9Zb-carotene in transgenic calli were approximately 4.8–7.8
times higher than those in NT calli. The contents of
cryptoxanthin, zeaxanthin, and violaxanthin also significantly increased in transgenic calli.
Lycopene was not detected in transgenic and NT calli,
even though IbLCY-b was down-regulated in transgenic
123
8144
Mol Biol Rep (2014) 41:8137–8148
Fig. 4 Quantitative highperformance liquid
chromatography (HPLC)
analysis of total carotenoid
contents and carotenoid
compounds in transgenic
IbLCY-b-RNAi sweetpotato
calli. Each carotenoid was
measured by HPLC using a
minimum of five different calli.
All levels are expressed as the
mean (the average content in
gram dry weight) ± standard
deviation of two independent
determinations
calli. To understand why transgenic IbLCY-b-RNAi calli
did not accumulate lycopene, the expression levels of genes
involved in carotenoid biosynthesis in transgenic and NT
calli were compared (Fig. 5). The results show that transcript levels of GGPS, PSY, CHY-b and cytochrome P450
monooxygenases (P450) in transgenic lines were significantly higher than those in NT cells.
However, the transcript levels of PDS, ZDS, LCY-e,
zeaxanthin epoxidase (ZEP) and 9-cis-epoxycarotenoid
dioxygenase (NCED) were lower than those in NT lines.
Carotenoid cleavage dioxigenase (CCD1) had high
expression levels in transgenic lines #2 and #17.
diaminobenzidine (DAB) staining, which turns to a dark
brown color when oxidized by H2O2 (Fig. 6a). Transgenic
IbLCY-b-RNAi calli retained a yellow color, indicating that
oxidized species and DAB reactants were reduced. The NT
calli (Ym) developed a dark brown color, indicating the
accumulation of oxidized species and peroxides. Oxidized
DAB contents in transgenic calli were significantly lower
than those in NT cells, reflecting the oxidation damage in
NT calli (Fig. 6b).
Transgenic IbLCY-b-RNAi calli have greater tolerance
to salt stress
To evaluate the drought tolerance of transgenic IbLCY-bRNAi calli, transgenic and NT callus lines were treated
with PEG for 72 h. Visible damage was apparent in NT
calli, whereas transgenic calli retained essentially the same
color (Fig. 7a). After 72 h of PEG treatment, the water
content in transgenic calli was significantly higher than that
in NT cells (Fig. 7b). Malondialdehyde (MDA) contents
To assess the effects of IbLCY-b down-regulation on tolerance to oxidative stress induced by salt, 2 week-old calli
were treated with 150 or 200 mM NaCl for 24 h. Saltinduced oxidative stress in calli was visualized with 30 , 30 -
123
Transgenic IbLCY-b-RNAi calli have greater tolerance
to drought stress
Mol Biol Rep (2014) 41:8137–8148
8145
Fig. 5 Expression patterns of
genes involved in carotenoid
biosynthesis in transgenic
sweetpotato calli expressing
IbLCY-b-RNAi. Different
letters indicate statistically
significant differences between
the means (P \ 0.05) for
nontransgenic. GGPS
geranylgeranyl pyrophosphate,
PSY phytoene synthase, PDS
phytoene desaturase, ZDS fcarotene desaturase, LCY-b
lycopene b-cyclase, LCY-e
lycopene e-cyclase, CHY-b bcarotene hydroxylase, P450
cytochrome P450
monooxygenases, ZEP
zeaxanthin epoxidase, NCED
9-cis-epoxycarotenoid
dioxygenase, CCD1 carotenoid
cleavage dioxigenase 1. Data
are the means of three
replicates. Statistical analyses
were carried out using a oneway analysis of variance with
the least-significant difference
post hoc test (*P \ 0.05;
**P \ 0.01)
were also significantly lower in transgenic lines compared
to that for NT lines (Fig. 7c). We investigated the relationship between greater drought tolerance and the levels
of abscisic acid (ABA), the drought-stress-related plant
hormone. ABA levels were compared in both transgenic
and NT calli, with the content in transgenic calli approximately 1.4 times higher than that in NT cells (1.98 pM/mL)
(Fig. 8).
