Download Genetic Engineering

 People
have been practicing gene manipulation for
hundreds of years
 One way we have been practicing genetic
engineering is through a process called selective
breeding.
 Selective breeding occurs when we choose
animals with favorable traits and breed those
animals and do not breed animals with traits we
find unfavorable.
 Selective
breeding is
regulated by two principles”
• Hybridization – crossing two
organisms that are not similar to
hopefully get the best of both
organisms
• Inbreeding – breeding very similar
animals to preserve the traits the
are present in that line of
organisms. This can cause
recessive alleles present in these
lines to show up causing
unnecessary illness.
Sometimes we want new varieties of
an organism, so we induce mutation.
 Mutations are the main source of
genetic variation, it’s how new traits
form
 Breeders can use radiation and chemicals to force
mutations to occur.
 Most of the time these mutations are harmful to the
organism, but occasionally a favorable mutation will
appear.
 This is an ethical issue with animals, so we only practice
these methods with bacteria and plants

 Genetic
engineering is making changes in
the DNA code of a living organism
 We already know that we have read certain
organisms DNA sequence, and that we can
analyze it using gel electrophoresis, but we
can also transform DNA using recombinant
DNA and viruses
 Restriction
enzymes are proteins that cut DNA at
specific sites.
 For example BamI cuts DNA wherever it sees at
CTAG sequence.
 So, where would BamI cut this strand of DNA?
GTCTAGCGTACACTGCTAGAACGT
CAGATCGCATGTGACGATCTTGCA
 Synthetic
DNA can be made in a lab using a
machine called a DNA synthesizer.
 The scientists can join natural pieces of DNA
to synthesized one using enzymes that splice
DNA back together
 They can also combine DNA from two
completely different organisms together
 This is called recombinant DNA because it
combines the DNA from two different
sources together
 This
is a process that allows
us to make many copies of a
strand of DNA very quickly
 The first step is to denature
the DNA or separate the two strands
 This is done by heating the DNA up to about 9496oC
 Then we lower the temperature and add
primers that will attach to specific sequences in
the DNA
 The polymerase attaches to the DNA strand and
replicates a complimentary strand of DNA
 This
process is repeated continually creating
copies of copies of copies and increasing the
amount of DNA exponentially
 This process allows researchers to make many
copies of unique
segments of DNA and
store them or share them
 That way if we find a tiny
sample of DNA at a crime
scene we can replicate it
to make as much as we
want to test many times
?
 Transformation
–
when a cell takes
DNA from outside
the cell and
integrates it into the
cell’s own DNA
 This can be done
three ways
• Natural uptake of DNA
from surroundings
• Injection with a needle
• Using a virus to inject
the DNA
Some bacteria are able to
naturally able to pick up DNA
and sometimes humans control
it
 Scientists create a piece of DNA
called a plasmid
 These plasmids need to have a
origin for replication and two
ends that a specific restriction
enzyme will cut
 Wherever it cuts the bacterial
DNA is where the plasmid is
inserted
 Sometimes these changes add a
gene that make a bacterial cell
resistant to antibiotics

 DNA
can be inserted
into larger cells such
as egg cells with a
needle
 We also use viruses
to inject DNA into
cells
 A virus naturally injects its own DNA into
other cells, so if we replace the harmful virus
DNA with a favorable gene the virus will
inject that gene into the cell.
 Sometimes
we just
randomly insert
needed recombinant
genes into the DNA, but
sometimes we target
specific areas for
insertion
 We can target specific
genes that are
unfavorable and insert
the recombinant genes
in its place so it
“knocks out” that gene
Recombinant DNA
Host Cell DNA
Target Gene
Modified Host Cell DNA
 It
allows us to create transgenic organisms that
help support our population
• Pest resistant crops
• Crops with added nutrients that taste better
• Cows who produce more growth hormone
• Plants or bacteria that will produce plastics
 We
can use small, quickly reproducing organisms
to generate medicine cheaply
• Bacteria can contain genes to make insulin or human
growth hormone
• Some microorganisms were developed to digest oil
 We
can insert some of our DNA into animals to
study the affects of disease
 Stem
cells are cells that have
not yet differentiated and
can become any type of cell
still
 There are adult stem cells,
and embryonic stem cells,
but adult stem cells can only
produce one type of cell
 So, it is more beneficial to
use embryonic stem cells for
research, but it requires
destroying an embryo.
 Stem cells could possibly be used to produce any
other type of cell or structure, they could be used
to cure diseases
 In
1997 we successfully cloned our first
mammal, a sheep named Dolly
 They took a cell from one sheep and an egg
cell from another.
 They removed the nucleus from the egg cell
and then fused it with the other cell using an
electric shock.
 They then implanted this egg cell into the
uterus of a foster mother who gave birth to
Dolly
 What
do you think about genetic
engineering, stem cells, and cloning?
 Is
it right or wrong?