Download (LPT1) and humans (LPCAT3)

Identification of Novel Lysophospholipid Acyltransferases in Yeast (LPT1) and
Humans (LPCAT3) and Regulation of Triglyceride Synthesis in Yeast
A Thesis
Submitted to the Faculty
of
Drexel University
By
Shilpa Jain
in partial fulfillment of the
requirements for the degree
of
Doctor of Philosophy
June 2008
© Copyright 2008
Shilpa Jain. All Rights Reserved.
ii
Dedications
To Mummy, Papa, Didis and Prosenjit
iii
Acknowledgements
I would like to express my gratitude for my advisor, Dr. Peter Oelkers, Dept. of
Bioscience and Biotechnology, Drexel University. Under his guidance I learned lot of lab
techniques and thus acquired tools to answer research questions and think like a scientist.
He taught me all. I don’t remember one time when walk-ins were not welcome in his
office. No matter what experiment I plan I will always hear his voice in my head “Think
about the scientific question you are asking”. No idea was a stupid idea. It was so much
fun to discuss research ideas with him. Peter can explain an experiment on a small piece
of paper with the same ease as he can tell you about places to see in a hand drawn
paramecium shaped map of New York.
Special thanks to my committee members for their time and suggestions. Dr.
Bentz, the Chair of the committee brought interesting perspective on membranes and
acyl-CoA concentrations, Dr. Nickels had very good suggestions to offer about tools to
use in my project. His suggestion about using automated synthetic lethality screen in
collaboration saved us a lot of time. Dr. Saunders always had good comments not only
related to research but also how to make effective presentations. Dr. Elefant in spite of
being a geneticist by training always had relevant questions and made me think of the
bigger picture in terms of the physiological role of enzymes studied in the project. I am
lucky to have all of these great scientists in my committee. I am grateful to Dr. Howett,
Head, Dept. of Bioscience and Biotechnology for sponsoring registration fees to local and
regional conferences. She is a role model for all the Graduate students in the department.
Nanette, Brenda and Kerin in bioscience office your help is appreciated.
iv
It is important to have fellow mates who keep you sane in graduate school. I am
lucky I had a great support system. Annie (Annette) thanks for the movie-ice cream dates
and all fun things we did together. It was always nice to know (with your laughter
streaming in our lab and our music vice versa) that you were sitting next door and I could
simply walk over and talk to you. I cannot forget lazy eat-sleep-play ludo-eat-ludo-sleep
weekends with Poulomi and Vilas. Thanks, to both of you for always being there in the
ups and downs of the “to be Ph.D.” life. Kavi, Adetoun, Ang, Mei, Neha and Soumya
you all were great lab mates. Sara, you were a cool buddy. Maggie, thanks for teaching
me how to swim and overcome my fears of deep water. Shaya, Eugenia and Aiman
thanks for your help. The set of instructions in thesis manual makes thesis formatting
look like a daunting task. I am glad I had Ellen to help me out.
I am indebted to my family: my parents, Alka didi, Vandi and Ritu for their
unconditional support and encouragement. Mummy thanks for your prayers (especially
before submitting the papers or appearing before job interviews). Ritu and Ken thanks for
always checking on my progress in school and supporting me during my job search. Dids
by now it has been established that you are my 24 hr. emergency hotline. Prashant thanks
for being my personal physician and I am sure we will keep in touch. Roni you are a
great housemate and having Pari at home was a great stress buster.
Last but not least my special thanks to my husband, Prosenjit for all the support
and love. Thanks for talking to me on phone at odd hours in night, (although perfectly
normal hours for me...). I always looked forward to week long vacations with you in the
entire year. Whenever things were tough for me I always thought of how someone else
across Atlantic was working hard to realize his dreams. Your love just keeps me going.
v
Table of Contents
LIST OF TABLES............................................................................................................ vii
LIST OF FIGURES ......................................................................................................... viii
ABSTRACT....................................................................................................................... xi
1. INTRODUCTION .........................................................................................................1
1.1 Triglyceride synthetic pathway..............................................................................1
1.1.1 Steps and enzymes of triglyceride synthetic pathway ..................................6
1.1.2 Regulation of triglyceride synthesis............................................................21
1.2 Phospholipid Biosynthesis .....................................................................................23
1.2.1 Acyl chain asymmetry in phospholipids ....................................................27
1.2.1.1 Mechanisms to incorporate acyl chains in phospholipids..................28
1.2.1.2 Acyl chain remodeling of phospholipids by acyl-CoA dependent
lysophospholipid acyltransferases .................................................................32
1.2.1.3 Phospholipid remodeling in Saccharomyces cerevisiae ....................34
1.2.1.4 Physiological role of lysophospholipid acyltransferases ...................35
1.3. Specific Aims .......................................................................................................37
2. REGULATION OF TRIGLYCERIDE SYNTHESIS IN SACCHAROMYCES
CEREVISIAE................................................................................................................38
2.1 Abstract ................................................................................................................38
2.2 Introduction..........................................................................................................39
2.3 Experimental Procedures .....................................................................................42
2.4 Results..................................................................................................................46
2.5 Discussion ............................................................................................................67
vi
3. IDENTIFICATION OF A NOVEL LYSOPHOSPHOLIPID ACYLTRANSFERASE
(LPT1) IN SACCHAROMYCES CEREVISIAE............................................................76
3.1 Abstract ................................................................................................................76
3.2 Introduction..........................................................................................................78
3.3 Experimental Procedures .....................................................................................84
3.4 Results..................................................................................................................89
3.5 Discussion ..........................................................................................................109
4. IDENTIFICATION AND BIOCHEMICAL CHARACTERIZATION OF HUMAN
LYSOPHOSPHATIDYLCHOLINE ACYLTRANSFERASE-3 (LPCAT3)............116
4.1 Abstract ..............................................................................................................116
4.2 Introduction........................................................................................................118
4.3 Experimental Procedures ...................................................................................120
4.4 Results................................................................................................................124
4.5 Discussion ..........................................................................................................139
5. SUMMARY................................................................................................................146
LIST OF REFERENCES.................................................................................................155
APPENDIX 1: GENERAL STRUCTURE OF GLYCEROLIPIDS ..............................173
APPENDIX 2: MISCELLANEOUS EXPERIMENTS...................................................176
vii
List of Tables
1.1 Amino acid alignment score of human AGPAT family members...............................9
3.1 Comparison of different methods used to calculate kinetic parameters of Lpt1 .....104
3.2 Kinetic parameters of Lpt1 ......................................................................................104
3.3 Subcellular localization of acyl-CoA dependent LPCAT activity...........................106
4.1 Kinetic parameters of human LPCAT3 ...................................................................135
viii
List of Figures
1. Figure 1.1: Triglyceride synthetic pathway ...................................................................2
2. Figure 1.2: Triglyceride synthetic pathway in mammals...............................................4
3. Figure 1.3 Triglyceride synthetic pathway in Saccharomyces cerevisiae .....................5
4. Figure 1.4: Phylogenetic tree based on amino acid sequence similarity of AGPAT
family members .............................................................................................................9
5. Figure 1.5 Phospholipid synthetic pathway in mammals ............................................24
6. Figure 1.6 Phospholipid synthetic pathway in Saccharomyces cerevisae...................25
7. Figure 1.7 Phospholipid remodeling (Lands Cycle) ....................................................31
8. Figure 2.1 Inability to oxidize fatty acids significantly increases triglyceride levels in
pox1∆ strain .................................................................................................................47
9. Figure 2.2 Triglyceride levels in glycogen deficient strains........................................48
10. Figure 2.3 Effect of addition of water-soluble phospholipid precursors in media on
triglyceride levels.........................................................................................................50
11. Figure 2.4 Glycogen levels in triglyceride deficient yeast strain.................................52
12. Figure 2.5 In vitro Diacylglycerol acyltransferase (DGAT) activity with increasing
concentrations of [14C] oleoyl-CoA. ............................................................................55
13. Figure 2.6 Effect of 5mM ATP on in vitro Diacylglycerol acyltransferase (DGAT)
activity..........................................................................................................................59
14. Figure 2.7 Effect of 0.8mM NADH on in vitro Diacylglycerol acyltransferase
(DGAT) activity...........................................................................................................60
15. Figure 2.8 Effect of 0.2mM acetyl-CoA on in vitro Diacylglycerol acyltransferase
(DGAT) activity...........................................................................................................61
16. Figure 2.9 Effect of 0.1 mM malonyl-CoA on in vitro Diacylglycerol acyltransferase
(DGAT) activity...........................................................................................................62
17. Figure 2.10 Effect of 0.1 mM and 1mM AMP on in vitro Diacylglycerol
acyltransferase (DGAT) activity..................................................................................65
ix
18. Figure 2.11 Effect of 0.1mM ADP and 0.8 mM NAD on in vitro Diacylglycerol
acyltransferase (DGAT) activity..................................................................................66
19. Figure 3.1 Pathways for phospholipid synthesis in Saccharomyces cerevisiae. ......... 81
20. Figure 3.2 Incorporation of [3H] oleate into phospholipids and neutral lipids in slc1Δ,
ydr018Δ, ybr042Δ ................................................................................................................. 91
21. Figure 3.3 Incorporation of [3H] oleate into diglyceride, triglyceride and
phospholipids in ybr042∆, ydr018∆ and ybr042∆ydr018∆ in slc1∆ background .......92
22. Figure 3.4 Alignment of LPT1 and 3 human members of the MBOAT gene family.94
23. Figure 3.5 In vitro 1-acyl-sn-glycerol-3-phosphate acyltransferase (AGPAT) assays ......... 96
24. Figure 3.6 Lysophosphatidylcholine acyltransferase (LPCAT) activity is absent in
lpt1Δ.............................................................................................................................97
25. Figure 3.7 Lysophospholipid substrate specificity of Lpt1p ................................................ 99
26. Figure 3.8.1 Acyl-CoA substrate specificity of Lpt1p..............................................101
27. Figure 3.8.2-3 Acyl-CoA substrate specificity of Lpt1p .................................. 102-103
28. Figure 3.9 Incorporation of [3H] oleate into phospholipids and neutral lipids .........107
29. Figure 4.1 Alignment of Lpt1p and MBOAT5 / C3F...............................................125
30. Figure 4.2 Predicted transmembrane domains of LPCAT3......................................125
31. Figure 4.3 Lysophosphatidylcholine acyltransferase (LPCAT) activity in infected Sf9
insect cells..................................................................................................................127
32. Figure 4.4 Lysophospholipid substrate specificity of LPCAT3 ...............................128
33. Figure 4.5 Kinetics of lysoPC utilization by LPCAT3 .............................................129
34. Figure 4.6 Kinetics of Stearoyl-CoA (18:0-CoA) utilization by LPCAT3........................131
35. Figure 4.7 Kinetics of Oleoyl-CoA (18:1-CoA) utilization by LPCAT3 ........................... 132
36. Figure 4.8 Kinetics of Arachidonoyl-CoA (20:4-CoA) utilization by LPCAT3............... 133
37. Figure 4.9 Kinetics of Linolenoyl-CoA (18:3-CoA) utilization by LPCAT3..................... 134
38. Figure 4.10 Effect of LPCAT3 expression on Sf9 phospholipid species. ........................... 137
x
39. Figure 4.11 Dendogram showing members of human MBOAT family...................140
40. Figure 5.1 Evolutionary dendogram showing homologs of Lpt1 in other eukaryotes151
41. Figure 5.2 Dendogram showing Lpt1 homologs in human MBOAT family ...........152
42. Figure A1. Glycogen levels in pox1, tgl3∆tgl4∆tgl5∆ yeast strains.........................176
43. Figure A2. Effect of cerulenin on glycogen levels in wild type yeast strain ............177
44. Figure A3. Effect of inositol and choline on triglyceride synthesis in wild type yeast
strain at different growth phases ..............................................................................178
xi
Abstract
Identification of Novel Lysophospholipid Acyltransferases in Yeast (LPT1) and Humans
(LPCAT3) and Regulation of Triglyceride Synthesis in Yeast
Shilpa Jain, MS
Peter Oelkers, Ph.D.
Cells require membranes for survival and need energy to meet the costs of living.
Phospholipids and triglyceride together fulfill both the requirements. Phospholipids are
predominant membrane lipids and triglycerides allow for storage of surplus energy therby
enhancing survival in energy poor conditions. Therefore, an understanding of how cell
regulates triglyceride synthesis and maintains membrane composition by acyl chain
remodeling of phospholipids is important.
Saccharomyces cerevisiae was used as a model system to study the intracellular
regulation of triglyceride synthesis at the step of diglyceride esterification. Using
metabolic labeling with [3H] oleate, we found that the inability to hydrolyze fatty acids,
significantly (p<0.05) increased triglyceride synthesis by 75%. Disabling glycogen
synthesis (alternative energy reserve) did not alter triglyceride synthesis. Additionally,
inability to store energy as triglyceride did not result in a compensatory increase in
glycogen synthesis. To address the possibility of regulation at the level of enzyme
activity, microsomal diacylglycerol acyltransferase assays were performed in the
presence of a variety of metabolites (AMP, ADP, ATP, NAD+, NADH, acetyl-CoA and
malonyl-CoA). DGAT activity was not regulated at physiological concentrations of these
metabolites.
Acyl chains in the sn-2 position of phospholipids are introduced by de novo
synthetic pathway involving 1-acylglycerol-3-phosphate acyltransferase (AGPAT) or by
acyl chain remodeling that requires lysophospholipid acyltransferases (LPLAT). LPT1
xii
(YOR175c) an acyltransferase with unknown function was identified by its synthetic
lethal interaction with Slc1, the known AGPAT in yeast. LPT1 was shown to encode for
a novel AGPAT/ LPLAT in yeast with high apparent affinity for saturated acyl-CoAs but
higher apparent Vmax for monounsaturated acyl-CoAs. Lpt1 does not share sequence
similarity with known LPLAT/AGPAT family members and belongs to membranebound-O-acyltransferase (MBOAT) super family. Homology search with Lpt1 identified
the human MBOAT5, a protein with unknown function. Cell lysates from insect cells
expressing human MBOAT5 (renamed as LPCAT3) showed a 10 fold increase in
LPCAT activity over control. In summary, the identification of a novel LPLAT in yeast
has proved to be the founding member of LPLAT family in humans. Future
characterization of this family is likely to shed light on how membrane composition is
adjusted and controlled in humans.
xiii
1
CHAPTER 1: INTRODUCTION
1.1 Triglyceride synthetic pathway
Triglyceride, also known as triacylglycerol, is composed of a glycerol molecule
joined to three acyl chains by ester bonds. This is an energy-rich molecule that allows for
compact energy storage and yields twice the amount of energy in comparison to a
polysaccharide such as glycogen or starch. All eukaryotes and a subclass of prokaryotes
(Actinomycetes), have intracellular triglyceride stores in structures known as lipid
droplets, lipid particles and oil bodies. Probably, the ability to store surplus energy in
form of triglyceride offers a metabolic advantage during the periods of nutritional surplus
and nutritional stress (Alvarez 2002). Triglyceride also sequesters fatty acids and
diacylglycerol, precursors for phospholipid biosynthesis.
The Kennedy pathway or glycerol -3- phosphate pathway is the de novo route for
intracellular triglyceride synthesis (Kennedy 1961). Initial steps of this pathway are
common for triglyceride and glycerophospholipid biosynthesis. The Kennedy pathway
requires glycerol 3-phosphate and fatty acyl-CoA as substrates (Appendix 1). Glycerol 3phosphate can be generated either by reduction of dihydroxyacetone phosphate, an
intermediate of glycolysis, or from the phosphorylation of glycerol. Acyl-CoAs, the other
substrates, come from activation of fatty acids by coenzyme A. Glycerol 3-phosphate
undergoes sequential acylation by two fatty acyl CoA molecules to form phosphatidic
acid (PA) (Figure 1.1).
2
Figure 1.1: Triglyceride synthetic pathway
3
Acyl-CoA: glycerol-sn-3-phosphate acyltransferase (GPAT) catalyzes the first step in the
Kennedy Pathway to form 1-acylglycerol-sn-3-phosphate (lysophosphatidic acid) (Figure
1.1). The subsequent acylation of 1-acylglycerol-3-phosphate to phosphatidic acid is
catalyzed
by
acylglycerol-3-phosphate
acyltransferase
(AGPAT)
also
called
lysophosphatidate acyltransferase (LPAAT). Phosphatidic acid is then converted to
diacylglycerol in a reaction catalyzed by phosphatidic acid phosphatase (PAP).