Discussion
As a key branch point in the carotenoid biosynthesis pathway, LCY-b introduces a ring at both ends of lycopene to
form a-carotene and b-carotene in plant plastids. To characterize the sweetpotato LCY-b gene (IbLCY-b), we isolated
it and transformed it into white-fleshed sweetpotato culture
cells using an IbLCY-b-RNAi vector. IbLCY-b has a length
of 1,506 bp and contains the conserved regions of plant
LCY-bs, which was determined by comparing the amino
acidic sequence of IbLCY-b with LCY-b sequences of ten
other plants. The plant LCY-b conserved region, containing
dinucleotide-binding domain, cyclase motifs (CM) I and II,
and a charged region, is proposed to be essential for the
association of LCY-b with membrane components and also
for its catalytic activity [1, 8, 23, 24] (Fig. 2a). The chloroplast-specific LCY-b of S. lycopersicum and N. tabacum had
three and four amino acid changes, respectively [23]. The
CM I and II and the charged region were the same or with one
amino acid change in S. lycopersicum and N. tabacum,
respectively. These results indicate that IbLCY-b is closely
correlated with the chloroplast-specific LCY-b family.
123
8146
Mol Biol Rep (2014) 41:8137–8148
A
A
B
B
Fig. 6 Transgenic sweetpotato calli expressing IbLCY-b have greater
tolerance to salt-induced oxidative stress. a Visible damage of
transgenic and nontransgenic Ym sweetpotato calli treated with a 30 ,
30 -diaminobenzidine (DAB)-HCl solution after treatment with 150
and 200 mM NaCl for 24 h. b Analysis of oxidized DAB contents in
transgenic IbLCY-b and nontransgenic Ym sweetpotato calli after
treatment with 150 mM NaCl. Data are the means of three replicates.
Statistical analyses were carried out using a one-way analysis of
variance with the least-significant difference post hoc test (*P [ 0.05;
**P [ 0.01)
In our previous studies, we characterized the function of
IbCHY-b and IbLCY-e in transgenic calli by down-regulating their expression using RNAi technology [13, 14]. For
the current study of carotenoid biosynthesis, transgenic
sweetpotato culture cells were chosen as a model system
because transgenic calli can be easily prepared and compared with transgenic sweetpotato plants [13, 14]. We
constructed an IbLCY-b-RNAi vector and introduced it into
white-fleshed sweetpotato culture cells by Agrobacteriummediated transformation. Three independent transgenic
lines with low expression levels of IbLCY-b (Fig. 3c) were
selected for detailed characterization. All transgenic lines
in this study displayed significantly higher levels of total
and individual carotenoids than those in NT calli (Fig. 4).
Lycopene did not accumulate in transgenic calli. We
anticipated that lycopene would accumulate in transgenic
calli due to down-regulation of IbLCY-b, even though
sweetpotato does not accumulate lycopene in SRs. We
suggest that sweetpotato converts lycopene to other
metabolites, so lycopene levels do not become elevated.
There are several possible reasons why transgenic calli do
not accumulate lycopene. First, transgenic sweetpotato
123
C
Fig. 7 Effect of drought (-0.5 MPa) stress on transgenic IbLCY-b RNAi calli. a Visible damage of sweetpotato calli after treatment with
PEG for 72 h. b Water content in sweetpotato calli after treatment
with PEG for 72 h. c Quantitative analysis of lipid peroxidation in
sweetpotato calli after PEG treatment for 72 h. Malondialdehyde
(MDA) is a measure of lipid peroxidation. Data represent the average
of three replicates. Statistical significance of differences between the
control and transgenic lines were determined by one-way analysis of
variance with the least-significant difference post hoc test (*P [ 0.05;
**P [ 0.01)
culture cells did not have well differentiated chloroplasts.
IbLCY-b had high homology with the tomato chloroplastspecific LCY-b, SlLcyb [11, 25]. In tomato, SlLcyb is
preferentially expressed in green leaves, where the conversion of lycopene to b-carotene and a-carotene is usually
complete [25]. The LCY genes are differentially expressed
in photosynthetic and nonphotosynthetic organs; thus it is
probably partially true that culture cells can lose the
potential to accumulate lycopene in the cell independently
from that induced by gene expression. Second, LCY-b is
encoded by a single gene in several plants including
Mol Biol Rep (2014) 41:8137–8148
8147
with greater abiotic stress tolerance through the metabolic
engineering of carotenoid biosynthesis.
