* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download APBioTech 2015 16
Gene therapy wikipedia , lookup
Gene prediction wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Somatic cell nuclear transfer wikipedia , lookup
Cellular differentiation wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Restriction enzyme wikipedia , lookup
Point mutation wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Genetic engineering wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
DNA vaccination wikipedia , lookup
Genomic library wikipedia , lookup
Designer baby wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Genome editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Biotechnology DNA Cloning: An Overview Bacterium 1 Gene inserted into Cell containing gene of interest plasmid Bacterial chromosome Plasmid Recombinant DNA (plasmid) Gene of interest 2 2 Plasmid put into DNA of chromosome bacterial cell Recombinant bacterium Gene cloning involves using bacteria to make multiple copies of a gene Fig. 20-2b Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Protein expressed by gene of interest Gene of Interest Copies of gene Protein harvested 4 Basic research and Basic research on gene Gene for pest resistance inserted into plants various applications Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Basic research on protein Human growth hormone treats stunted growth Restriction Enzymes • Gene cloning was made possible by the discovery of restriction enzymes. • Many different enzymes exist – named after the organism in which they are found • EcoRI (E. coli), HindIII (Haemophilus influenza), PstI (Providencia stuartii) Fig. 20-3-1 Restriction site DNA 1 5 3 3 5 Restriction enzyme cuts sugar-phosphate backbones. Sticky end Fig. 20-3-2 Restriction site DNA 1 5 3 3 5 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. One possible combination Fig. 20-3-3 Restriction site DNA 1 5 3 3 5 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. One possible combination 3 DNA ligase seals strands. Recombinant DNA molecule Fig. 20-UN3 Vector DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR Cut by same restriction enzyme, mixed, and ligated Recombinant DNA plasmids Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) 5 Target sequence 3 Genomic DNA 1 Denaturation PCR can make billions of a specific DNA segment in a few hours. 5 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleotides Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence TECHNIQUE 3 PCR produces many copies of a specific target segment of DNA PCR Animation PCR DNA Amplification PCR Applications 30,000 y. o. woolly mammoth In forensics, PCR requires only small samples of DNA to analyze DNA polymerase (Taq) Fig. 20-9 TECHNIQUE Gel Electrophoresis One indirect method of rapidly analyzing and comparing genomes is gel electrophoresis Mixture of DNA molecules of different sizes Power source – Cathode Anode + Gel 1 Power source – + Longer molecules 2 RESULTS Shorter molecules TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA TCATCCGATCAGATCATGCTAGTACATCGATCGATACT Fig. 20-12 TECHNIQUE Primer DNA (template strand) DNA Sequencing Deoxyribonucleotides DNA polymerase DNA (template strand) Relatively short DNA fragments can be sequenced using the dideoxy chain termination method. dATP ddATP dCTP ddCTP dTTP ddTTP dGTP ddGTP Labeled strands Shortest Direction of movement of strands Longest Longest labeled strand Detector Laser RESULTS Sequencing Video Shortest labeled strand Last base of longest labeled strand Last base of shortest labeled strand Dideoxyribonucleotides (fluorescently tagged) DNA Sequencing DNA Sequencer New approaches have accelerated the pace of genome sequencing The Human Genome Project was proposed in 1986 to determine the normal sequence of all human DNA. The history of sequencing • New Generation Sequencing Millions of different fragments are sequenced at the same time. This is called massively parallel sequencing. Studying the Expression of Interacting Groups of Genes DNA microarray assays compare patterns of gene expression in different tissues, at different times, or under different conditions Microarray Video 50 µm Metagenomics Genetic diversity is explored without isolating intact organisms. From: National Academy of Science, 2009 Cloning organisms has the potential to generate stem cells for research • Organismal cloning produces one or more organisms genetically identical to the “parent” that donated the single cell Fig. 20-16 Can a differentiated plant cell develop into a whole plant? EXPERIMENT RESULTS Transverse section of carrot root 2-mg fragments Fragments were cultured in nutrient medium; stirring caused single cells to shear off into the liquid. Single cells began to divide. Embryonic plant developed from a cultured single cell. Plantlet was cultured on agar medium and later, planted in soil. A single somatic carrot cell developed into a mature carrot plant. Can the nucleus from a differentiated animal cell direct development of an organism? Fig. 20-17 Frog egg cell Frog tadpole EXPERIMENT Frog embryo UV Less differentiated cell Fully differentiated (intestinal) cell Donor nucleus transplanted Donor nucleus transplanted Enucleated egg cell Egg with donor nucleus activated to begin development RESULTS Most develop into tadpoles Most stop developing before tadpole stage TECHNIQUE Reproductive cloning of a mammal Mammary by nuclear transplantation cell donor Egg cell donor 2 1 In 1997, Scottish researchers announced the birth of Dolly Egg cell from ovary 3 Cells fused Cultured mammary cells 3 4 Grown in Nucleus removed Nucleus from mammary cell culture Early embryo 5 Implanted in uterus of a third sheep Surrogate mother 6 Embryonic development RESULTS Lamb (“Dolly”) genetically identical to mammary cell donor Fig. 20-19 CC (for Carbon Copy) was the first cat cloned The practical applications of DNA technology • Many fields benefit from DNA technology and genetic engineering A stem cell is a relatively unspecialized cell that can reproduce itself indefinitely and differentiate into specialized cells of one or more types Embryonic stem cells Adult stem cells Early human embryo at blastocyst stage (mammalian equivalent of blastula) From bone marrow in this example Cells generating all embryonic cell types Cells generating some cell types Cultured stem cells Different culture conditions Stem cell animation Nuclear implantation Different types of differentiated cells Liver cells Nerve cells Blood cells Fig. 20-22 Cloned gene Gene therapy 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 Retrovirus capsid Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient 4 Inject engineered cells into patient. Bone marrow Fig. 20-25 TECHNIQUE Agrobacterium tumefaciens Genetic engineering in plants has been used to transfer many useful genes Ti plasmid Site where restriction enzyme cuts T DNA DNA with the gene of interest RESULTS Recombinant Ti plasmid Plant with new trait Plant Breeding compared to Genetic Modification of Plants GHOSTS Fig. 20-11 TECHNIQUE DNA + restriction enzyme Restriction fragments I II III Heavy weight Nitrocellulose membrane (blot) Gel Sponge I Normal -globin allele II Sickle-cell allele III Heterozygote 1 Preparation of restriction fragments Paper towels Alkaline solution 2 Gel electrophoresis 3 DNA transfer (blotting) Radioactively labeled probe for -globin gene I II III Probe base-pairs with fragments Fragment from sickle-cell -globin allele Nitrocellulose blot 4 Hybridization with radioactive probe Fragment from normal -globin allele I II III Film over blot 5 Probe detection