Phosphatidic acid and diacylglycerol generated in this pathway can be converted into
triglyceride or phospholipid. In the pathway to generate triglyceride, diacylglycerol
acyltransferase (DGAT) catalyzes diacylglycerol esterification with a third acyl-CoA to
generate triglyceride. This is the terminal and unique step in the de novo triglyceride
synthesis.
Triglyceride Synthesis in Yeast
The triglyceride synthesis occurs in yeast by Kennedy pathway reactions, as
discussed above, with a few differences. The first step of acylation reaction starts with
either glycerol 3-phosphate or dihydroxyacetone phosphate (DHAP) and acyl-CoA
(Figure 1.3). If dihydroxyacetone phosphate is the substrate, it is acylated, and the product
1-acyl DHAP is reduced to form lysophosphatidic acid. Unlike mammals, DHAP in yeast
is not utilized to synthesize ether lipids but contributes to the formation of glycerolipids
(Coleman 2004). However, the relative contributions of the glycerol 3-phosphate and
DHAP to triglyceride and phospholipid synthesis are not known (Racenis 1992).
Lysophosphatidic acid is further acylated to form phosphatidic acid.
4
Figure 1.2: Triglyceride synthetic pathway in mammals
5
Figure 1.3 Triglyceride synthetic pathway in Saccharomyces cerevisiae
6
Diacylglycerol formed from phosphatidic acid is acylated to triglyceride by two reactions,
acyl-CoA dependent and acyl-CoA independent. The acyl-CoA dependent reaction is
similar in mammals and yeast. In the acyl CoA independent reaction the diacylglycerol
esterification occurs by using the sn-2 acyl group of glycerophospholipids preferentially
phosphatidylcholine and phosphatidylethanolamine (Oelkers 2000). This reaction has not
been characterized in humans.
1.1.1 Steps and enzymes of triglyceride synthetic pathway
Step 1: Synthesis of 1-acylglycerol 3-phosphate (Lysophosphatidic acid)
This is the first step of glycerolipid synthesis. Glycerol-3-phosphate is acylated to 1-acylglycerol-3-phosphate (also known as lysophosphatidic acid) and is catalyzed by acylCoA: glycerol -3-phosphate acyltransferase (GPAT) (Figure 1.1, Appendix 1).
In mammals
In mammals, four GPAT isoforms, GPAT1-4 have been cloned. GPAT1 and
GPAT2 encoded activity is associated with mitochondrial fraction while GPAT3 and
GPAT4 encoded enzymes are microsomal (Coleman 2004; Cao 2006; Wang 2007; Chen
2008; Nagle 2008) (Figure 1.2). The microsomal GPAT contributes to about 90% of total
cellular activity in most tissues. This activity has only been recently characterized hence
not much is known about its regulation. Regulation of the mitochondrial GPAT has been
intensively studied and found to occur by the transcriptional activation during adipocyte
differentiation and by sterol regulatory element binding protein-1c (SREBP-1c) (Ericsson
1997).
7
The mitochondrial activity is also subject to nutritional and hormonal regulation.
In rats, 48 hours of fasting has been shown to reduce hepatic mitochondrial GPAT1
protein expression and activity by 30% while refeeding for 24 hours, a high carbohydrate
or high sucrose diet increases mRNA abundance and activity by 60% (Lewin 2001).
Fasting and refeeding result in an increase in insulin secretion hence the mitochondrial
GPAT mRNA level and activity was examined in streptozotocin induced diabetic mice. In
the diabetic mice the mRNA levels of the mitochondrial GPAT could not be detected and
upon insulin injection the mRNA levels increased about 20 fold after 6 hours (Shin 1991).
In energy rich conditions, there is up regulation of triglyceride synthesis while
fatty acid utilization by beta-oxidation is reduced. Over expression of mitochondrial
GPAT in primary cultures of rat hepatocytes resulted in 81% reduction in fatty acid
oxidation and a significant increase in hepatic diacylglycerol and phospholipid
biosynthesis. Interestingly, the increase in triglyceride synthesis was seen only in cells
provided with additional fatty acids in media, akin to energy replete condition favoring
triglyceride synthesis (Linden 2004). The mitochondrial GPAT activity is affected by
energy rich and poor conditions in a cell. Low ATP levels result in activation of AMP
kinase that inhibits mouse mitochondrial GPAT activity in liver and adipose tissue
(Coleman 2004). Besides these studies, on regulation of mitochondrial GPAT isoform the
regulation of microsomal isoforms and their contribution to triglyceride synthesis still
requires future studies.
8
In Yeast
In yeast, Gat1 and Gat2 are responsible for the GPAT activity in endoplasmic
reticulum (ER) and lipid particles (Athenstaedt 1997; Zheng 2001) (Figure 1.3). Both
Gat1 and Gat2 are able to utilize glycerol-3-phosphate and dihydroxyacetone phosphate
as substrates (Zheng 2001). Both yeast enzymes share sequence similarity (12%) with the
mammalian mitochondrial GPATs. A gat1Δgat2Δ double mutation is lethal for yeast cells
indicating that these two genes encode for the principal GPATs in yeast. GAT1 deletion
results in about 80% decrease in GPAT activity while GAT2 deletion results in 30%
decrease in GPAT activity. The gat1Δ and gat2Δ single deletion yeast cells when grown
to mid log phase and pulse labeled with [14C] acetate show 50% decrease in labeling of
triglyceride in gat2Δ and 50% increase in gat1Δ yeast cells. This results suggests that
acylation through Gat2 plays a larger role in triglyceride synthesis (Zaremberg 2002). The
GPAT activity increases by 3-fold in yeast grown in media containing non-fermentable
carbon sources glycerol and ethanol versus fermentable carbon source glucose (Minskoff
1994). Apart from this observation, nothing is known about the regulation of GPAT
activity in yeast.
Step 2: Synthesis of phosphatidic acid
Lysophosphatidic acid is acylated by acyl-CoA:1-acylglycerol-3-phosphate
acyltransferase (AGPAT) also known as lysophosphatidic acid acyltransferase (LPAAT).
Phosphatidic acid formed by AGPAT is an important intermediate in the Kennedy
pathway because it can serve as precursor for phospholipids as well as triglyceride
(Figure 1.1; Figure 1.4; Appendix 1).
9
Gene
Identity (%)
AGPAT1 AGPAT2 AGPAT3 AGPAT4 AGPAT5
AGPAT1 47
7
13
11
AGPAT2 47
4
10
9
AGPAT3 7
4
61
18
AGPAT4 13
10
61
18
AGPAT5 11
9
18
18
AGPAT6 16
8
2
2
3
AGPAT7 16
16
6
4
8
AGPAT8 16
6
25
22
18
AGPAT6
16
8
2
2
3
12
8
AGPAT7
16
16
6
4
8
12
8
AGPAT8
16
6
25
22
18
8
8
-
Table 1.1: Amino acid alignment score of human AGPAT family members
Figure 1.4: Phylogenetic tree based on amino acid sequence similarity of AGPAT
family members
10
In mammals
The human AGPAT1 and AGPAT2 were identified based on sequence homology
to the bacterial (plsC) and yeast AGPAT (SLC1) genes (Eberhardt 1997; Stamps 1997;
West 1997; Aguado 1998) (Figure 1.2). Seven other putative members of AGPAT family
AGPAT3-9 have been identified. By analyzing the conserved sequences of all the
AGPAT family members AGPAT1 and AGPAT2 belong to the same sub group and have
been confirmed as AGPATs. AGPAT3, AGPAT4 and AGPAT5 belong to the same
subgroup and have very weak AGPAT activities (Figure 1.4, Table1.1) (Agarwal 2007).
AGPAT1 and AGPAT2 have been shown to convert lysophosphatidic acid to
phosphatidic acid; the same cannot be said about the biochemical properties of other
member AGPATs (Leung 2001; Lu 2005)
Cell lysates from insect cells expressing AGPAT1 showed 3-fold incorporation of
[14C] oleoyl CoA in lysophosphatidic acid over background (Aguado 1998). The transient
expression of AGPAT2 in COS 7 cells showed 6 to 17-fold increase in AGPAT activity
compared to mock transfected cells. The AGPAT1 and AGPAT2 encoded activity was
specific for lysophosphatidic acid and did not utilize other acyl acceptors, glycerol 3phosphate, lysophosphatidylcholine, lysophosphatidylethanolamine (Eberhardt 1997).
Murine AGPAT3, AGPAT4 and AGPAT5 expressed in COS-1 cells showed only 1.4
fold AGPAT activity over the background. The acyltransferase activity in cell lysate was
measured by incorporation of radioactive [14C]oleoyl-CoA in oleoyl-lysophosphatidic
acid (Lu 2005). The substrate specificity of AGPAT3, AGPAT4 and AGPAT5 for other
acyl acceptors has not been determined.
11
Recently AGPAT8 and AGPAT6 were characterized as microsomal GPAT3 and GPAT4
(Cao 2006; Chen 2008; Nagle 2008). Human AGPAT7 upon ectopic expression in E.coli
shows weak acyltransferase activity with lysophosphatidylethanolamine (lysoPE) and 1alkeny lysoPE (Cao 2008) while mouse AGPAT9 displays lysophosphatidylcholine
acyltransferase activity (LPCAT1) (Chen 2006; Nakanishi 2006).
AGPAT1 mRNA is detectable in all human tissues with highest expression in
skeletal muscle (Agarwal 2002). Overexpression of AGPAT-1 in C2C12 myotubes and
3T3-L1 adipocytes resulted in 25% increase in AGPAT activity. In AGPAT1 over
expressing 3T3-L1 adipocytes, the uptake of [3H] oleate and its incorporation in
triglyceride increased by two fold compared to the mock transfected cells. AGPAT1 over
expressing C2C12 myotubes upon stimulation by insulin showed 30% decrease in
incorporation of [14C] glucose in glycogen concomitant with 33% increased incorporation
in total lipids. In the same study, the immunofluorescence microscopy of 3T3L1
adipocytes and myotubes showed that the overexpressed AGPAT1 protein was localized
to cytosol (Ruan 2001).
However, AGPAT1 when expressed in mammalian Chinese hamster ovary cell
line, shows endoplasmic reticulum staining and lack of plasma membrane localization
(Aguado 1998). Thus, the physiological role of AGPAT1 cannot be predicted based on
the results of this study. AGPAT2 is expressed in most of the human tissues with high
expression levels in heart and liver. AGPAT2 mRNA levels in adipose are two fold
higher than AGPAT1 while other AGPATs 3, 4, 5 are not expressed at detectable levels
in adipose tissue (Agarwal 2002).
12
AGPAT2 gene expression is induced during adipocytes differentiation and is
required for the early induction of transcription factors (c/EBP and PPARγ) required for
adipocyte differentiation (Gale 2006). Murine AGPAT3 mRNA shows equal expression
in all the tissues while AGPAT4 and AGPAT5 are highly expressed in brain and
epidermis respectively (Lu 2005).
The biological significance of having multiple (at least 2) isoforms of AGPATs
has not been determined. One obvious explanation might be the redundancy in AGPAT
family. This possibility is ruled out because AGPAT2 gene mutation in individuals results
in congenital generalized lipodystrophy type 1, a disorder characterized by lack of body
fat, insulin resistance and hypertriglyceridemia (Agarwal 2002). In this condition, other
members of the AGPAT family cannot compensate for the critical role of AGPAT2 in
triglyceride synthesis and its role in adipocyte differentiation and maturation. Another
possibility is that AGPAT isoforms perform different biological functions in different
tissues. Due to the lack of data about the physiological role of AGPAT isoforms, nothing
is known about the regulation of multiple AGPAT isoforms. Further studies are required
to know whether there is coordinated or independent regulation of isoforms and what is
their contribution in triglyceride synthesis and regulation.
In Yeast
In yeast, Slc1 mediates all of the AGPAT activity in the lipid particles and 54% of
the total enzyme activity in microsomes (Athenstaedt 1997). SLC1 (sphingolipid
compensation-1) was identified by a screen to search for suppressors of a genetic defect
in sphingolipid synthesis and was found to be homologous to bacterial AGPAT
(plsC)(Coleman 1990).
13
A mutation in the plsC gene causes the strain to grow slowly at 37ºC and not at all
at 42ºC. The ectopic expression of SLC1 in a bacterial strain mutated for plsC gene
enabled the strains to grow normally at 37ºC and promoted growth at 42ºC. This
suggested that SLC1 encodes for AGPAT activity in yeast (Coleman 1990; Nagiec 1993).
Further studies showed that slc1Δ mutants showed no AGPAT activity in lipid particles
but microsomes prepared from slc1∆ strain retained 46% of the total AGPAT activity.
This indicates that alternative pathway or another enzyme involved in glycerolipid
biosynthesis must exist in yeast, which contributes to the formation of phosphatidic acid
in the absence of Slc1(Athenstaedt 1997). The enzyme, which mediated phosphatidic acid
synthesis in yeast in the absence of Slc1 was not known before the current study was
undertaken (Jain 2007). Triglyceride levels in slc1∆ mutants grown to log phase are 3-4
times higher than normal (Athenstaedt 1997). This unidentified enzyme with AGPAT
activity might be primarily involved in triglyceride synthesis. This uncharacterized
AGPAT activity might have higher expression and activity in specific growth phase,
such as log phase or stationary phase, a characteristic shared with diacylglycerol
esterifying enzymes in yeast (Oelkers 2002). Identification of the enzyme or enzymes
responsible for the Slc1 independent AGPAT activity will complete the characterization
of almost all of the enzymes involved in triglyceride synthesis in yeast. The only enzyme
which has not been characterized yet is the residual magnesium dependent phosphatidic
acid phosphatase (PAP) activity in cells lacking the known PAPs DPP1, LPP1 and PAH1.
Acetate labeling of cells lacking PAH1, DPP1, and LPP1 show a minor contribution (~
10%) of this unknown enzyme to triglyceride synthesis.
14
Thus the characterization of novel AGPAT in yeast will help to understand
intracellular regulation of triglyceride synthesis in total.
Step 3: Synthesis of diacylglycerol
Phosphatidic acid phosphatase (PAP) dephosphorylates phosphatidic acid to form
diacylglycerol (Figure 1.1). Two kind of PAP activity exist in yeast and mammalian
tissues. PAP1 is magnesium dependent and is sensitive to N-ethylmaleimide (NEM), a
cysteine modifying reagent, while PAP2 is neither dependent on magnesium nor is NEM
sensitive. (Carman 2006).
In mammals
The PAP1 activity is thought to be involved in the synthesis of triglyceride,
phosphatidylethanolamine and phosphatidylcholine (Cascales 1984). Studies with rat lung
microsomes have shown that the magnesium dependent PAP1, was removed from
microsomes when washed with (0.5M) of sodium chloride while magnesium independent
PAP-2 remained associated with microsomes. The washed microsomes lost their ability to
incorporate [14C] glycerol-3-phosphate through phosphatidic acid into triglyceride and
phosphatidylcholine. There was also a concomitant increase in labeling of phosphatidic
acid in washed microsomes. Addition of magnesium dependent PAP1 isolated by gel
filtration
from
wash
supernatant
restored
the
labeling
of
triglyceride
and
phosphatidylcholine. Magnesium independent PAP2 isolated from cytosol when added to
the washed microsomes was incapable of restoring glycerolipid synthesis (Walton 1984).
15
PAP1 activity is cytosolic and upon stimulation by fatty acids or acyl-CoAs the
enzyme has been shown to translocate from cytosol to the endoplasmic reticulum, where
it is active (Reue 2008). The molecular identity of PAP1 was unknown until recently. In
yeast PAP1, activity was purified and the amino acid sequencing identified it as Pah1, the
yeast ortholog of mammalian lipin protein (Han 2006). LPIN-1 a member of the LPIN
gene family was initially identified by positional cloning as the gene responsible for fatty
liver dystrophy (fld), diabetes and diminished adipose tissue in mice (Péterfy 2001). The
mechanism by which this gene would cause lipodystrophy was not clear.