Genomic information for sweetpotato is very limited
compared to its agronomic importance. The biosynthetic
pathway will become fully known after completing the
whole-genome sequencing of sweetpotato in the near future.
Transgenic sweetpotato plants expressing the IbLCY-bRNAi vector should be generated and characterized in terms
of carotenoid content and abiotic stress tolerance. In summary, our results show that it should be possible to generate
transgenic plants with increased tolerance to environmental
stresses and enriched nutritional value by manipulating the
genes involved in carotenoid biosynthesis.
Fig. 8 Analysis of abscisic acid (ABA) content in transgenic IbLCYb-RNAi and nontransgenic Ym sweetpotato calli. Data represent the
average of three replicates. Statistical significance of differences
between the control and transgenic lines was determined by one-way
analysis of variance with the least-significant difference post hoc test
(*P [ 0.05; **P [ 0.01)
Arabidopsis, rice, and maize. Tomato, pepper, papaya, and
orange plants have organ-specific LCY-b function mediated
by small gene families [1, 6, 9–11, 23, 26–31]. By contrast,
tomato fruit-specific LCY-b can elevate b-carotene accumulation without a concomitant decrease in total carotenoids [7]. We can expect that sweetpotato also has multiple
LCY-b genes to regulate lycopene accumulation. In spite of
the observed LCY-b down-regulation, a-branch and bbranch carotenoids such as b-carotene and a-carotene,
respectively, displayed high levels of accumulation in
transgenic IbLCY-b-RNAi lines. Finally, CCD1 gene
expression was significantly higher in transgenic lines.
CCDs might be involved in oxidative cleavage of carotenoids such as lycopene, a-carotene, b-carotene, and zeaxanthin to generate apocarotenoids [32]. Bixa orellana
CCD1 is related to carotenoid dioxygenases cleavage of
lycopene [33]. In this study, transgenic lines with high
levels of CCD1 expression can convert lycopene to
cleavage metabolites mediated by CCD1. This scenario
remains to be studied.
Recent studies have demonstrated that increased carotenoid levels mediated by plant metabolic engineering
improves the responses to abiotic stresses such as salt
stress, drought stress, and oxidative stress [13, 14, 34, 35].
In the present study, DPPH radical activity and ABA
content in transgenic lines was much higher than that in the
NT line, indicating that the IbLCY-b-RNAi vector might
contribute to abiotic stress tolerance on the whole-plant
level. The antioxidant activity of carotenoids involves
quenching of singlet oxygen and rapid interaction with
peroxyl radicals (ROO), as opposed to that of unsaturated
acyl chains [36–38]. ABA is a well-known plant hormone
that responds to abiotic stress [39, 40]. This study demonstrates that it is possible to develop transgenic plants
Acknowledgments This work was supported by ‘‘Cooperative
Research Program for Agriculture Science & Technology Development
(Project Nos. PJ009506, PJ009488 and PJ008097)’’ the Rural Development Administration, Republic of Korea, and the KRIBB Initiative
Program.
References
1. Cunningham FX, Pogson B, Sun Z, McDonald KA, DellaPenna D,
Gantt E (1996) Functional analysis of the beta and epsilon lycopene
cyclase enzymes of Arabidopsis reveals a mechanism for control of
cyclic carotenoid formation. Plant Cell 8(9):1613–1626
2. Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis in plants. Annu Rev Plant Physiol Plant Mol
Biol 49:557–583
3. Goodwin T (1980) The biochemistry of the carotenoids, vol
1(2nd edn). Chapman & Hall, London
4. Ronen GCM, Zamir D, Hirschberg J (1999) Regulation of
carotenoid biosynthesis during tomato fruit development:
expression of the gene for lycopene epsilon-cyclase is downregulated during ripening and is elevated in the mutant Delta.
