* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Proteome
Non-coding DNA wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Biosynthesis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Magnesium transporter wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic code wikipedia , lookup
Western blot wikipedia , lookup
Genomic library wikipedia , lookup
Gene expression wikipedia , lookup
Expression vector wikipedia , lookup
Interactome wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Structural alignment wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Community fingerprinting wikipedia , lookup
Protein structure prediction wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Point mutation wikipedia , lookup
Proteolysis wikipedia , lookup
基因與蛋白質資料庫 阮雪芬 Nov 20 & 27, 2002 NTU  Genome   Sequence searching Cutting site for a specific sequence   Restriction Mapper REBASE       REBsite NEB cutter v1.0 DARWIN Sequence Alignment   Index NCBI  BLAST  Pairwise BLAST Search for conserved domains ORF Finder BGSS  Proteome  Protein primary structure       Amino acid and atomic composition Computing pI and MW Sequence searching Sequence alignment DNA translate to protein Protein-protein interaction on the web     YPLMD GeneScape YIPD BIOCARTA Outline       Introduction to genomics Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding Ribose and Deoxyribose Backbone of DNA and RNA Purines and Pyrimidines Watson-Crick Base Pairs Watson-Crick Base Pairs Watson-Crick Model of Double Helical DNA Biochemical Context of Genomics and Proteomics DNA Genome “Genomics” mRNA Proteins Cell functions Proteome “Proteomics” DNA 和蛋白質合成的地方 DNA Proteins Sugar Chain cytoplasm Genome  Gene + Chromosome Genome Gene Sequence Searching Accession Number Gene Sequence Gene Sequence Searching AA046701 AA069414 AA070289 AA446013 AA425102 http://www.ncbi.nlm.nih.gov/UniGene/ Gene Sequence Searching Gene Sequence Searching Gene Sequence Searching GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC Cutting Site for a Specific Sequence Sequence Cut by Restriction Enzymes 1. RestrictionMapper 2. REBASE 3. DARWIN Cutting Site for a Specific Sequence RestrictionMapper http://www.restrictionmapper.org RestrictionMapper RestrictionMapper REBASE Rebase.neb.com/rebase.html DARWIN http://darwin.bio.geneseo.edu/~yin/WebGene/ RE.html Sequence Alignment Input Query DNA Sequence Amino Acid Sequence Blastp Compares Against protein Sequence Database tblastn Compares Against Translated Nucleotide Sequence Database blastn Compares Against Nucleotide Sequence Database blastx tblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Pairwise BLAST BLAST NCBI: http://www.ncbi.nlm.nih.gov/ Copy Sequence Search for Conserved Domains ORF Finder (Open Reading Frame Finder) http://www.ncbi.nlm.nih.gov/gorf/ BGSS (Gene Function Search System) AA046701 AA069414 AA070289 AA446013 AA425102 http://gate.sinica.edu.tw:8900/perl/genequery.pl BGSS Outline  Introduction to proteomics  Primary Structure Analysis  Protein Sequence Searching Protein Sequence Alignment DNA Translate to Protein Protein-protein Interactions  Useful Bio-websites    What Is Proteomics ? Proteomics   Protein +Genome Proteome ProteomeProteomics How Proteomics Can Help Drug Development Definitions of Proteomics    First coined in 1995 Be defined as the large-scale characterization of the entire protein complement of a cell line, tissue, or organism. Goal: -To obtain a more global and integrated view of biology by studying all the proteins of a cell rather than each one individually. Proteomics Origins    In 1975, the introduction of the 2D gel by O’Farrell who began mapping proteins from E. coli. The first major technology to emerge for the identification of proteins was the sequencing of proteins by Edman degradationpicomole MS technology has replaced Edman degradation to identify proteinsfemtomole Types of Proteomics