Subsequent biochemical characterization of human LPIN 1-3 encoded lipin
proteins (lipin-1A, lipin-1B, lipin-2 and lipin-3) confirmed their role as PAP activity
specific for phosphatidic acid. It was an exquisite example of the power of using model
organisms as tools to establish identity of mammalian lipid metabolizing enzymes.
Recombinant lipin proteins, when expressed in 293T cells, show that lipin-2 and lipin-3
exhibit 4- fold less PAP activity than lipin-1. In the fld mice, PAP1 activity encoded by
LPIN-1 was completely absent in white and brown adipose tissue and skeletal muscle.
Thus Lipin-1 accounts for all PAP activity in these metabolic tissues (Han 2006; Donkor
2007). Human LPIN-1 mRNA levels are abundant in liver and brain while LPIN2-3 are
significantly expressed in stomach, pancreas and intestine (Reue 2008). The lipin-1
activity is regulated transcriptionally. In primary culture of mouse hepatocytes the mRNA
level of LPIN-1 increased upon 4 hour incubation in media containing glucocorticoids,
cAMP and glucagon. There were no changes observed in the mRNA levels of LPIN-2 and
LPIN-3 isoforms (Manmontri 2008).
16
Lipin-1 undergoes phosphorylation upon insulin stimulation and in sharp contrast,
epinephrine leads to its dephosphorylation. The phosphorylation did not affect PAP-1
activity but mediated cytoplasmic to microsomal localization of lipin-1 (Reue 2008). The
PAP-1 activity levels increased in liver in fasting conditions and this correlated with
increase in mRNA levels of Lpin-1. Most of these studies have shown lipin-1 to be the
regulated isoform and the contribution of lipin-2 and lipin-3 to triglyceride synthesis is
not known.
PAP2 activity is less selective for its substrate and dephosphorylates
lysophosphatidic acid, diacylglycerol pyrophosphate and sphingosine1-phosphate in
addition to phosphatidic acid. Therefore, this activity is referred to as lipid phosphate
phosphatase (LPP). LPP1-3, DPPL1 and DPPL2 encode for PAP2 activity in mammals
(Brindley 2004; Takeuchi 2007). The members of PAP2 (LPP) family are predicted to
regulate cell signaling by lipid phosphates and their dephosphorylated forms such as
diacylgycerol and sphingosine (Carman 2006).
In Yeast
In yeast, PAH1 encodes for PAP1 activity while DPP1, LPP1 contribute to PAP2
activity (Carman 2006) (Figure 1.3). Pah1 shares sequence similarity with mammalian
PAP1 enzyme, Lipin1. Pah1 is localized to the cytosolic and membrane fractions of cell.
The pah1∆ deletion mutants when labeled with
32
Pi to steady state show an increase in
cellular PA levels by 120-160% consistent with its role as PAP. The pah1Δ mutants
showed
a
decrease
in
phosphatidylcholine
(43%)
phosphatidylethanolamine (50%) and phosphatidylinositol (80%).
and
increase
in
17
The incorporation of [2-14C] acetate in triglyceride was reduced by 92% in pah1Δ
mutant stationary phase and by 62% in exponential phase. All these results show that
PAH1 is responsible for the generation of diglyceride required for the synthesis of
phospholipids and triglyceride in S. cerevisiae (Han 2006). PAP activity encoded by
PAH1 is inhibited by phosphorylation and ATP (O'Hara 2006).
DPP1 and LPP1 encoded enzymes have broad substrate specificity and they are
able to utilize lysophosphatidic acid and diacyglycerol pyrophosphate besides
phosphatidic acid. The dpp1Δlpp1Δ mutants when labeled with [2-14C] acetate did not
show any major effect on neutral lipid composition in either the exponential or stationary
growth phase. DPP1 and LPP1 are responsible for regulation of phosphatidic acid levels
in vacuoles and Golgi but they might not contribute to the de novo synthesis of
triglyceride that occurs in endoplasmic reticulum (Carman 1997). A dpp1∆lpp1∆pah1∆
triple deletion yeast mutant still shows some PAP1 activity, suggesting the presence of an
additional gene or genes that are yet to be identified (Han 2006).
Step 4: Synthesis of triglyceride
In this terminal and unique step of triglyceride synthesis the diglyceride is esterified to
triglyceride by an acyl CoA: diacylglycerol acyltransferase (DGAT) reaction (Figure 1.1,
Appendix 1)
In mammals
DGAT1 and DGAT2 catalyze diglyceride esterification reaction in mammals (Figure
1.2). DGAT1 was identified by sequence similarity to acyl-CoA: cholesterol
acyltransferase (ACAT1). Mouse DGAT-1 protein is 20% identical to the mouse ACAT1.
18
DGAT1 cDNA when expressed in H5 insect cells, showed acyl CoA dependent activity
capable of utilizing only diglyceride (Cases 1998). Normal triglyceride levels in plasma
and adipose tissue of DGAT1-/- mice indicated the presence of another triglyceride
synthetic mechanism. Subsequently DGAT2 was identified by sequence homology to a
DGAT
purified
from
the
oleaginous
fungus
M. rammaniana
using
column
chromatography. DGAT2 does not share sequence similarity to DGAT1 that is a member
of ACAT family. DGAT2 when expressed in insect cells showed DGAT activity which
was specific for diglyceride and sensitive to magnesium chloride concentrations higher
than 20mM (Cases 2001). DGAT1 and DGAT2 have similar substrate specificities for
acyl-CoAs and prefer oleoyl-CoA to palmitoyl-CoA, arachidonoyl CoA and linolenoyl
CoA at a fixed concentration of 25μM (Cases 2001).
Both DGATs are expressed in tissues that are active in triglyceride synthesis, such
as white adipose tissue (WAT), small intestine, liver, and mammary gland. DGAT1
mRNA levels are highest in small intestine, while DGAT2 is expressed at high levels in
liver and white adipose tissue (Cases 1998; Cases 2001; Stone 2004). DGAT1-/- mice are
viable, have 50% less body fat and are resistant to diet induced obesity. Disruption of
DGAT2 gene in mice leads to perinatal lethality (~ 6 hours after birth), decrease in plasma
triglyceride by 64% and undetectable triglyceride in liver (Stone 2004). The inability of
DGAT1 to compensate for DGAT2 suggests that these two enzymes have different
functions. DGAT1 and DGAT2 overexpression in liver increased their mRNA levels by
ninety fold and two fold and increased the hepatic triglyceride content by three fold and
five fold respectively.
In comparison to DGAT1, small increase in DGAT2 mRNA
resulted in greater increase in triglyceride content (Monetti 2007).
19
This study reinforced that DGAT2 might be more specific and effective than
DGAT1 in promoting triglyceride synthesis. There are very few studies, which have
examined the regulation of DGATs. In differentiating 3T3-L1 adipocytes, the DGAT1
mRNA increases by seven fold whereas the protein level increases by 90 fold, suggesting
posttranscriptional regulation of DGAT1 gene. Increase in DGAT1 protein level by 90
fold correlated with 100 fold increase in DGAT activity in differentiated adipocytes.
Overexpression of DGAT1 in 3T3-L1 adipocytes by an adenovirus construct increased
mRNA levels by 20 fold but the protein levels by only two fold. The discordant DGAT1
protein and mRNA expression were not due to changes in protein stability. The steady
state DGAT1 protein levels in 3T3-L1 adipocytes were not altered in the presence of
proteolytic inhibitor N- acetyl-Leu-Leu-norleucinal (ALLN). In addition, treatment of
3T3-L1 adipocytes with cycloheximide did not show change in the protein turnover.
DGAT1 when mutated at conserved tyrosine phosphorylation site to phenylalanine
(T316F) did not affect DGAT activity in 3T3-L1 adipocytes. DGAT1 encoded enzyme
activity does not seem to be regulated by phosphorylation. Thus it was speculated that
regulation of DGAT1 expression occurs at the translational level (Yu 2002).
Total DGAT specific activity was found to decrease by 86% upon 24 hours
incubation of 3T3-L1 adipocytes in media not containing glucose. Addition of glucose to
the media of glucose-starved adipocytes for additional 24 hours increased the DGAT
activity by 2- fold. DGAT1 mRNA were abolished in the adipocytes incubated in media
not containing glucose and were replenished upon addition of glucose to the media. The
DGAT2 mRNA levels were unaffected by similar treatment (Meegalla 2002). To further,
study the effect of insulin on DGAT1 and DGAT2 mRNA levels the mature adipocytes
20
were serum starved for 16 hrs followed by addition of insulin for 24 hours. Insulin was
shown to preferentially enhance DGAT2 mRNA levels (Meegalla 2002). CAAT/enhancer
binding proteins (alpha and beta) play an important role in adipogenesis and these
transcription factors have been shown to increase DGAT2 mRNA levels during adipocyte
differentiation (Payne 2007)
Studying DGAT2 regulation is complicated because DGAT2 gene family in
humans has six members, identified by sequence similarity to DGAT2 the original
member of the family. Three members are monoacylglycerol acyltransferases (MGAT13), which synthesize diacylglycerol by esterification of monoacylglycerol. MGAT1-3
when expressed in insect cells also show weak DGAT activity(Cao 2007). Two other
members are wax-alcohol acyltransferases, that synthesize wax esters and the last
member hDC3 remains to be biochemically characterized (Sturley 2007).
In Yeast
All the enzymes responsible for mediating diglyceride esterification in
Saccharomyces cerevisiae have been identified. DGA1, LRO1 and ARE2 encoded
enzymes mediate diglyceride esterification in yeast (Oelkers 2002) (Figure 1.3). These
three genes belong to different gene families. DGA1 is the yeast homolog of human
DGAT2, and is responsible for acyl CoA dependent DG esterification. LRO1 is a member
of lecithin cholesterol acyltransferase (LCAT) family and mediates triglyceride synthesis
by an acyl CoA independent mechanism that utilizes phospholipids to esterify
diacylglycerol (phospholipid diacylglycerol acyltransferase or PDAT) (Oelkers 2002).
Dga1 and Lro1 mediate most of triglyceride synthesis (98%) while ARE2, a homolog of
21
DGAT1, has a minor role. Depending on the growth conditions, Dga1 and Lro1
contribute differently to the triglyceride synthesis (Oelkers 2000; Oelkers 2002). The
dga1Δ yeast strain when grown to stationary phase and pulse labeled with [3H] oleate for
30 minutes showed 50% reduction in incorporation of radioactive oleate into triglyceride.
The lro1∆ deletion mutants grown to stationary phase in the similar experiment did not
show significant change in triglyceride synthesis. However, during exponential growth
phase lro1∆ deletion led to 75% loss of triglyceride synthesis while dga1∆ deletion
caused 25% reduction. This suggests that Dga1 can mediate all of the triglyceride
synthesis in stationary phase in the absence of Lro1, but not in exponential phase where
Lro1 plays a major role in diglyceride esterification (Oelkers 2000; Oelkers 2002). A
dga1∆lro1∆are2∆ strain lacks the ability to synthesize triglyceride (Oelkers 2002), and
has been used a model system to study the role of DGAT2 family members in triglyceride
synthesis (Turkish 2005).
1.1.2 Regulation of triglyceride synthesis
Since several enzymes in the triglyceride synthetic pathway have only been
recently identified, their regulation has just begun to be studied. The role of transcription
factors, liver X receptors (LXR), sterol regulatory element binding protein (SREBP-1c),
peroxisome proliferator-activated receptor-γ (PPARγ) and hormonal and nutritional
regulators has been acknowledged (Coleman 2004). However, few studies have focused
on the enzymes involved in triglyceride synthesis and the intracellular regulation of the
pathway. There can be multiple points of regulation of a biochemical pathway.
22
The first enzyme of the metabolic pathways is often the regulated step, and several
studies have shown that the mitochondrial GPAT regulation occurs at the transcriptional
level. Interestingly, animal models lacking each of the four reactions of the triglyceride
synthesis show profound effect on triglyceride levels. The intermediates of the pathway
lysophosphatidic acid, phosphatidic acid and diglyceride, are signaling molecules and is
possible that these alter the gene expression of triglyceride synthetic enzymes. Regulation
is also likely to occur at branch points of the pathway. Diacylglycerol esterification,
mediated by DGAT is one such branch point. DGAT is the only reaction that exclusively
mediates the terminal step of triglyceride synthesis. In cultured permeabilized rat
hepatocytes, under the experimental conditions when the substrates for the triglyceride
synthetic pathway are available, DGAT has been regarded as a rate-limiting step
(Mayorek 1989).
In comparison to mammals, yeast enzymes that mediate DG esterification have
been completely identified. Yeast cells have fewer and conserved isoforms of triglyceride
synthetic enzymes and the gene enzyme relationship has been established for almost all of
them. This, coupled with the availability of powerful genetic tools, can allow studies on
regulation of intracellular triglyceride synthesis.
23
1.2 Phospholipid Biosynthesis
Phospholipids are structural and functional components of biological membranes.
They typically have a glycerol backbone with acyl chains linked by ester linkage to the
first and second carbon of glycerol, and a polar group attached by a phosphodiester
linkage to the third carbon. Phosphatidylcholine (PC), phosphatidylethanolamine (PE),
phosphatidylinositol (PI) and phosphatidylserine (PS) are the major phospholipids.
Phosphatidylglycerol (PG) and cardiolipin (CL) are also present in mitochondrial
membranes (Appendix 1). Phospholipid biosynthesis initially described by Kennedy
occurs mainly by CDP-diacylglycerol (CDP-DAG) and CDP-choline pathway (Figure
1.5) (Kennedy 1961). The synthesis of phosphatidic acid, a major building block for
phospholipids occurs by reactions common to triglyceride synthesis described earlier.
Phosphatidic acid is an important branch point intermediate as it can form either
diacylglycerol or CDP-DAG (Figure 1.5). Phosphatidic acid is converted to
diacylglycerol, a reaction catalyzed by phosphatidic acid phosphatase (PAP). This
diacylglycerol can be utilized either to synthesize triglycerides or PC, PE and PS. The
conversion of phosphatidic acid to CDP-DAG is mediated by CDP-DAG synthase
(CDS). CDP-DAG is converted to PI, a reaction catalyzed by phosphatidylinsotiol
synthase (PIS). Cardiolipin, an exclusive mitochondrial phospholipid is also synthesized
from CDP-DAG.
24
Figure 1.5 Phospholipid synthetic pathway in mammals The abbreviations used are:
GPAT: Glycerol-3-phosphate acyltransferase, AGPAT: Acylglycerol-3-phosphate
acyltransferase, PAP: Phosphatidic acid phosphatase, DGAT: Diacylglycerol
acyltransferase, CDP-DAG: CDP-diacylglycerol, CDS: CDP-diacylglycerol synthase,
CL: cardiolipin CLS: Cardiolipin synthase, PI: Phosphatidylinositol, PIS: PI synthase,
PS: Phosphatidylserine, PC: Phosphatidylcholine, PSS1: PS synthase1, PSS2:
Phosphatidylserine synthase 2, PSD: PS decarboxylase, PE:Phosphatidylethanolamine,
PEMT: PE methyl transferase, EK: Ethanolamine kinase, ET: CTP:phosphoethanolamine
cytidylyltransferase, EPT: Ethanolamine phosphotransferase, CK: Choline Kinase, CT:
CTP:phosphocholine cytidylyltransferase, CPT: Choline phosphotransferase
25
Figure 1.6 Phospholipid synthetic pathway in Saccharomyces cerevisiae The
abbreviations used are: GPAT: Glycerol-3-phosphate acyltransferase, AGPAT:
Acylglycerol-3-phosphate acyltransferase, PAP: Phosphatidic acid phosphatase, DGAT:
Diacylglycerol acyltransferase, CDP-DAG: CDP-diacylglycerol, CDS: CDPdiacylglycerol synthase, CL: cardiolipin CLS: Cardiolipin synthase, PI:
Phosphatidylinositol, PIS: PI synthase, PS: Phosphatidylserine, PC: Phosphatidylcholine,
PSS1: PS synthase1, PSD: PS decarboxylase, PE:Phosphatidylethanolamine, PEMT: PE
methyl transferase, EK: Ethanolamine kinase, ET: CTP:phosphoethanolamine
cytidylyltransferase, EPT: Ethanolamine phosphotransferase, CK: Choline Kinase, CT:
CTP:phosphocholine cytidylyltransferase, CPT: Choline phosphotransferase
26
PC and PE can be synthesized via the CDP-choline and CDP-ethanolamine
pathway. Choline kinase (CK) mediates the formation of phosphocholine, the first
reaction of the CDP-choline pathway. The phosphocholine is then converted into CDPcholine by CTP: phosphocholine cytidylyltransferase (CT). This reaction requires
activation by cytosine triphosphate (CTP). In the subsequent and last reaction, catalyzed
by cholinephosphotransferase (CPT), a diacylglycerol molecule is utilized to form PC. A
similar pathway converts ethanolamine to PE. This PE can get methylated to PC by
phosphatidylethanolamine methytransferase (PEMT). PC synthesis by methylation in
addition to CDP-Choline pathway occurs only in liver. In all other tissues CDP-choline
pathway is the only pathway to synthesize PC. PS is synthesized from PC and PE by a
base dependent reaction. PS synthase-1 (PSS-1) mediates exchange of serine for choline
while PS synthase-2 (PSS-2) uses PE. PS is also converted to PE by PS decarboxylase
(PSD).