Plant J 17:341–351
5. Giovannucci E, Rimm E, Liu Y, Stampfer M, Willett W (2002) A
prospective study of tomato products, lycopene, and prostate
cancer risk. J Natl Cancer Inst 94:391–398
6. Ronen G, Carmel-Goren L, Zamir D, Hirschberg J (2000) An
alternative pathway to beta-carotene formation in plant chromoplasts discovered by map-based cloning of Beta and old-gold
color mutations in tomato. Proc Natl Acad Sci USA
97:11102–11107
7. Rosati C, Aquilani R, Dharmapuri S, Pallara P, Marusic C,
Tavazza R, Bouvier F, Camara B, Giuliano G (2000) Metabolic
engineering of beta-carotene and lycopene content in tomato
fruit. Plant J 24(3):413–420
8. Hugueney P, Badillo A, Chen H-C, Klein A, Hirschberg J,
Camara B, Kuntz M (1995) Metabolism of cyclic carotenoids: a
model for the alteration of this biosynthetic pathway in Capsicum
annuum chromoplasts. Plant J 8(3):417–424
9. Alquézar B, Zacarı́as L, Rodrigo MJ (2009) Molecular and
functional characterization of a novel chromoplast-specific
lycopene b-cyclase from Citrus and its relation to lycopene
accumulation. J Exp Bot 60(6):1783–1797
10. Devitt LC, Fanning K, Dietzgen RG, Holton TA (2010) Isolation
and functional characterization of a lycopene b-cyclase gene that
controls fruit colour of papaya (Carica papaya L.). J Exp Bot
61(1):33–39
123
8148
11. Pecker I, Gabbay R, Cunningham F Jr, Hirschberg J (1996)
Cloning and characterization of the cDNA for lycopene b-cyclase
from tomato reveals decrease in its expression during fruit ripening. Plant Mol Biol 30(4):807–819
12. Ziska LHRG, Tomecek M, Prior SA, Torbet HA, Sicher R (2009)
An evaluation of cassava, sweetpotato and field corn as potential
carbohydrate sources for bioethanol production in Alabama and
Maryland. Biomass Bioenergy 33:1503–1508
13. Kim SH, Ahn YO, Ahn M-J, Jeong JC, Lee H-S, Kwak S-S
(2013) Downregulation of the lycopene epsilon-cyclase gene
increases carotenoid synthesis via the b-branch-specific pathway
and enhances salt-stress tolerance in sweetpotato transgenic calli.
Physiol Plant 147:432–442
14. Kim SH, Ahn YO, Ahn M-J, Lee H-S, Kwak S-S (2012) Downregulation of b-carotene hydroxylase increases b-carotene and
total carotenoids enhancing salt stress tolerance in transgenic
cultured cells of sweetpotato. Phytochemistry 74:69–78
15. Hofgen R, Willmitzer L (1988) Storage of competent cells for
Agrobacterium transformation. Nucl Acids Res 16:9877
16. Lim CJ, Kim HY, Lee CH, Kim Y, Back K, Bae J-M, Lee SW,
Ahn M-J (2009) Variation in carotenoid composition in carrots
during storage and cooking. J Food Sci Nutr 14:240–245
17. Pieroni A, Janiak V, Durr CM, Ludeke S, Trachsel E, Heinrich M
(2002) In vitro antioxidant activity of non-cultivated vegetables
of ethnic Albanians in southern Italy. Phytother Res
16(5):467–473
18. Chadwick CA, Potten CS, Nikaido O, Matsunaga T, Proby C,
Young AR (1995) The detection of cyclobutane thymine dimers
(6-4) photolesions and the dewar photoisomers in sections of UVirradiated human skin using specific antibodies, and the demonstration of depth penetration effects. J Photochem Photobiol B
28(2):163–170
19. Verslues PEAM, Katiyar-Agarwal S, Zhu J, Zhu J-K (2006)
Methods and concepts in quantifying resistance to drought, salt
and freezing, abiotic stresses that affect plant water status. Plant J
45:523–539
20. Zhao LZF, Guo J, Yang Y, Li B, Zhang L (2004) Nitric oxide
functions as a signal in salt resistance in the calluses from two
ecotypes of reed. Plant Physiol 134:849–857
21. Peever TLHV (1989) Electrolyte leakage, lipoxygenase, and lipid
peroxidation induced in tomato leaf tissue by specific and nonspecific elicitors from Cladosporium fulvum. Plant Physiol
90:867–875
22. Artsaenko OPM, Zur Nieden U, Fiedler U, Weiler EW, Müntz K,
Conrad U (1995) Expression of a single-chain Fv antibody
against abscisic acid creates a wilty phenotype in transgenic
tobacco. Plant J 8:745–750
23. Moreno JC, Pizarro L, Fuentes P, Handford M, Cifuentes V,
Stange C (2013) Levels of lycopene b-cyclase 1 modulate
carotenoid gene expression and accumulation in Daucus carota.