and Their Applications to Biology Two-dimensional Gel Approach Nature 2000, 405, 837-846 Standard Proteome Analysis by 2DE-MS Mass Fingerprint Searching in http://www.expas ych/tools/peptide nt.html Current Opinion in Chemical Biology 2000, 4:489–494 Primary Structure Analysis  Object: To compute the characters of proteins. -Amino acid composition -Atomic composition -pI -Molecular weight Amino Acid & Atomic Composition ProtParam Amino Acid & Atomic Composition http://www.expasy.ch/tools/protparam.html Amino Acid & Atomic Composition Amino Acid Composition Atomic Composition Computing pI and MW Computing pI and MW Computing pI and MW MW pI Protein Sequence Searching P02571 Protein Sequence Searching Sequence Alignment Input Query DNA Sequence Amino Acid Sequence Blastp Compares Against protein Sequence Database tblastn Compares Against Translated Nucleotide Sequence Database blastn Compares Against Nucleotide Sequence Database blastx tblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Sequence Alignment http://www.expasy.ch/ Sequence Alignment Sequence Alignment Sequence Alignment Sequence Alignment Sequence Alignment Similarity is very low No similarity The Information Stored in Genes Is Expressed by a Multistage Process The Genetic Code Is Degenerate DNA Translate to Protein http://www.expasy.ch/tools/ DNA Translate to Protein DNA Protein DNA Translate to Protein DNA Translate to Protein DNA sequence DNA Translate to Protein Protein-protein Interactions on the Web  Yeast http://depts.washington.edu/sfields/yplm/data/index.html http://portal.curagen.com http://mips.gsf.de/proj/yeast/CYGD/interaction/ http://www.pnas.org/cgi/content/full/97/3/1143/DC1 http://dip.doe-mbi.ucla.edu/ http://genome.c.kanazawa-u.ac.jp/Y2H  C. Elegans http://cancerbiology.dfci.harvard.edu/cancerbiology/ResLabs/Vidal/  H. Pylori http://pim/hybrigenics.com  Drosophila http://gifts.univ-mrs.fr/FlyNets/Flynets_home_page.html Yeast Protein Linkage Map Data  New protein-protein interactions in yeast List of interactions with links to YPD Stanley Fields Lab http://depts.washington.edu/sfields/yplm/data Yeast Protein Linkage Map Data GeneScape  PathwayCalling: Protein interaction and pathway Analysis PATHCALLING YEAST DATABASE http://portal.curagen.com GeneScape GeneScape GeneScapeMIPS  Currently about 9750 protein-protein-interactions (8250 physical and 1500 genetic) are annotated. Yeast Interacting Proteins Database (YIPD) Yeast Interacting Proteins Database http://genome.c.kanazawa-u.ac.jp/ Genetic Network Visualization System Workbench System for Support of Gene Regulatory Network Construction Java Applet Java Applet GUI System Help Pathway Software BIOCARTA http://biocarta.com/ Browse all pathway Pathway Software BIOCARTA Pathway Result 1: Enolase Pyruvate Cancer cells Acetyl-CoA ethanol lactate Glycolysis Pathway Result 2: Retinoic Acid Receptor RXR-alpha Useful BioWeb Site name URL Information available MOWSE http://srs.hgmp.mrc.ac.uk/cgi-bin/mowse Peptide mass mapping and sequencing ProFound http://prowl.rockefeller.edu/cgibin/ProFound Peptide mass mapping and sequencing PeptIdent http://www.expasy.ch/tools/peptident. Peptide mass mapping and sequencing PepSea http://195.41.108.38/PepSeaIntro.html Peptide mass mapping and sequencing MASCOT http://www.matrixscience.com/ Peptide mass mapping and sequencing PepFrag http://www.proteometrics.com/ Peptide mass mapping and sequencing Protein Prospector http://prospector.ucsf.edu/ Peptide mass mapping and sequencing FindMod http://www.expasy.ch/tools/findmod/ Posttranslational modification SEAQUEST http://fields.scripps.edu/sequest/ Uninterpreted MS/MS searching FASTA Search Programs http://fasta.bioch.virginia.edu/ Protein and nucleotide database searching Cleaved Radioactivity of http://fasta.bioch.virginia.edu/crp Protein phosphorylation site mapping
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            