In Yeast
The basic pathways of phospholipid biosynthesis in S.cerevisiae are similar to those
in higher eukaryotes with the exception of PS synthesis (Figure 1.6). In yeast, PS is
synthesized from CDP-DAG and serine whereas in mammalian cells, the only pathway to
synthesize PS is a base-exchange reaction in which the head group of PC and PE is
replaced by serine. PC synthesis in yeast occurs primarily by CDP-DAG pathway
(Carman 1989), while in mammals with the exception of liver, CDP-choline pathway is
the only pathway to synthesize PC.
27
1.2.1 Acyl chain asymmetry in phospholipids
Phospholipids exhibit a variety in their molecular species, because of different
combinations of acyl chains present at the sn-1 and sn-2 positions. In general, there is an
asymmetrical distribution of acyl group on phospholipids (Hanahan 1960). Saturated
fatty acids are usually esterified at the sn-1 position whereas unsaturated fatty acids are
esterified at the sn-2 position. This asymmetrical distribution of acyl chains in
phospholipids might influence the degree of order and motion of phospholipid molecules
in lipid bilayer, a property referred to as membrane fluidity. The temperature, at which
the membrane changes from gel like to a fluid like physical state, is dependent on the
acyl chain composition of phospholipids. This transition temperature (Tt) is higher for
distearoyl phosphatidylcholine (58ºC), phospholipid with two saturated acyl chains
compared to 1-stearoyl-oleoyl phosphatidylcholine (3ºC), phospholipid with one
saturated and one unsaturated acyl chain (Cronan 1975).
Membrane properties like carrier mediated transport, phagocytosis and endocytosis
are affected with changes in acyl chain composition of phospholipids (Spector 1985). It is
acknowledged that membrane fluidity and properties are also influenced by other
components of membrane such as cholesterol and proteins. This positional distribution of
acyl groups in phospholipids is particularly important when arachidonic acid is present at
the sn-2 position. This fatty acid is a precursor for biologically active eicosanoids (Funk
2001). The distinct acyl chain composition of phospholipids has been observed in various
cells and tissues. It is possible that acyl chain composition of phospholipids is required
for a particular cellular function, an example being dipalmitoylphsopahtidylcholine, a
28
major component of the pulmonary surafactant (Yamashita 1997). Mostly the
physiological relevance of individual molecular species of phospholipids is not known.
1.2.1.1 Mechanisms to incorporate acyl chains in phospholipids
There can be two mechanisms to incorporate acyl chains in phospholipids: (1) de
novo phospholipid synthesis and (2) acyl chain remodeling of existing phospholipids
by deacylation/reacylation reaction.
Incorporation of acyl chains by de novo phospholipid synthesis
De novo synthetic enzymes catalyzing the fatty acid esterification at sn-2 position
might determine positional distribution of acyl groups in phospholipids. 1-acylglycerol3phosphate acyltransferases (AGPAT) introduce acyl chains at the sn-2 position of the
glycerol backbone of lysophosphatidic acid to form phosphatidic acid (PA), an important
intermediate in the de novo synthesis of membrane phospholipids and triglycerides
(Figure 1.1) (Kennedy. 1961). Among the AGPATs 1-9, only AGPAT-1 and AGPAT-2
show robust enzyme activity. Cell lysates from insect cells expressing human AGPAT-1
using 10μM of acyl-CoAs showed highest activity for palmitoyl-CoA (16:1) and then the
rank order was C16:0=C14:0=C12:0=C18:2>C18:3=C18:0=C20:4>C18:1. In the same
study using 45 μM of acyl-CoAs the preference was in the rank order
C16:1=C16:0=C14:0>C18:3=C18:2>C20:4=C18:0=C18:1.
At
these
two
fixed
concentrations AGPAT-1 seems to utilize wide range of acyl-CoAs from C12- C18 with
no clear preference for acyl groups by degree of saturation (Aguado 1998).
The
preference of the AGPAT-2 for different molecular species of acyl-CoA was studied
29
using membrane preparations of Sf9 cells expressing the human AGPAT2. At a single
concentration
of
8μM
acyl-CoAs
were
preferred
in
the
following
order:
C18:1>C18:2=C14:0=C16:0>C18:0>C20:4. The AGPAT2 activity displayed a Vmax of
200 nmol/min/mg and an apparent Km of 2μM with varying concentrations of oleoylCoA. In the same study competition experiments were performed with Sf9 membrane
preparations containing AGPAT2, [3H] lysophosphatidic acid, 0.6μM [14C]18:1-CoA and
1.2 μM unlabeled acyl-CoAs. AGPAT2 displayed equal preference for C18:0-CoA and
C16:0-CoA in comparison to 18:1-CoA (Eberhardt 1997; Aguado 1998; Leung 2001
Hollenback 2006). Due to single concentration of acyl-CoAs used in these studies to
determine the acyl-CoA specificity of AGPAT1 and AGPAT2 it is difficult to compare
substrate preferences of the enzyme in terms of catalytic efficiency. However, these
results suggest that AGPAT1 and AGPAT2 might have a generic role in synthesizing
precursors with a variety of acyl chain composition for phospholipids and triglyceride
synthesis and might not contribute to asymmetric distribution of acyl chains in
phospholipids.
Acyl chain remodeling of existing phospholipids
Various studies have shown that the distribution of fatty acids in phospholipids
present in tissues and cells was different from its precursor molecule phosphatidic acid.
This suggested that the phospholipid undergo fatty acid remodeling after de novo
synthesis. Experiments using [14 C]acetate to label fatty acid residues and [14C] glycerol
to label the glycerol backbone of phospholipids showed for the first time differences in
turnover of acyl chains and glycerol in phospholipids (Lands 1958).
30
These results introduced the concept that the phospholipid species synthesized by
the de novo synthetic reaction undergo deacylation at the sn-2 position by phospholipase
A2 and reacylation by lysophospholipid acyltransferases to form remodeled phospholipid
species
(Lands
cycle)
(Figure
1.7).
The
presence
of
acyl-CoA
dependent
lysophosphatidylcholine acyltransferase (LPCAT) activity in rat liver microsomes
supported the idea of phospholipid remodeling (Lands 1960). The rat liver microsomal
LPCAT activities selectively incorporated palmitoyl-CoA at the sn-1 position of 2- acyl
lysophosphatidylcholine
and
oleoyl-CoA
at
the
sn-2
position
of
1-acyl
lysophosphatidylcholine. These experiments were done with mixtures of 1-acyl lysoPC
and 2-acyl lysoPC with a single concentration of 0.5mM [14C] fatty acid and 0.2mM CoA (Lands 1963). This demonstrated the role of acyl-CoA specificity of these activities in
maintaining asymmetrical distribution of acyl chains in phospholipids.
There are very few in vivo studies on the deacylation-reacylation mechanism for
acyl chain remodeling in phospholipids. Labeled lysophosphatidylcholine (lysoPC) and
lysophosphatidylethanolamine (lysoPE) when injected intravenously disappeared from
blood and labeled PC and PE were recovered in organs such as liver, small intestine,
skeletal muscles, lungs, kidney and heart. To study the mechanism of formation of PC,
lysoPC labeled in both phosphate (32P) and acyl chain (14C) was injected into rats. The
labeled PC was found to have a similar 14C/32P ratio suggesting that majority of PC was
synthesized from lysoPC by acylation reaction and not by transacylation reaction
between two lysophospholipid molecules (Stein 1966).
31
Figure 1.7 Phospholipid remodeling (Lands Cycle)
32
Another study showed that remodeling of PC occurred in tissues post synthesis.
Hamster hearts were perfused with, [1-3H] glycerol and then the lipids were extracted at
various time points (0, 30, 60, 120 and 240 minutes). Immediately after label was
introduced, the acyl chain composition of diacylglycerol and newly synthesized PC was
similar. The composition of newly synthesized PC was different from that of endogenous
PC. During the chase period the medium chain and saturated species showed gradual
decrease and dienoic species increased. At the end of chase (240 minutes post labeling)
the acyl chain distribution in PC was found to be similar to that of the endogenous PC.
Since the labeling in diacylglycerol decreased by 90% after 30 minutes the redistribution
of label in molecular species of PC did not occur due to de novo synthesis of
phospholipids but was a result of acyl chain remodeling of phospholipids by deacylation
and reacylation (Arthur 1984).
1.2.1.2 Acyl chain remodeling of phospholipids by acyl-CoA dependent
lysophospholipid acyltransferases
Lysophospholipids are acylated by two types of reactions. The acyl-CoA dependent
reactions involve transfer of acyl group from acyl-CoA to lysophospholipids to form
phospholipids and these reactions are catalyzed by acyl-CoA: lysophospholipid
acyltransferases (LPLAT). The acyl-CoA independent reactions also known as
transacylation, involve the transfer of acyl group of a phospholipid directly to another
lysophospholipid to synthesize phospholipids. The focus of this study is the acylation
mediated by acyl-CoA dependent 1-acyl lysophospholipid acyltransferase.
33
Since LPLAT activity is involved in manipulating the acyl chain composition of the
phospholipids it is likely that this activity is present in most of the tissues. In rat brain in
vitro LPCAT activity was demonstrated (Webster 1964). Acylation activity for 1-acyl
lysophosphatidylinositol
and
1-acyl
lysophosphatidyserine
and
2-acyl
lysophosphatidylserine was reported in rat liver (Yamashita 1997). In rat liver
microsomes 0.5mM linoleate in the presence of 0.1mM Co-A was incorporated
preferentially in the sn-2 position of 1-acyl lysophosphatidylethanolamine in comparison
to stearate (Lands 1963). Also in rat pancreas, enzyme activity in homogenate responsible
for acylation of 2-acyl lysoPC, 2-acyl lysoPE, 2-acyl lysoPI and 2-acyl lysoPS showed
preference for arachidonate over stearate at 17μM in the presence of 0.1 mM CoASH and
6mM ATP (Rubin 1983).
In general, in these single concentration studies LPLAT activities seem to prefer
saturated acy-CoA at the sn-1 position and unsaturated acyl-CoA for the sn-2 position,
thus maintaining the acyl chain asymmetry in phospholipids. There are exceptions to this
selectivity, in adult rat lung type II epithelial cells 1-acyl lysophosphatidylcholine
acyltransferase (1-acyl-LPCAT) shows preference for palmitoyl-CoA at varying
concentrations ranging from 0.5-22 μM. The Km and Vmax values were not reported in the
study (Tansey 1975). However, in rabbit lung cells 1-acyl LPCAT showed only mild
preference for palmitoyl-CoA (Km=15μM, Vmax=137nmol/min/mg) over oleoyl CoA
(Km=16μM, Vmax= 100 nmol/min/mg). The reacylation system was suggested to
catalyze the synthesis of dipalmitoyl phosphatidylcholine, a major constituent of
pulmonary surfactant system (Yamashita 1997). It is possible that physiological
concentrations of palmitoyl-CoA in lung cells favor its incorporation in the sn-2 position.
34
Almost 50 years after the lysophospholipid acyltransferase activity was reported,
there are very few studies on molecular nature of these enzymes. The genes encoding
mouse lysophsophatidylcholineacyltransferase-1(LPCAT1) and lysoplatelet activating
factor acetyltransferase (LysoPAFAT)/ LPCAT2 were recently identified (Nakanishi
2006; Shindou 2007). LPCAT1 has been suggested to catalyze synthesis of dipalmitoyl
PC in alveolar type II cells of lung. Platelet activating factor has an ether linked alkyl
chain at the first carbon of glycerol, acetyl group in the second carbon and choline head
group linked to the third carbon similar to phosphatidylcholine (Appendix 1).
LysoPAFAT/LPCAT2 exhibited acetyltransferase activity also capable of incorporating
arachidonoyl-CoA into sn-2 position of lysoPAF to synthesize PAF (Nakanishi 2006;
Shindou 2007). The gene or genes encoding the lysophospholipid acyltransferase activity
in other tissues reported in literature, responsible for asymmetrical distribution of fatty
acids in phospholipids are yet to be identified.
1.2.1.3 Phospholipid remodeling in Saccharomyces cerevisiae
Similar to mammals, yeast phospholipids have saturated acyl groups (mostly
palmitate) localized to sn-1 position and unsaturated acyl group (predominantly oleate) to
the sn-2 position in phospholipids (Yamada 1977). As reviewed earlier, yeast can
synthesize PC by either methylation of PE or via CDP-choline pathway (Figure 1.6).
However, in wild type yeast the steady state acyl chain composition of PC is different
from that of PC newly synthesized by either of these pathways (Boumann 2003). Yeast
cells when incubated with [3H]oleic acid, just after 2 minutes, show rapid and exclusive
incorporation of oleate preferentially in sn-2 position of PC, PE , PI and PS.
35
The deacylation mediated by phospholipase and reacylation was suggested to explain
these
findings
(Wagner
1994).
Later,
an
acyl-CoA
dependent
2-acyl
lysophosphatidylcholine activity localized to endoplasmic reticulum was reported in
yeast
(Richard
1998).
Acyl-CoA
independent
mitochondrial
1-acyl
lysoPC
acyltransferase activity encoded by TAZ1 has been described in yeast (Testet 2005).
However, for the acyl CoA dependent lysophospholipid acyltransferase activity the gene
enzyme relationship was not established until the present study was undertaken (Jain
2007). Identification of yeast gene would enable the identification of the human
homologs responsible for the reacylation arm of phospholipid remodeling in higher
eukaryotes.
1.2.1.4 Physiological role of lysophospholipid acyltransferases
Lysophospholipid acyltransferases (LPLAT) play an important physiological role in
selective placement of acyl chains in the sn-1 and sn-2 position of phospholipids.
Remodeling of phospholipids helps to maintain acyl chain composition of membrane
lipids and allows for the incorporation of arachidonic acid in the sn-2 position of
phosphatidylcholine which when released by cytosolic PLA2 is a substrate for
eicosanoids (Funk 2001). The acyl chain composition of the peritoneal macrophage
membrane phospholipids when enriched for saturated fatty acids, showed a reduction in
endocytosis and bilayer fluidity (Mahoney 1980). Although it is agreed that
lysophospholipid acyltransferases are involved in remodeling of acyl chains in
phospholipids but this might not be the only function of acyltransferases in all tissues.
36
In intestinal mucosa, 1-acyl-lysophosphatidylcholine acyltransferase activity is enriched
in the brush border free microsomal fraction. At a fixed concentration of 125μM, when
equimolar amounts of labeled oleoyl-CoA and unlabeled palmitoyl-CoA were used, the
enzyme incorporated 60% less palmitoyl-CoA in the sn-2 position of lysoPC to
synthesize PC. This enzyme synthesizes PC from lysoPC formed after digestion of
phospholipids. This PC can then be packaged into chylomicrons and secreted into lymph.
Thus this enzyme has an important physiological role in absorption of phospholipids
(Subbaiah 1969).
Few studies have suggested that lysophospholipid acyltransferases might play an
important role in vesicular trafficking. Lysophospholipids produced by the action of
cytoplasmic phospholipase A2 on membrane phospholipids, have been shown to induce
the formation of Golgi membrane tubules. These tubules most likely play an important
role in intracellular trafficking pathways, that include transport between Golgi to
endoplasmic reticulum (ER) and maintenance of Golgi structure. It has been proposed
that lysophospholipid acyltransferases tightly associated with Golgi membranes reduces
the lysophospholipid levels and promotes fission of tubules leading to vesicle formation.