PLoS One 8(3):e58144
24. Beyer P, Kröncke U, Nievelstein V (1991) On the mechanism of
the lycopene isomerase/cyclase reaction in Narcissus pseudonarcissus L. chromoplasts. J Biol Chem 266(26):17072–17078
123
Mol Biol Rep (2014) 41:8137–8148
25. Apel W, Bock R (2009) Enhancement of carotenoid biosynthesis
in transplastomic tomatoes by induced lycopene-to-provitamin A
conversion. Plant Physiol 151(1):59–66
26. Ahrazem O, Rubio-Moraga A, López RC, Gómez-Gómez L
(2010) The expression of a chromoplast-specific lycopene beta
cyclase gene is involved in the high production of saffron’s
apocarotenoid precursors. J Exp Bot 61(1):105–119
27. Bai L, Kim E-H, DellaPenna D, Brutnell TP (2009) Novel
lycopene epsilon cyclase activities in maize revealed through
perturbation of carotenoid biosynthesis. Plant J 59(4):588–599
28. Bang H, Kim S, Leskovar D, King S (2007) Development of a
codominant CAPS marker for allelic selection between canary
yellow and red watermelon based on SNP in lycopene b-cyclase
(LCYB) gene. Mol Breed 20(1):63–72
29. Chaudhary N, Nijhawan A, Khurana J, Khurana P (2010)
Carotenoid biosynthesis genes in rice: structural analysis, genome-wide expression profiling and phylogenetic analysis. Mol
Genet Genomics 283(1):13–33
30. Lange BM, Ghassemian M (2003) Genome organization in
Arabidopsis thaliana: a survey for genes involved in isoprenoid
and chlorophyll metabolism. Plant Mol Biol 51(6):925–948
31. Just BJ, Santos CAF, Fonseca MEN, Boiteux LS, Oloizia BB,
Simon PW (2007) Carotenoid biosynthesis structural genes in
carrot (Daucus carota): isolation, sequence-characterization,
single nucleotide polymorphism (SNP) markers and genome
mapping. Theor Appl Genet 114(4):693–704
32. Giuliano G, Al-Babili S, von Lintig J (2003) Carotenoid oxygenases: cleave it or leave it. Trends Plant Sci 8(4):145–149
33. Rodrı́guez-Ávila NL, Narváez-Zapata JA, Ramı́rez-Benı́tez JE,
Aguilar-Espinosa ML, Rivera-Madrid R (2011) Identification and
expression pattern of a new carotenoid cleavage dioxygenase
gene member from Bixa orellana. J Exp Bot 62(15):5385–5395
34. Luo Y, Liu YB, Dong YX, Gao X-Q, Zhang XS (2009) Expression
of a putative alfalfa helicase increases tolerance to abiotic stress in
Arabidopsis by enhancing the capacities for ROS scavenging and
osmotic adjustment. J Plant Physiol 166(4):385–394
35. Chen X, Han H, Jiang P, Nie L, Bao H, Fan P, Lv S, Feng J, Li Y
(2011) Transformation of b-lycopene cyclase genes from Salicornia europaea and Arabidopsis conferred salt tolerance in
Arabidopsis and Tobacco. Plant Cell Physiol 52(5):909–921
36. Burton GW, Ingold KU (1984) beta-carotene: an unusual type of
lipid antioxidant. Science 224:569–573
37. Krinsky NI, Yeum KJ (2003) Carotenoid-radical interactions.
Biochem Biophys Res Commun 305:754–760
38. El-Agamey ALG, McGarvey DJ, Mortensen A, Phillip DM,
Truscott TG, Young AJ (2004) Carotenoid radical chemistry and
antioxidant/pro-oxidant properties. Arch Biochem Biophys
430:37–48
39. Zhu JK (2002) Salt and drought stress signal transduction in
plants. Annu Rev Plant Biol 53(1):247–273
40. Li XJ, Yang MF, Chen H, Qu LQ, Chen F (1804) Shen SH (2010)
Abscisic acid pretreatment enhances salt tolerance of rice seedlings: proteomic evidence. Biochim Biophys Acta 4:929–940