Download DNA Technology

DNA TECHNOLOGY
• Transgenic organism
• Restriction Enzyme
• GMO = genetically modified organism
• Gene therapy
• Vector
• Recombinant DNA
• PCR (polymerase chain reaction)
• Gel Electrophoresis
• Cloning
• Stem cells
Transgenic Organisms
What are they?
Organisms that carry genes from another
species
The first transgenic organisms were
bacteria
First transgenic animal happened in 1975
A mouse carried an ape gene
+
How in the world did that happen?!
First you find the gene that
you want to transfer over
Then you must cut that gene out of the parent DNA
The area you want to put the DNA
in the other organism has to be found
Cut the new DNA so you can insert into vector
Gene put into its new DNA home
Different restriction enzymes cut
DNA at different palindromes
How do you cut the DNA?
Use restriction enzymes: Bacterial proteins
that have the ability to cut strands of DNA at a
specific nucleotide sequence.
How does the cut piece of DNA get into the targeted
organisms cells?
For animals:
Transgene put into a vector and then into a fertilized egg
For Plants:
Transgene put into vector which is put into a bacterium that infects plant cells.
GGAATTCCTTAAGTCAACCGCTTAAGG
Gene you want.
Makes Human
insulin
GGAATTCCTTAAGTCAACCGCTTAAGG
Cut out by restriction
enzymes
GTACTGACCCTTGGTA
AGAGTACGTTTGT
DNA inside vector cut
with restriction
enzymes
What the heck is a vector?
A Vector is a Virus that has been re-engineered
A new piece of DNA has been added to the virus and often times
the part of DNA that infects you is removed.
Transgene
Transgene put into
vector DNA
GTACTGACCCTTGGTA
AGAGTACGTTTGT
TTAAGTCAA
Vector
infects
egg
Vector puts Transgene
into egg DNA
Egg put into
mother and when
baby cow is born it
makes human
insulin
Vectors
• Example: plasmid (small ring of DNA in a
bacterial cell
• May be biological (viruses or plasmids)
• Or mechanical (micropipette or “bullet”
So why don’t we make all kinds of new animals and plants?
We don’t know how it will affect our environment
If something is wrong with them its not
like we can just take them all back up
What other effects will it have besides the
one intended
They can mutate
Examples of GMOs (genetically modified organisms) that we
have now………
Sterile male crop pests
Plants that have an
insecticide in them
Gene Therapy
What in the world is gene therapy?!?!
The treatment of certain disorders, especially genetic
disorders, by introducing specific engineered genes into
a patient's cells
Several methods can be used when treating a genetic disorder:
A normal gene may be inserted into a nonspecific location within the genome to
replace a nonfunctional gene. This approach is most common.
An abnormal gene could be swapped for a normal gene.
The abnormal gene could be repaired, which returns the gene to its normal
function.
The regulation (the degree to which a gene is turned on or off) of a particular gene
could be altered
So how do we do this?
A vector is used to deliver the DNA needed to fix the problem into
the target cells……the ones that need to be fixed.
Just like in transgenic organisms the vector infects the cells and delivers
the DNA into the cell to be put into the target cell’s DNA
This new DNA changes the target cells so that they are now normal.
What kind of disorders are we talking about here?
Hemophilia
Huntington’s Disease
Sickle Cell Anemia
Thalassaemia
Cystic
Fibrosis
So don’t we cure everybody?
FDA has not approved gene therapy because it has proven
dangerous.
Not a permanent cure
Our bodies can have an immune response to the vector and
DNA. Example of this is France.
Many diseases are caused by multi-gene problems
Gene Therapy
CellCell
culture
Cell
culture
flask
flask
Bone marrow
cells
Hip
bone
PCR: polymerase chain reaction
• Replicates DNA outside of living
organisms
• Uses heat and enzymes to make lots of
DNA very fast
• Used for crime investigations, diagnose
diseases (like HIV) and cloning
Recombinant DNA
• Made by connecting (recombining)
fragments of DNA from different sources
Uses of Recombinant DNA
•
•
•
•
•
•
•
Insect resistant crops
Growth hormones
Insulin for diabetics
Higher yielding food plants
Clotting factor for hemophiliacs
E. coli produces indigo dye to color jeans
Cheese, laundry detergents, and sewage
treatment are enhanced by recombinant DNA
GEL ELECTROPHORESIS
Loading the well with DNA
Steps of Gel Electrophoresis:
• Restriction enzymes cut DNA into
fragments. The fragmented DNA is
injected into wells in the gel. A current is
sent through the gel and the fragments will
move at different speeds that appear as
bands under UV light. Bands can be
matched up to identify criminals, bodies or
fossils or to determine parentage. Longer
fragments move slower than short ones.
Send a current through the gel
Fragments will move at different speeds, creating
bands that appear under UV light
Bands can be matched up to identify
parents, children, or criminals
Cloning
• Making an identical genetic copy
Dolly, 1997 News report
Stem Cells
• Undifferentiated cells that can be genetically
engineered to express the genes for any
desired type of tissue
– Usually embryonic = controversial
– But is there another way…?
• Often used in regenerative medicine
– Current research hopes to treat diseases such
as Parkinson's disease, Alzheimer's disease,
spinal cord injury, heart disease, diabetes and
arthritis.
Plasmid Activity: p. 355 in textbook
•
•
•
•
•
Write the letters on the LONG strip:
GGATCC
GGATCC
CCTAGG
CCTAGG
Write the letters on the SHORT strip:
GGATCC
CCTAGG
Make sure all letters are equally
spaced
Plasmid activity p. 354-355
• Tape the ends of the shorter strip together.
• This is the plasmid
• Cut the longer strip of DNA in 2 places at
the palindrome GIGATCC. This is the
foreign DNA. Cutting it represents
restriction enzymes.
• Cut the plasmid in the same way.
• Insert the foreign gene into the plasmid
and tape together.