This hypothesis is supported by the in vitro studies in which Golgi membrane incubated
with [14C] palmitoyl-CoA incorporated majority of labeled acyl chain into PC and PE.
However, in the presence of CI-976, an ACAT inhibitor, the lysophospholipid
acyltransferase activity associated with Golgi membrane was inhibited. In vitro and in
vivo studies on the same inhibitor have shown that it induces tubule formation in Golgi
and increase lysophospholipid content in Clone 9 cells (Drecktrah 2003).
37
High levels of lysophosphatidylcholine lead to apoptosis (Takahashi 2002; Han 2008),
cell lysis (Weltzien 1979) and inflammation (Kougias 2006). Thus in addition to the
above mentioned functions lysophospholipid acyltransferases might play an important
role in regulation of lysophospholipid levels, thus mitigating their harmful effects.
Characterization of molecular nature of lysophospholipid acyltransferases will provide us
with tools (RNAi or knock out animals) to understand the physiological role of these
enzymes.
1.3. Specific Aims
1. Examine the intracellular regulation of triglyceride synthesis at the step of
diglyceride esterification in Saccharomyces cerevisiae.
2. Identify novel yeast acylglycerol-3-phosphate acyltransferase(s) (AGPAT) in
Saccharomyces cerevisiae.
3. Identify uncharacterized human genes with sequence similarity to the novel yeast
AGPAT.
38
CHAPTER 2: REGULATION OF TRIGLYCERIDE SYNTHESIS IN
SACCHAROMYCES CEREVISIAE
2.1 Abstract
Dga1, Lro1 and Are2 are the only enzymes that mediate the terminal step of
diglyceride esterification to synthesize triglyceride in Saccharomyces cerevisiae.
Identification of all the enzymes responsible for diglyceride esterification allows yeast to
be used as a model system to study the intracellular regulation of triglyceride synthesis.
Initially, various genetic and growth conditions were studied where triglyceride synthesis
varies. Using metabolic labeling with [3H] oleate, we found that the deletion of POX1,
the enzyme that mediates the initial step of fatty acid oxidation, significantly increased
triglyceride synthesis by 75%. However, deletion of two glycogen synthase enzymes
(GSY1 and GSY2) did not alter triglyceride synthesis. To identify additional growth
conditions in which triglyceride synthesis is regulated the effect of water soluble
phospholipid precursors, inositol (75 μM) and choline (1 mM) on triglyceride synthesis
was studied. Addition of inositol and choline or both to growth medium did not alter
triglyceride synthesis.
Additionally, deletion of the two enzymes that mediate the vast majority of
triglyceride synthesis, LRO1 and DGA1, did not result in an increase in glycogen
synthesis. Therefore, an inability to hydrolyze fatty acids seems to promote their storage
while an inability to store energy as carbohydrate does not result in a compensatory
increase in energy storage in lipid form.
39
We further hypothesized that Dga1 mediated diglyceride esterifying activity will
be regulated by the level of certain cellular metabolites. Specifically, those metabolites
that indicate a relatively energy poor environment (AMP, ADP and NAD+) would likely
inhibit the enzyme and the metabolites that indicate a relatively energy rich environment
(ATP, NADH, Acetyl CoA) would activate it. A lro1Δare1Δare2Δ triple deletion yeast
strain was created in which Dga1 was the only diglyceride esterifying enzyme. In vitro
diacylglycerol acyltransferase (DGAT) activity in microsomes from this strain was
measured in the presence of physiological concentration of the metabolites of interest.
DGAT activity was not regulated in response to the metabolites.
2.2 Introduction
Triglycerides are important energy storage molecules in all eukaryotes. The
intracellular triglyceride synthetic pathway was largely identified by Kennedy (Kennedy
1961) and shares initial steps with phospholipid synthesis. This de novo synthetic
pathway requires glycerol 3-phosphate and acyl-CoA as substrates (Figure 1.1). Glycerol
3- phosphate is acylated at the sn-1 position to form 1-acylglycerol-3-phosphate
(lysophosphatidic acid), and then at sn-2 position yielding phosphatidic acid.
Phosphatidic acid is then dephosphorylated to form diglyceride. The terminal and unique
step in triglyceride synthesis is the esterification of diglyceride catalyzed by
diacylglycerol acyltransferase (DGAT). In mammals, two independent enzymes DGAT1
and DGAT2 catalyze this reaction (Cases 1998; Cases 2001). DGAT1 is a member of the
acyl CoA: cholesterol acyltransferase (ACAT) gene family.
40
DGAT2, the founding member of the DGAT2 gene family, was identified by its
sequence similarity to two proteins DGAT enzymes purified from the fungus, Mortierella
ramanniana (Cases 2001). Members of the DGAT2 family share no sequence homology
to the ACAT family which includes DGAT1. In humans, the DGAT2 family is complex
and has seven members: DGAT2, three monoacylglycerol acyltransferases (MGAT1-3),
two wax alcohol acyltransferases (AWAT1-2) and hDC3 which remains to be
characterized. MGAT catalyzes the esterification of monoacylglycerol (MG) to
synthesize diglyceride, an important reaction for the absorption of dietary fat in small
intestine (Lehner 1996). MGAT1-3 when expressed in insect cells also show weak
DGAT activity (Cao 2007), hence the physiological role of the members of DGAT2
family is not well defined.
In yeast, enzymes mediating diglyceride esterification have been completely
identified. Three different enzymes mediate diglyceride esterification. Dga1, the yeast
ortholog of human DGAT2 enzyme mediates diglyceride esterification by a DGAT
reaction (Oelkers 2002). Lro1, a homolog of mammalian lecithin cholesterol
acyltransferase (LCAT) mediates triglyceride synthesis by phospholipid diacylglycerol
acyltransferase (PDAT) reaction (Oelkers 2000). This reaction utilizes phospholipids in
an acyl-CoA independent esterification of diglyceride. PDAT activity has also been
identified in plant species (Stahl 2004). However, in mammals LCAT specifically
catalyzes the cholesterol esterification. Dga1 and Lro1 contribute to 98% of triglyceride
synthesis in yeast cells grown in media containing low nitrogen or 0.1% oleate and in
logarithmic and stationary growth phase.
41
Are2, one of the sterol esterifying enzymes in yeast and homolog of DGAT1
contributes to the residual (2%) triglyceride synthesis (Oelkers 2002). Deletion of DGA1,
LRO1, and ARE2 leads to complete loss of triglyceride synthesis in yeast (Oelkers 2002).
Thus, Saccharomyces cerevisiae is a good model system to study the intracellular
regulation of triglyceride synthesis. In the current study we hypothesized that digyceride
esterification, the only committed step in triglyceride synthetic pathway, is responsible
for the regulation of triglyceride synthesis and the enzymes which mediate digyceride
esterification are regulated. In addition to this central hypothesis we also pursued the idea
that there is a coordinated regulation of triglyceride and glycogen (cellular energy
reserves) synthesis in a cell. Inability to synthesize triglyceride by digyceride
esterification might result in increased glycogen synthesis and vice versa. To address the
hypothesis the specific objectives of the study were: 1) identify genetic backgrounds and
growth conditions where triglyceride synthesis is altered, 2) determine if the changes in
the protein and activity levels of Dga1 and Lro1 are responsible for the alteration in
triglyceride synthesis in conditions identified in aim1 and 3) examine whether glycogen
synthesis is altered in the absence of triglyceride synthesis and vice versa.
42
2.3 Experimental Procedures
Material
Yeast extract, peptone, and Bacto-agar were from Fisher Scientific. Dextrose, inositol
and choline were from Sigma. Synthetic defined media, yeast nitrogen base were
obtained from Qbiogene (MP Biomedicals). Yeast extract peptone, plus 2% dextrose
(YPD), synthetic complete (SC), and sporulation media (1% Potassium acetate) were
prepared as described (Sherman 2002). [1-14C] oleoyl CoA (20,000 dpm/nmol) and [3H]
oleate (2.63 Ci/mmol) were from PerkinElmer Life Sciences. All other chemicals were
obtained from either Sigma or Fisher.
Yeast Strains
Molecular biology and yeast genetic procedures were performed according to
conventional protocols. Deletion mutant strains for GSY1 and GSY2 were generated by
homologous recombination in a W303-1B haploid (MATa ade2–1, can1–1, trp1–1, ura3–
1, his3–11, 15, leu2–3, 112) (Thomas 1989) by transformation with PCR derived
products containing 50 base pairs of GSY1 or GSY2-specific sequence flanking the
Kluyveromyces lactis URA3 sequence generated (Ito 1983; Rothstein 1991). GSY1
knockout
oligos
were
as
follows:
GSY1F,
5’
ATGGCTCGTGACTTACAAAATCATCTACTGTTCGAAGTAGCAACAGAAGTAC
ATGGCAATTCCCGGGGATCG
and
GSY1
R,
5’
TTAATTATCCTCGTAGTATGCAGACGTATCGTTGTCATCATCGTCATTGTTCA
ACATGGTGGTCAGCTGGAATT. GSY2 knockout oligos were as follows GSY2F, 5’
ATGTCCCGTGACCTACAAAACCATTTGTTATTCGAGACTGCGACTGAGGTACA
TGGCAATTCCCGGGGATCG
and
GSY2
R,
5’
43
TTAACTGTCATCAGCATATGGGCCATCGTCGTCATCGTCAGCTGCAGGATTCA
ACATGGTGGTCAGCTGGAATT. Single deletion transformants were confirmed by
PCR using gene specific primers. Conventional inter strain crosses were used to generate
double or triple deletion strains. The generation of yeast strains with single or multiple
deletions in the DGA1, LRO1, ARE1 and ARE2 genes have been described previously
(Oelkers 2002). The pox1Δ strain was obtained from Dr. Peter Oelkers. Yeast strains
were grown in YPD media , SC media (Adams 1997).
Pulse labeling
A dilute inoculation (1/1000 of a saturated culture) of each strain into YPD was grown
overnight at 30°C into logarithmic (log) phase (OD660 0.55–0.80). 4 ml of cells were
labeled with 4μl of [3H] oleate (2.63 Ci/mmol) at 30°C for 30 minutes with shaking,
washed twice with 0.5% tergitol and once with water, and frozen. Lipids were extracted
from cell pellets by lyticase treatment and organic extraction. The extracted lipids were
resolved by thin layer chromatography (TLC) in hexane: diethyl ether: acetic acid
(70:30:1) as described (Oelkers 2000). For pulse labeling experiments two independent
strains of each genotype were assayed on three different days.
Isolation of Microsomes
Yeast cells were grown in YPD into early stationary phase (O.D.660 = 1.0). The cells
were harvested, washed and lysed, and microsomes prepared from a 100,000 x g spin as
described (Leber 1994).
44
In vitro Diacylglycerol Acyltransferase Assay
All DGAT assays were performed in a final volume of 200 µl for 5 minutes at 23°C. The
final concentration of assay components was 175 mM Tris, pH 7.8, 10 mM sodium
acetate, 2 mg/ml BSA (essentially fatty acid free), 8 mM MgCl2, 160 μM
dioleoylglycerol (in ethanol), 7.5 - 60 µM [1-14C] oleoyl-CoA (20,000 dpm/nmol) and 40
μg of microsomal protein. The reactions were stopped by adding chloroform: methanol
(2:1) and lipids were extracted and resolved by TLC as described earlier. The background
was determined as the activity observed when the radiolabel was added after the
chloroform/methanol. Adenosine triphosphate (ATP), adenosine diphosphate (ADP),
adenosine monophosphate (AMP), oxidized nicotinamide adenine dinucleotide (NAD+),
reduced nicotinamide adenine dinucleotide (NADH), acetyl-CoA and malonyl-CoA were
individually added to the reaction mixture to study their effect on in vitro DGAT activity.
Parallel DGAT reactions were also conducted in the absence of these metabolites. Kinetic
data was analyzed by using EZ -Fit and GraphPad Prism 5 software. The Hill plot was
used to estimate the Hill number and apparent Km for oleoyl-CoA.
Glycogen estimation
Glycogen levels were assayed by alkaline digestion at 95ºC of yeast cells in 0.25 M
Na2CO3 as described in literature (Parrou 1997). Briefly, yeast cells grown to different
growth phases (O.D.660nm 1.2-3.6) were harvested by centrifugation (3000g for 5 minutes
and at 0-4ºC), carefully drained to remove culture media and resuspended in 0.25 ml of
0.25M Na2CO3 in screw top eppendorf tubes. The tubes containing the cell suspension
was then incubated in water bath at 95ºC for 4 hours.
45
After 4 hours the pH of the cell suspension was brought down to 5.2 by addition of 0.15
ml acetic acid and 0.6 ml of 0.2M sodium acetate, pH 5.2. The mixture was then
incubated overnight with 2.5 μl amyloglucosidase (10 mg of enzyme/ml of acetate buffer)
at 57 ºC with constant agitation in either a hybridization oven or in a water bath. After the
overnight incubation the suspensions were centrifuged for 3 minutes at 5000g, and
glucose was determined in 20μl of supernatant by addition of 200μl of glucose oxidase
reagent (Parrou 1997).
Statistical tests
The statistical analyses involved comparing two means by t tests and greater than two
means by employing ANOVA. F test for equality of variance among two samples was
conducted before comparing means of two samples by t test. Levene’s test of
homogeneity was used to establish equality of variances before analyzing the data by
ANOVA. Post hoc tests were conducted after ANOVA analysis to find out which means
significantly differed from each other. Tukey’s test was used for post hoc analysis if the
variances were equal and Tamhane’s T2 or Dunnett’s T3 were used if the variances were
not equal. The statistical analysis was done by using SPSS 16 and Excel software. All the
experiments were done at least 3 times on 3 different days with at least two different
strains with the same genotype to account for day to day and strain to strain variation. All
the data was expressed as mean ± S.D.
46
2.4 Results
Identification of genotypes and growth conditions that affect triglyceride synthesis
POX1 encodes for acyl-CoA oxidase, the first and rate-limiting enzyme in the βoxidation pathway in peroxisomes. The deletion of POX1 gene would disable the
hydrolysis of fatty acids and might induce triglyceride synthesis to store excess fatty
acids. The normal and pox1Δ deletion strains were pulse labeled with [3H] oleate for 30
minutes. Indeed pox1Δ showed 75% more [3H] oleate incorporation into triglyceride in
comparison to the normal yeast strain (Figure 2.1) (p<0.05). To further probe whether the
removal of the ability of cell to store energy as glycogen would result in an increased
storage of energy in the form of triglyceride, strains lacking glycogen synthetic enzymes
gsy1Δ, gsy2Δ and gsy1Δgsy2Δ deletion mutants were created. The deletion strains when
pulse labeled with [3H] oleate did not show significant alteration in triglyceride synthesis
in comparison to the normal strain (Figure 2.2).
Previous studies have shown that triglyceride synthesis is up regulated when
yeast enter stationary growth phase, undergo sporulation and when oleate is added to the
growth media (Illingworth 1973; Taylor 1979). To identify additional growth conditions
in which triglyceride synthesis is regulated the effect of inositol and choline, water
soluble phospholipid precursors on triglyceride synthesis was studied. The reason for
using these phospholipid precursors is that addition of 75µM inositol to the growth
medium decreased phosphatidic acid (PA), an important intermediate in triglyceride and
phospholipid synthesis, by 4.6 fold.
3
40
(% of total lipids)
[ H] Oleate incorporation in TG
47
*
30
20
10
0
Normal
pox1Δ
Figure 2.1 Inability to oxidize fatty acids significantly increases triglyceride
levels in pox1∆ strain. Indicated yeast strains were grown in YPD media to (O.D.
0.6-0.8, logarithmic phase), labeled with [3H] oleate for 30 minutes and harvested.
Lipids were extracted from cell pellets, resolved by thin layer chromatography
and quantified by scintillation counting of the cut TLC plates.( * indicates p<
0.05). The data represent mean ± S.D of 3 independent experiments.
3
25
(% of total lipids)
[ H] oleate incorporation in TG
48
20
15
10
5
0
Normal
gsy1Δ
gsy2Δ
gsy1Δgsy2Δ
Figure 2.2 Triglyceride levels in glycogen deficient strains. Yeast cells were
grown in YPD media to (O.D. 0.6-0.8, log phase), labeled with [3H] oleate for 30
minutes and harvested. Lipids were extracted from cell pellets, resolved by thin
layer chromatography and quantified by scintillation counting of the cut TLC
plates. The data represent mean ± S.D of 3 independent experiments.
49
Also, phosphatidylinositol (PI) synthesis increased by 6 fold at the expense of decrease in
phosphatidylserine (PS) and phosphatidylcholine (PC) synthesis by 1.2 and 3.8 fold
respectively (Kelley 1988). Also, phosphatidylinositol (PI) synthesis increased by 6 fold
at the expense of decrease in phosphatidylserine (PS) and phosphatidylcholine (PC)
synthesis by 1.2 and 3.8 fold respectively (Kelley 1988). Thus inositol, by perturbing the
synthesis of phospholipids and intermediates common to phospholipids and triglyceride,
might alter the synthesis of triglyceride. The addition of choline (1mM) to the medium in
addition to inositol enhances these effects (Homann 1985).
Therefore, we decided to study the effect of addition of inositol, choline or both
on triglyceride synthesis. In comparison to the YPD growth media all the components of
synthetic complete (SC) media are defined and allow easy manipulation of growth media
by systematic omission or inclusion of individual components. Normal yeast strains were
grown in SC media (lacking inositol and choline) with 2% glucose or the same media
supplemented with inositol (75 μM) or choline (1 mM) or both to logarithmic phase and
pulse labeled with [3H] oleate (Figure 2.3). The addition of inositol resulted in a slight
decrease in incorporation of [3H] oleate in triglyceride but it was not statistically
significant. Addition of both inositol and choline or just choline to growth medium did
not alter triglyceride synthesis.
3
40
(% of total lipids)
[ H] oleate incoporation in TG
50
30
20
10
0
Control
Inositol
Choline
Inositol +
Choline
Figure 2.3 Effect of addition of water-soluble phospholipid precursors in
media on triglyceride levels. Normal strain was grown to log phase (O.D. 0.60.8) in synthetic complete media with 75µM inositol, 1 mM choline or both to log
phase and labeled with [3H] oleate for 30 minutes and harvested. Lipids were
extracted from cell pellets, resolved by thin layer chromatography and quantified
by scintillation counting of the cut TLC plates. The data represent mean ± S.D of
3 independent experiments.
51
The synthesis of energy reserves in yeast cell is not coordinately regulated.
DGA1 and LRO1 contribute to 98% of triglyceride synthesis in yeast (Oelkers
2002). Absence of the ability to esterify diglyceride to form triglyceride, which is a major
energy store, might result in a compensatory increase in another energy reserve,
glycogen. To test this hypothesis, the glycogen content of normal and dga1Δlro1Δ yeast
strains grown in YPD to late exponential phase to stationary growth phase (O.D.660 1.23.6) was determined (Figure2.4). The cellular glycogen levels of normal and dga1Δlro1
yeast strains increased by 15 and 17 fold respectively, as yeast cells progressed from late
logarithmic to stationary growth phase. This increase in glycogen levels in normal and
dga1Δlro1Δ yeast strains with growth phase is consistent with previous studies (Lillie
1980; François 2001). However, there was no significant difference in glycogen levels
between yeast strains lacking triglyceride synthesis, dga1Δlro1Δ, and normal even at a
high cell density (O.D660 = 3.6).
This shows that there is no coordinated regulation between triglyceride and
glycogen synthesis in yeast in the culturing conditions used in the present study. It is
possible that the loss of triglyceride synthesis has a pronounced effect on glycogen
synthesis in a particular culturing condition. A quadruple deletion mutant
dga1Δlro1Δgsy1Δgsy2Δ was created. This yeast strain lacks the ability to synthesize
glycogen and triglyceride and is viable on YPD growth media at 30°C. This suggested
that in laboratory conditions on energy rich media (YPD) energy reserves triglyceride and
glycogen are non-essential for viability. Future studies on the ability of this strain to grow
in energy poor media would be interesting.
52
7
Glycogen (mg/10 cells)
1.2
0.8
0.4
0
1.2
1.8
2.4
3
3.6
O.D.660nm
Figure 2.4 Glycogen levels in triglyceride deficient yeast strain. Normal and
dga1Δlro1Δ haploids were grow in YPD to an O.D. of 1.2 to 3.6. The cells were
lysed, boiled, treated with amyloglucosidase and glucose oxidase in order to
determine the amount of glycogen present. Data are normalized to the number of
cells. The data represent mean ± S.D of three independent experiments. Open
bars-normal yeast strain, filled bars- dga1Δlro1Δ deletion mutant
53
Determination of protein and activity levels of diacylglycerol esterifying enzymes
The regulation of an enzyme can occur at the level of transcription, translation
and / or changes in enzyme activity due to covalent modifications or modulator induced
conformational changes. The next step involved the determination of protein and activity
levels of diglyceride esterifying enzymes in the identified genetic and growth conditions
in which triglyceride levels are altered. The results would test the hypothesis whether
changes in expression and activity of diglyceride esterifying enzymes are associated with
changes in triglyceride synthesis. This study was part of an ongoing larger study on the
regulation of yeast triglyceride synthetic enzymes Dga1 and Lro1. Hence, the focus was
on the in vitro microsomal DGAT activity mediated by Dga1, one of the diglyceride
esterifying enzymes.
The experiments on mRNA abundance and protein expression by Western
blotting were conducted by other members of the Oelkers lab. Real time PCR was
conducted to quantify DGA1 and LRO1 mRNA levels in normal yeast cells grown in
YPD to exponential and stationary phase.
The mRNA levels of DGA1 and LRO1
(normalized to actin) increased by 3-fold in stationary phase which correlates with
increased incorporation of [3H] oleate in triglyceride in a normal strain in stationary
phase (Oelkers et al., unpublished data). The measurement of mRNA levels of DGA1 and
LRO1 in other genetic and growth conditions yielded results with high variability and
hence further studies were not carried. In order to study regulation at the
posttranscriptional level, an attempt was made to measure the protein levels of Dga1 and
Lro1 in conditions where triglyceride synthesis is altered.
54
Polyclonal antibodies were raised in rabbits against synthetic peptides derived
from the protein sequences of DGA1 and LRO1. The experimental conditions were
optimized to see if the specific antibodies could detect Dga1 and Lro1 immobilized on
membrane. Western blot indicated non specific bands and failed to detect Dga1 and Lro1
with reproducible results. Thus the changes in protein expression levels by Western
blotting could not be pursued (Oelkers et al., unpublished data). Next we sought to study
whether regulation of triglyceride synthesis occurred by change in enzymatic activity of
diglyceride esterifying enzymes.
In vitro microsomal diacylglycerol acyltransferase (DGAT) activity
To measure in vitro DGAT activity mediated specifically by Dga1 and to rule out
any minor contribution from Are2, a lro1Δare1Δare2Δ yeast strain was created. Dga1
was the only enzyme catalyzing acyl-CoA dependent diglyceride esterification in this
yeast strain. To enrich Dga1 mediated activity microsomes were prepared from
lro1Δare1Δare2Δ triple deletion strain. The assay conditions were optimized with regards
to the protein mass and temperature. The enzyme activity was found to be linear for 5
minutes with 40µg of microsomal protein at 23°C. The DGAT activity was recorded with
a range (5µM-60μM) of [14C] oleoyl CoA concentrations (Figure 2.5). EZ-Fit and
Graphpad Prism 5.0 software were used to analyze the kinetic data. Sigmoidal curve
fitted better to the data in comparison to a Michaelis Menten curve (r2 = 0.99 versus
0.87). Therefore, the kinetic data were analyzed on a Hill plot which yielded a Hill
number of 3.0. This indicated positive cooperativity of enzyme for oleoyl-CoA (Figure
2.5). The apparent K0.5 and Vmax for oleoyl-CoA were determined to be 16.1µM and 6.7
nmol/min/mg respectively.
55
A
DGAT activity
(nmol/min/mg)
8
6
4
2
0
0
20
40
60
14
[ C] Oleoyl CoA (Conc.µM)
B
3
Log (v/Vmax-v)
2
1
0
-1
0
0.5
1
1.5
2
-2
-3
-4
Log (Oleoyl-CoA (µM) )
Figure 2.5 In vitro diacylglycerol acyltransferase (DGAT) activity with
increasing concentrations of [14C] oleoyl-CoA. (A) Microsomes from
lro1Δare1Δare2Δ deletion strain were incubated in the presence of diacylglycerol
and varying concentration of [14C] oleoyl-CoA for 5 minutes at 23°C as described
in “Experimental Procedures”. The data represent mean ± S.D. n=3. (B) Hill plot
of the data in panel A.
56
Effect of ATP, NADH, Malonyl-CoA and Acetyl-CoA on in vitro DGAT activity
Acute regulation of triglyceride synthetic enzymes has been reported by two
studies. In vitro glycerol 3-phosphate acyltransferase (GPAT) and DGAT activity in post
mitochondrial supernatant (PMS) from rat adipose tissue, upon incubation with 1mM
adenosine 5’- triphosphate (ATP) for 15 minutes showed 25% and 35% reduced activity
respectively. DGAT activity has been shown to be predominantly (90%) associated with
microsomal fraction. However, in the same study, the microsomal fraction obtained from
the PMS did not show reduction in DGAT activity. The addition of cytosolic fraction
obtained from PMS when added to the in vitro DGAT assay with microsomal protein as
enzyme source resulted in reduction of enzyme activity in the presence of 1mM ATP
(Rodriguez 1992).
The cytosolic activity responsible for reduction in in vitro DGAT activity was not
inhibited by protein kinase C inhibitors. It was suggested that phosphorylation by
tyrosine kinase was responsible for the reduction in DGAT activity (Walsh 1989;
Rodriguez 1992). Mouse and human DGAT1 contain a single conserved tyrosine residue
while DGAT2 contains 6 potential protein kinase C phosphorylation sites (Cases 2001).
However, no change in DGAT activity was observed when conserved tyrosine residue in
human DGAT1 was mutated to phenylalanine (Oelkers 1998).
We hypothesized that the presence of metabolites which indicate energy status of
the cell would affect in vitro microsomal DGAT activity. The metabolites that increase in
concentration in energy replete cells, namely ATP, NADH, acetyl-CoA and malonylCoA would activate DGAT activity so that energy can be stored in the form of
triglyceride and vice versa.
57
It was suggested as early as 1960s that adenosine phosphates regulate reactions
involved in energy storage or energy production. Two classic examples include
phosphofructokinase-1 and muscle glycogen phosphorylase that have been shown to be
allosterically regulated by ATP and adenosine monophosphate (AMP) in opposite
directions (Ramaiah 1964). Previous studies have shown that ATP levels are 5 fold
higher in yeast cells grown in the presence of 2% glucose in media in comparison to the
starved cells (Wu 1994). The cellular concentration of ATP has been estimated to be 2.3
– 5.2 mM in yeast cells grown to logarithmic phase in regular YEP growth media
containing 2% dextrose and in starved cells the ATP concentration is 0.57mM (OzierKalogeropoulos 1991; Ingram 2000).
5mM ATP was added to DGAT assay components and DGAT activity was
recorded for varying concentrations of oleoyl-CoA. Hill plot analysis of kinetic data was
performed (Figure 2.6). The apparent K0.5 for oleoyl-CoA with ATP and without ATP
was 14.3 ± 4.3 μM and 17 ± 5.6 μM respectively. The Vmax values with and without ATP
were 6 ± 3 nmol/min/mg and 5.8 ± 2 nmol/min/mg respectively. The decrease in apparent
K0.5 with the addition of ATP was statistically not significant in comparison to the control
reactions. Two way ANOVA and post hoc analysis of kinetic data did not indicate
statistically significant difference in enzyme activity with and without ATP.
Nicotinamide adenine dinculetoides work in conjunction with adenosine
phosphates as energy transfer system in the cell. The ratio between reduced and oxidized
forms of nicotinamide adenine dinculetoides is indicative of the cellular metabolic state
(Krebs 1967).
58
Yeast cells grown in 0.5% glucose show a 50% decrease in NADH levels in
comparison to cells grown in 2% glucose. The cellular concentration of NADH in yeast
cells has been reported to be around 0.8mM in cells grown in YPD (2%glucose) (Lin
2004). 0.8 mM NADH was added to the mixture for DGAT assay and Hill plot analysis
was done (Figure 2.7). The K0.5 values with NADH and without NADH were 24.7 ± 9.8
μM and 17 ± 4.2 μM respectively. The Vmax values with NADH and without NADH were
5.5 ± 1.4 nmol/min/mg and 4.8 ± 1.6 nmol/min/mg respectively. However due to the high
variability in the kinetic data the t-test did not detect significant difference between K0.5
values with and without NADH. No statistically significant changes in DGAT activity at
varying concentrations of oleoyl-CoA were seen with the addition of NADH.
Acetyl-CoA is a primary substrate for citric acid cycle with a marked function in
energy production. Acetyl-CoA has been shown to allosterically activate pyruvate
carboxylase, an enzyme involved in gluconeogenesis (Cooper 1966). The reported
cellular concentrations of acetyl-CoA range from 25 - 100 μM (McCormick 1983). 0.25
mM acetyl-CoA has been shown to allosterically activate yeast pyruvate carboxylase and
increase the enzyme activity by 100 fold (Rhode 1986) and the same concentration of
acetyl-CoA was added to the DGAT assay mixture (Figure 2.8). In the presence of acetylCoA the apparent K0.5 was 17.9 ± 3.2 μM which was not significantly different from K0.5
of 17± 4.2 μM of reaction without acetyl-CoA. The apparent Vmax upon addition of
acetyl-CoA was 4.5 ± 0.9 nmol/min/mg and was similar to that of control reaction (4.8 ±
1.6 nmol/min/mg).
59
A
DGAT activity
(nmol/min/mg)
8
6
4
2
0
0
10
20
30
40
50
14
ATP
Control
[ C]Oleoyl CoA (µM)
B
Log (v/Vmax-v)
2
1
0
0
0.5
1
1.5
2
-1
-2
ATP
-3
Log (Oleoyl-CoA (µM))
Control
Figure 2.6 Effect of 5mM ATP on in vitro Diacylglycerol acyltransferase (DGAT)
activity. (A) Microsomes from lro1Δare1Δare2Δ deletion strain were incubated in the
presence of 5mM ATP, diacylglycerol and varying concentration of [14C] oleoyl-CoA for
5 minutes at 23°C as described in “Experimental Procedures”; The data represent mean ±
S.D. n=3. (B) Hill plot of the data in panel A.
60
A
DGAT activity
(nmol/min/mg)
4
3
2
1
0
0
10
20
30
40
NADH
Control
14
[ C]Oleoyl CoA (µM)
B
Log (v/Vmax-v)
1
0
0
0.5
1
1.5
2
-1
-2
-3
Log (Oleoyl-CoA (µM))
NADH
Control
Figure 2.7 Effect of 0.8mM NADH on in vitro Diacylglycerol acyltransferase
(DGAT) activity. (A) Microsomes from lro1Δare1Δare2Δ deletion strain were incubated
in the presence of 0.8mM NADH, diacylglycerol and varying concentration of [14C]
oleoyl-CoA for 5 minutes at 23°C as described in “Experimental Procedures”; The data
represent mean ± S.D. n=3. (B) Hill plot of the data in panel A.
61
A
DGAT activity
(nmol/min/mg)
5
4
3
2
1
0
0
10
20
30
14
[ C]Oleoyl CoA (µM)
40
Acetyl CoA
Control
B
Log (v/Vmax-v)
1
0
0
0.5
1
1.5
2
-1
-2
Acetyl-CoA
-3
Log(Oleoyl-CoA (µM))
Control
Figure 2.8 Effect of 0.2mM acetyl-CoA on in vitro Diacylglycerol acyltransferase
(DGAT) activity. (A) Microsomes from lro1Δare1Δare2Δ deletion strain were incubated
in the presence of 0.2mM acetyl-CoA, diacylglycerol and varying concentration of [14C]
oleoyl-CoA for 5 minutes at 23°C as described in “Experimental Procedures”; the data
represent mean ± S.D. n=3. (B) Hill plot of the data in panel A.
62
A
DGAT activity
(nmol/min/mg)
4
3
2
1
0
0
20
Malony-CoA
40
Control
14
[ C]Oleoyl CoA (µM)
B
Log (v/Vmax-v)
1
0
0
0.5
1
1.5
2
-1
-2
-3
Log(Oleoyl-CoA (µM))
Malonyl-CoA
Control
Figure 2.9 Effect of 0.1 mM malonyl-CoA on in vitro Diacylglycerol acyltransferase
(DGAT) activity. (A) Microsomes from lro1Δare1Δare2Δ deletion strain were incubated
in the presence of 0.1mM malonyl-CoA, diacylglycerol and varying concentration of
[14C] oleoyl-CoA for 5 minutes at 23°C as described in “Experimental Procedures”; the
data represent mean ± S.D. n=3. (B) Hill plot of the data in panel A.
63
Malonyl-CoA is an intermediate in the de novo synthesis of fatty acids and is an
allosteric inhibitor of carnitine palmitoyltransferase I (CPT I), an enzyme that regulates
the rate at which long chain fatty acyl-CoAs are transported into mitochondria for βoxidation (Ruderman 1999). The effect of malonyl-CoA on in vitro DGAT activity was
studied. 0.1 mM malonyl-CoA has been shown to inhibit 92-96% of rat liver CPT I
activity upon ectopic expression in yeast (de Vries 1997). The apparent K0.5 in the
presence of malonyl-CoA was 18.7 ± 1.6 μM compared to 17 ± 4.2 μM of control
reaction (Figure 2.9). This slight increase in K0.5 in the presence of malonyl-CoA was not
found to be statistically significant. Vmax of the enzyme was unaffected upon addition of
malonyl-CoA. Overall the addition of metabolites which indicate energy rich status of
cell did not affect the Vmax and Km of DGAT for oleoyl-CoA. Statistical analysis of
kinetic data in the presence of modulators by two way ANOVA and post hoc tests did not
detect any changes in DGAT activity at varying concentrations of oleoyl-CoA.
Next, we proceeded to determine kinetic parameters of DGAT in the presence of
metabolites that indicate energy poor status of cell: AMP, ADP and NAD+. We
hypothesized that these metabolites should lead to decrease in DGAT activity so that
energy storage in form of triglyceride is not favored. The cellular AMP levels in yeast
range from 0.1mM to 1mM (Polakis 1966; Betz 1967). In the presence of 0.1mM AMP
the apparent K0.5 was 15.4 ± 5.5 µM while in the presence of 1mM AMP it was 16.4 ±
5.8 µM (Figure 2.10). The K0.5 values were not statistically significant in comparison to
the K0.5 of 17.6 ± 8.7 µM in the absence of AMP. There was no change in Vmax of the
enzyme with increase in concentration of AMP.
64
The Vmax in the presence of 0.1m M and 1 mM AMP was 5.5 ± 1 nmol/min/mg and it
was not significantly different from Vmax in the absence of AMP. Statistical analysis by
two way ANOVA followed by post hoc tests did not detect any effect of AMP on DGAT
activity at varying concentrations of oleoyl-CoA. The cellular concentration of ADP in
yeast has been reported to range from 0.3 mM to 1 mM (Wu 1994; Ingram 2000). At
concentration as high as 6 mM, ADP has been shown to enhance glucose binding by
yeast hexokinase (Woolfitt 1988). Microsomes of liver rat when incubated for 15 minutes
with 5 mM ADP show 14% reduction in DGAT activity (Haagsman 1982). 5mM ADP
was added to the DGAT assay components to investigate whether ADP modulates in
vitro DGAT activity. In the presence of 5 mM ADP the DGAT activity was linear for
7.5-20 μM of oleoyl-CoA (Figure 2.11). We did not study the effect of ADP on DGAT
activity at concentrations higher than 20 μM of oleoyl-CoA. Therefore, it was not
possible to determine a K0.5 or Vmax for oleoyl-CoA using Michaelis–Menten equation
and Hill plot analysis. The change in DGAT activity upon addition of ADP to the DGAT
assay components was not found to be statistically significant. Next we studied the effect
of addition of 0.8 mM NAD on DGAT activity (Figure 2.11). Intracellular concentration
of NAD+ of 1-1.2 mM has been reported in yeast grown on YPD (Lin 2004). The kinetic
data was analyzed by Hill plot (Figure 2.11). The Km of DGAT for oleoyl-CoA in the
presence and absence of NAD+ was 16.7 ± 8 μM and 17.6 ± 8.7 μM respectively. The
Vmax of the enzyme upon addition of NAD+ was 5.6 ± 0.3 nmol/min/mg in comparison to
4.8 ± 1.6 nmol/min/mg for the control reaction. Addition of NAD+ did not have
statistically significant effect on Vmax or Km of enzyme for oleoyl-CoA.
65
A
DGAT activity
(nmol/min/mg)
5
4
3
2
1
0
0
10
20
14
[ C]Oleoyl CoA conc. (µM)
AMP (0.1mM)
AMP (1mM)
Control
B
Log (v/Vmax-v)
1
0
0
1
2
-1
-2
-3
-4
Log (Oleoyl-CoA (µM))
Control
AMP 0.1mM
AMP 1mM
Figure 2.10 Effect of 0.1 mM and 1mM AMP on in vitro Diacylglycerol
acyltransferase (DGAT) activity.(A) Microsomes from lro1Δare1Δare2Δ deletion
strain were incubated in the presence of 0.1mM AMP and 1mM AMP, diacylglycerol and
varying concentration of [14C] oleoyl-CoA for 5 minutes at 23°C as described in
“Experimental Procedures”; the data represent mean ± S.D. n=3. (B) Hill plot of the data
in panel A.
66
A
DGAT activity
(nmol/min/mg)
6
4
2
0
0
10
20
14
[ C]Oleoyl CoA conc. (µM)
30
Control
ADP
NAD
B
Log (v/Vmax-v)
1
0
0
0.5
1
1.5
-1
-2
-3
Log (Oleoyl-CoA(µM))
NAD
Control
Figure 2.11 Effect of 0.1mM ADP and 0.8 mM NAD+ on in vitro Diacylglycerol
acyltransferase (DGAT) activity. (A) Microsomes from lro1Δare1Δare2Δ deletion
strain were incubated in the presence of 0.1mM ADP and 0.8 mM NAD+, diacylglycerol
and varying concentration of [14C] oleoyl-CoA for 5 minutes at 23°C as described in
“Experimental Procedures”; the data represent mean ± S.D. n=3. (B) Hill plot of the data
in panel A.
67
2.5 Discussion
Diglyceride esterification is the terminal and unique step in triglyceride synthesis.
Diglyceride is common intermediate for triglyceride and phospholipid synthesis. Cells
must maintain a balance between storage of energy in triglyceride and membrane
phospholipid synthesis, therefore it is likely that this branch point is subject to regulation.
The main hypothesis of the study was that the regulation of triglyceride synthesis occurs
at the step of diglyceride esterification and the enzymes that mediate this step are
regulated. Another hypothesis was that inability of cells to esterify diglyceride to form
triglyceride will increase glycogen synthesis as an alternative to store energy.
We used Saccharomyces cerevisiae as a model system to study the intracellular
regulation of triglyceride synthesis. In yeast Lro1, Dga1 and Are2 are the only
diglyceride esterifying enzymes and a yeast strain lacking all of these enzymes is devoid
of triglycerides (Oelkers 2002). Identification of all the diglyceride esterifying enzymes
allows genetic manipulation to study their role individually. In addition, yeast has
conserved glycerolipid synthetic pathways homologous to those in mammalian cells. The
amino acid sequence of Dga1 shares 35% identity with mammalian DGAT2 protein and
like its mammalian counterpart catalyzes acyl CoA dependent diglyceride esterification
(Oelkers 2002). Lro1 is the yeast ortholog of mammalian lecithin-cholesterol
acyltransferase (LCAT) with which it shares 27% identity.However, Lro1 catalyzes
triglyceride synthesis by a PDAT reaction which is acyl-CoA independent. Together
Dga1 and Lro1 conribute to 98% of triglyceride synthesis and the residual diglyceride
esterification is mediated by Are2, with a predominant role in sterol esterification
(Oelkers 2000; Oelkers 2002).
68
To address our hypothesis that triglyceride synthesis is regulated at the step of
diglyceride esterification, it was necessary to first identify genetic backgrounds and
growth conditions in which triglyceride synthesis is regulated. Previous studies have
described few conditions in which triglyceride synthesis is altered. Yeast cells grown in
media containing 0.1% oleate as the only carbon source, show seven fold increase in total
lipids, the majority of which is triglyceride (Dyer 2002). Triglyceride synthesis also
increases in yeast cells in stationary growth phase and when they undergo sporulation in
nitrogen poor media (Henry 1973; Taylor 1979). In lro1∆ yeast strains triglyceride
synthesis is reduced by 75% in logarithmic growth phase while dga1∆ shows 50%
reduction in stationary phase (Oelkers 2002). To identify additional conditions in which
triglyceride synthesis might be altered, we examined yeast strains with gene deletions
which disable fatty acid hydrolysis (pox1∆) or glycogen synthesis (gsy1∆, gsy2∆). We
hypothesized that in these three genetic backgrounds, triglyceride synthesis will be
increased to store the surplus energy.
Triglyceride synthesis was measured by pulse labeling pox1Δ and wild type yeast
strain with [3H] oleate. Indeed, there was a 75% increase in incorporation of the labeled
oleate in triglyceride in pox1Δ strain (p<0.05). Phospholipid and sterol ester synthesis
were unaffected suggesting that the effect of pox1Δ was triglyceride specific. However,
triglyceride and phospholipid synthetic pathways have common intermediates, substrates
and initial steps; it is less likely that the availability of acyl-CoA will favor one process
over another.
69
There can be two possibilities: first being that the enzymes in glycerolipid
synthetic pathway selectively channel substrates towards either phospholipid or
triglyceride synthesis or the second possibility being that the enzymes utilizing
phosphatidic acid and diglyceride as substrates for phospholipid and triglyceride
synthesis are regulated. Glycerol 3-phosphate acyltransferase (GPAT) mediates the first
step of triglyceride and phospholipid synthetic pathway. In yeast this reaction is mediated
by Gat1 and Gat2. The gat1∆ yeast cells show 50% increase in triglyceride synthesis
while gat2∆ yeast show 50% decrease in triglyceride synthesis (Zaremberg 2002). This
result raises the question whether lysophosphatidic acid species synthesized by Gat1 are
utilized for phospholipid synthesis while that synthesized by Gat2 are utilized to
synthesize triglyceride. So far no studies have been carried out to show that
lysophosphatidic acid species synthesized by Gat1 and Gat2 are different. At least two
isoforms exist for all the enzymes involved in synthesizing diglyceride, an important
intermediate in triglyceride and phospholipid synthesis. It is also possible that these
isoforms play an important role in directing intermediates of triglyceride and
phospholipid synthesis to a particular pathway. However, there is lack of information
about protein-protein interaction among different isoforms of the pathway that would
facilitate substrate channeling towards particular pathway.
Next we examined triglyceride synthesis in yeast strains with deletions in
glycogen synthetic enzymes (gsy1∆, gsy2∆ and gsy1∆gsy2∆). GSY1 and GSY2, encode
for yeast glycogen synthases with 50% similarity with mammalian muscle and liver
glycogen synthases. Glycogen synthase catalyzes the rate-limiting step of glycogen
synthesis.
70
Between the two yeast isoforms, Gsy2 mediates 90% of the enzyme activity in
YPD in stationary phase. Deletion of both the genes results in loss of glycogen synthesis
(Francois, 2001). Loss of glycogen as an energy reserve was expected to stimulate
storage of energy in form of triglyceride as a compensatory mechanism to maintain total
cellular energy reserves. Yeast single and double deletion strains gsy1Δ, gsy2Δ,
gsy1Δgsy2Δ, and wild type strains were pulse labeled with [3H]oleate to monitor
triglyceride synthesis. There was no significant difference in triglyceride synthesis in
glycogen synthesis deficient and wild type strains.
Next, we addressed the question whether the loss of triglyceride synthesis
increases glycogen accumulation in the cells. There is only one study which has
examined whether there is coordination between synthesis of cellular energy stores.
Glycogen synthesis in obese and lean rats was monitored by 3H2O after feeding them
isocaloric meal. Obese rats showed 3-fold reduction in hepatic glycogen synthesis and 5fold increase in lipogenesis when compared to the lean rats. However, the plasma insulin
levels were 4 times higher in obese animals in comparison to lean animals and it is
possible that the changes in glycogen synthesis were due to insulin resistance rather than
due to increase in lipogenesis (Obeid 2000).
Since triglyceride and glycogen synthetic enzymes have been characterized in
yeast it is possible to directly examine the effect of loss of intracellular triglyceride
synthesis on glycogen synthesis The dga1Δlro1Δ double deletion strain is deficient in
triglyceride synthesis yet viable and synthesizes only 2% of the normal amount of
triglyceride (Oelkers 2002).
71
Glycogen levels in dga1Δlro1Δ yeast cells grown (in YPD) to late exponential
phase and stationary phase were measured. Both the yeast strains showed an increase in
glycogen levels as they progressed from exponential to stationary phase. This agreed with
a previous study that found six-fold increase in glycogen levels (% of dry weight of cells)
as yeast cells progress from exponential to stationary phase (Lillie 1980). The glycogen
levels in dga1Δlro1Δ strain did not show significant increases in comparison to the wild
type cells. This result suggested that cellular glycogen and triglyceride synthesis cannot
compensate for the absence of each other and hence, there is no coordinated regulation in
them in the present assay conditions. It is possible that culturing of the yeast strains in
YPD, energy rich media might have masked any kind of coordinated regulation between
triglyceride and glycogen synthesis. Further studies in different growth conditions will be
required to establish how a cell adapts to loss in triglyceride synthesis.
To identiy additional growth condition in which triglyceride synthesis is altered,
we studied the effect of inositol and choline on triglyceride synthesis. Addition of water
soluble phospholipid precursors, inositol and choline to the growth media has been
shown to regulate a number of yeast phospholipid synthetic enzymes (Carman 1999).The
levels of phosphatidic acid (PA), an important intermediate in triglyceride and
phospholipid synthesis decreased by 2 fold in the yeast cells grown in presence of inositol
(Kelley 1988). Phosphatidic acid can be either dephosphorylated to form diglyceride for
triglyceride synthesis or can be converted to CDP-diacylglycerol (CDP-DG) for
phospholipid synthesis. Triglyceride content of yeast cells has been shown to increase in
stationary phase with simultaneous decrease in phospholipid synthesis (Taylor 1979).
72
This increase in triglyceride content is thought to occur by induction of
phosphatidic acid phosphatase (PAP) activity (Hosaka 1984). In stationary phase, the
activity of CDP-DG synthase is decreased by 2.5 fold, thus increasing the availability of
phosphatidic acid for diglyceride synthesis mediated by PAP (Homann 1987).
Loss of triglyceride synthesis in yeast cells lacking diglyceride esterifying
enzymes increases the phospholipid synthesis significantly in logarithmic and stationary
growth phases and when grown in the presence of oleate or nitrogen poor media (Oelkers
2002). Thus according to these studies phospholipid synthetic pathway and triglyceride
seem to be coupled to each other rather than former being regulatory. Interestingly, in the
present study addition of 75 µM inositol or 1mM choline and both to the growth media,
known to affect the activity of phospholipid synthetic enzymes showed no effect on
triglyceride synthesis in wild type yeast grown to exponential phase. Similar result was
obtained with wild type yeast grown to different growth phases (Appendix 3).
A previous study reported that inositol requiring yeast mutant (ino1-13)
incorporated twice the amount of [14C] acetate in triglyceride and phospholipids per cell
six hours after being shifted to inositol starved culture and losing viability (McCammon
1982). At earlier time points (2 and 4 hours) there was no difference in incorporation of
acetate label in total phospholipids and triglyceride in cells starved for inositol and
supplemented control containing 27.5µM of inositol (McCammon 1982). This results
show that changes in phospholipid synthesis might not be tightly coupled to triglyceride
synthesis required for storing excess fatty acids in a cell.
73
After identifying conditions which alter triglyceride synthesis, we studied whether
in these conditions expression and activity of diglyceride esterifying enzymes are
regulated. Regulation of diglyceride esterifying enzymes can occur at the level of mRNA
abundance, protein abundance and enzymatic activity. Triglyceride synthesis is increased
in yeast cells when they enter stationary phase from exponential growth phase (Taylor
1979). Real time PCR was conducted to quantify DGA1 and LRO1 mRNA levels in wild
type yeast cells grown in YPD to exponential and stationary phase (Oelkers et al.,
unpublished data). The mRNA levels (normalized to actin) of DGA1 and LRO1 increase
by 3-fold in stationary phase which correlates with increased incorporation of [3H]oleate
in triglyceride in a wild type strain in stationary phase. The measurement of mRNA
levels of DGA1 and LRO1 in other genetic and growth conditions yielded results with
very high variability and hence further studies were not carried.
In order to study regulation at the posttranscriptional level, we sought to measure
the protein levels of Dga1 and Lro1 in conditions where triglyceride synthesis is altered.
To do so polyclonal antibodies were raised in rats using synthetic peptides derived from
the protein sequences of Dga1 and Lro1. The changes in protein expression levels by
Western blotting could not be pursued due to inability to detect proteins by the antibodies
(Oelkers et al., unpublished data).
To address the possibility that Dga1 and Lro1 enzyme activity are regulated by
post translational modification or by allosteric mechanism, the in vitro DGAT enzyme
activity was measured in microsomes, an enriched source of the diglyceride esterifying
enzymes. A yeast triple deletion strain lro1Δare1Δare2Δ was created, in which
diglyceride esterification was only carried out by Dga1.
74
The microsomal DGAT activity with varying concentrations of oleoyl-CoA when
plotted resulted in a sigmoidal shape plot. The enzyme activity when analyzed by Hill
equation exhibited positive cooperativity (Hill number: 3). Cooperativity with respect to
oleoyl-CoA might be important in regulating the rate of triglyceride synthesis. Studies
done on permeabilized hepatocytes have suggested that at physiological levels of
glycerol-3-phosphate (1mM) when DGAT is saturated with diglyceride the rate of
triglyceride synthesis is determined by the affinity of DGAT for acyl-CoA (Stals 1994).
The apparent Vmax and K0.5 of DGAT for oleoyl-CoA were 6.7 nmol/min/mg and
15.5 µM respectively. Previous study on microsomal DGAT activity in HepG2 cells has
reported apparent Km of 8.3 µM for oleoyl-CoA (2.5-17 µM). The total DGAT activity
was representative of 2 DGAT isoforms, DGAT1 and DGAT2 expressed in HepG2 cells
(Ganji 2004). It is difficult to compare our data with that of this study because DGAT1
and DGAT2 might have characteristic enzyme kinetic parameters and contribution to
total DGAT activity in HepG2 cells. Nothing is known about the kinetic parameters of
DGAT1. However, a study reported that human DGAT1 was a multimeric protein but the
biochemical significance of tetramer formation was not examined (Cheng 2001).
In our assays, the microsomal DGAT activity was only mediated by Dga1p, a
member of DGAT2 family. Monoacylglycerol acyltransferase1 and 2 (MGAT1 and
MGAT2) also belong to the DGAT2 family and it was suggested that they exhibit
cooperative kinetics with varying concentrations of oleoyl-CoA ranging from 0-400 µM.
No analysis was done in these studies to estimate kinetic parameters (Yen 2003). Thus
this is the first study in our knowledge to describe the kinetic parameters of a member of
DGAT2 family.
75
To further characterize microsomal DGAT activity we studied the effect of
metabolites which indicate cellular energy status: ATP,ADP,AMP,NAD,NADH, acetylCoA, malonyl-CoA on Dga1. We hypothesized that during energy rich conditions in a
cell, when the levels of ATP, NADH, acetyl-CoA and malonyl-CoA are high these
metabolites may bind to Dga1 and allosterically activate the enzyme activity. This will
result in increased triglyceride synthesis. On the other hand when ADP, AMP and NAD+
levels are high when cells are depleted of energy, the triglyceride synthesis will be
inhibited. Enzymes involved in glycolysis and citric acid cycle such as pyruvate
dehydrogenase, isocitrate dehydrogenase and phosphofructokinase-1 (PFK1) have been
shown to be regulated in similar manner (Ramaiah 1964). Addition of ATP, ADP, AMP,
NADH, NAD+, acetyl-CoA and malonyl-CoA individually to the assay components at
cellular concentration did not alter the microsomal DGAT activity.
In Brassica napus (oil seed rape) in vitro microsomal DGAT activity was shown
to increase by 2 fold when 1- 2 mM ATP was added to the assay mixture containing
15µM of oleoyl-CoA and 330µM of diglyceride (Byers 1999). No changes in DGAT
activity were observed upon addition of ATP to the DGAT assay components used in the
present study. It is acknowledged that our results are limited because of the single
concentrations of most of the metabolites. However, the results are relevant because we
tried to mimic the physiological conditions by adding metabolites at cellular
concentration or at concentrations known to allosterically regulate activity of other
enzymes.
.
76
CHAPTER 3: IDENTIFICATION OF A NOVEL LYSOPHOSPHOLIPID
ACYLTRANSFERASE (LPT1) IN SACCHAROMYCES CEREVISIAE
(Published as Jain et al. 2007)
3.1 Abstract
The incorporation of acyl chains in the sn-2 position of phospholipids during de
novo synthesis is primarily mediated by the 1-acyl-glycerol-3-phosphate acyltransferase
(AGPAT) reaction. In S. cerevisiae, Slc1 has been shown to mediate this reaction but
AGPAT activity remains after SLC1 deletion. To identify the enzyme that mediates the
remaining activity, synthetic genetic array (SGA) analysis was performed using a slc1∆
strain. SGA analysis was performed in collaboration with Dr. Charles Boone and Michael
Costanzo, University of Toronto, Toronto, Canada. One of the genes identified by the
screen, LPT1, was found to encode for an acyltransferase that uses a variety of
lysophospholipid species, including 1-acyl-sn-glycerol-3-phosphate. Deletion of LPT1
had a minimal effect on 1-acyl-sn-glycerol-3-phosphate acyltransferase activity but overexpression increased activity 7-fold.
other
lysophospholipids
and
Deletion of LPT1 abrogated the esterification of
over-expression
increased
lysophosphatidylcholine
acyltransferase activity 7-fold. The majority of this activity (65%) co-purified with
microsomes.
To test the putative role for this enzyme in selectively incorporating
unsaturated acyl chains into phospholipids, in vitro, substrate concentration series
experiments were performed with the four acyl-CoA species commonly found in yeast.
77
While the saturated palmitoyl-CoA and stearoyl-CoA showed a lower apparent
Km, the monounsaturated palmitoleoyl-CoA and oleoyl-CoA showed a higher apparent
Vmax. Arachidonyl-CoA, although not abundant in yeast, also had a high apparent Vmax.
Pulse-labeling of lpt1∆ strains showed a 30% reduction in [3H] oleate incorporation into
phosphatidylcholine only.
Therefore, Lpt1, a member of the membrane bound- O-
acyltransferase (MBOAT) gene family, seems to work in conjunction with Slc1 to
mediate the incorporation of unsaturated acyl-chains into the sn-2 position of
phospholipids.
These findings identified LPT1, a novel lysophospholipid acyltransferase, as a
component of the Lands cycle responsible for acyl chain remodeling at the sn-2 position
of phospholipids. LPT1 belongs to the MBOAT family and shares sequence similarity
with uncharacterized human MBOAT proteins. Identification of LPT1 provides a
molecular tool to identify human homologs with similar function and study phospholipid
remodeling and turnover in yeast.
78
3.2 Introduction
According to the fluid mosaic model for the structure of biological membranes,
phospholipids
form
a
bilayer
in
which
protein
molecules
are
embedded.
Phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS),
phospatidylinositol (PI), cardiolipin, sphingolipids and sterols are major membrane lipids.
Each subcellular fraction has a distinct lipid composition for instance mitochondrial
membranes have high cardiolipin content while cholesterol is a major component of
plasma membrane.
The acyl chains in phospholipids are thought to influence the degree of order and
motion of phospholipid molecules in lipid bilayer, a property referred to as membrane
fluidity. Saturated acyl chains in membrane phospholipids pack tightly in an array
forming a gel like phase, while the unsaturated acyl chains cannot be packed as tightly
leading to fluid bilayer. The temperature at which membrane transitions from a gel like
state to a fluid like state is dependent on the acyl chain composition of the phospholipids
(Cronan 1975). In general, phospholipids have saturated acyl groups in the sn-1 position
and unsaturated acyl groups in sn-2 position (Hanahan 1960) At temperatures in the
physiological range the presence of saturated and unsaturated acyl chains in
phospholipids allows the lipid bilayer to be more fluid and simultaneously avoid drastic
phase changes with temperature. Changes in acyl chain composition of membrane
phospholipids are also associated with changes in cellular functions. In mouse peritoneal
macrophages an increase in unsaturation has been shown to result in an increase in
phagocytic activity. A reduction in endocytosis was observed in peritoneal macrophages
79
which were enriched in saturated fatty acids (Mahoney 1980). In calf thymus
lymphocytes, increase in linoleic acid and arachidonic acid content of the plasma
membrane was associated with increase in activities of lecithin acyltransferase, Na+ / K+
ATPase and decrease in Mg2+- ATPase and γ-glutamyl transferase activities (Mavis 1972;
Spector 1985).
Thus the pathways that establish this positional distribution of acyl chains in
phospholipids are of importance to the cell. According to Kennedy pathway acyl chains
are introduced at the sn-1 and sn-2 position by de novo synthetic enzymes glycerol 3phosphate acyltransferase (GPAT) and 1-acylglycerol-3-phosphate acyltransferase
(AGPAT) to synthesize phosphatidic acid (PA), a precursor to phospholipids and
triglycerides (Figure 3.1). One plausible hypothesis is that AGPAT selectively
incorporates unsaturated acyl groups in the sn-2 position to establish asymmetry in acyl
chain composition in phospholipids. However, human AGPAT1 and AGPAT2 when
expressed in baculovirus utilize both saturated as well as monounsaturated acyl-CoAs of
12-18 carbons at a single concentration of 8μM in the presence of 8 μM 33P labeled sn-118:1 lysoposphatidic acid (lysoPA). With varying concentrations of oleoyl-CoA (18:1CoA) and 8mM of 33P lysoPA the apparent Vmax and Km of the human AGPAT2 activity
were 210 nmol/min/mg and 0.4 μM respectively. Since single concentration of acyl-CoAs
was used to study acyl-CoA specificity, the catalytic efficiency for different acyl-CoAs
could not be calculated. However competition experiments between 0.6 μM
14
C-18:1-
CoA and 1.2 μM of other unlabeled acyl-CoAs with 6 μM 3H-labeled lysoPA and
recombinant human AGPAT2 showed similar preference for 16:0-CoA, 18:0-CoA and
80
18:1-CoA. Other acyl-CoAs were utilized in the order of 18:2-CoA> 12:0-CoA>14:0CoA>20:0-CoA>20:4-CoA ( Hollenback 2006).
Acyl-CoA specificity of AGPAT1 and AGPAT2 suggests they might not be
responsible for establishing acyl chain asymmetry in phospholipids. AGPAT family
currently includes 3 other putative AGPATs that share sequence similarity with AGPAT1
and AGPAT2 (Lu 2005; Agarwal 2007). AGPAT2 mutation is associated with congenital
generalized lipodystrophy-1 (CGL-1) and is believed to have a regulatory role in
adipocyte differentiation. AGPAT-1 and AGPAT-2 show robust AGPAT activity but the
biochemical role of AGPAT 3-5 and their contribution to AGPAT activity is not clear
(Agarwal 2002; Gale 2006). In yeast, SLC1 is the only member of AGPAT gene family
(Nagiec 1993; Athenstaedt 1997) and encodes for a protein which shares 25% and 20%
amino acid sequence identity with human AGPAT1 and AGPAT2. The slc1Δ yeast
mutants show no AGPAT activity in lipid particles but microsomes prepared from slc1∆
strain retain 46% of the total AGPAT activity. These results indicate the presence of
another microsomal AGPAT in yeast, which contributes to the formation of phosphatidic
acid in the absence of Slc1 (Athenstaedt 1997). Phosphatidic acid synthesized by AGPAT
can then be used to synthesize glycerophospholipids, phosphatidylserine (PS),
phosphatidylethanolamine (PE), phosphatidylcholine (PC), phosphatidylinositol (PI) and
cardiolipin through cytidinediphosphodiacylglycerol (CDP-DAG) pathway (Figure 3.1).
Alternatively, phosphatidic acid can be dephosphorylated to form diacylglycerol, a
precursor for synthesis of PE and PC via the CDP-ethanolamine and CDP-choline,
pathway (Kennedy 1961).
After de novo synthesis, the acyl chain composition of
phospholipids can be modulated by phospholipid remodeling (Figure 3.1).
81
Figure 3.1 Pathways for phospholipid synthesis in Saccharomyces cerevisiae. A, de novo
synthesis. B. Remodeling/ salvage pathways.
82
This involves deacylation by phospholipase A2 at the sn-2 position and
reacylation of resulting lysophospholipid by acyl-CoA dependent lysophospholipid
acyltransferase (Lands 1960). The deacylation-reacylation referred to as Lands cycle, has
many possible physiological functions. In addition to selectively incorporating
unsaturated acyl chains for membrane fluidity, arachidonic acid (20:4), a precursor for
eicosanoid synthesis is incorporated into sn-2 position by remodeling of phospholipids.
This may prime signal cascades that involve phospholipase A2 and eicosanoids synthesis
(Balsinde 2006). Besides maintaining acyl chain asymmetry in phospholipids,
remodeling is also involved in preferential incorporation of saturated acyl groups in
phosphatidylcholine to synthesize surfactant lipids in lungs (Yamashita 1997). In
mammals, lysophospholipid acyltransferase might play an important role in keeping the
levels of lysophospholipid low to prevent inflammation caused by lysophospholipids
(Kougias 2006).
So far only two lysophospholipid acyltransferases have been cloned and
designated
lysophosphatidylcholine
acyltransferase1
(LPCAT1)
and
lysoplatelet
activating factor acyltransferase (lysoPAFAT / LPCAT2) (Chen 2006; Nakanishi 2006;
Shindou 2007). Both the LPCATs contain conserved motifs found in members of the
AGPAT family and share ~ 50% similarities in their amino acid sequence. LPCAT1 is
highly expressed in lungs and has a preference for short to medium chain saturated acylCoAs (C10:0>C8:0>C12:0>C6:0=C14:0=C16:0) at a fixed concentration of 25μM
(Nakanishi 2006). LPCAT1 is highly expressed in alveolar type II cells of the rat lung
and a two fold LPCAT activity over endogenous activity was seen with
lysophosphatidylcholine and palmitoyl-CoA.
83
Based on these observations it was suggested that LPCAT1 might be involved in
the production of components of pulmonary surfactant lipids which include 40%
dipalmitoylphosphatidylcholine (DPPC) (Nakanishi 2006). However no gene targeting
studies were done to confirm the physiological role of LPCAT1 in the production of
surfactant lipids. LPCAT2 is expressed in inflammatory cells and is involved in synthesis
of platelet activating factor (PAF) from lyso-PAF (Shindou 2007).
In yeast, acyl-CoA independent LPCAT activity is mediated by Taz1 (Testet
2005). Acyl-CoA independent enzymes catalyze the transfer of acyl chain from
phospholipids to lysophospholipids without requiring the presence of acyl-CoA. The acyl
donor is a fatty acid present in the sn-2 position of phospholipids. The coenzyme A
independent transacylases are considered to play an important role in the incorporation of
plyunsaturated fatty acids (C20-C22) in lysophospholipids with ether linkages
(Yamashita 1997). Acyl-CoA dependent activity has been reported in yeast but no
enzyme-gene relationship has been established (Richard 1998; Testet 2005).
In this study, we established this relationship with LPT1 as the result of a
synthetic genetic array analysis (SGA) analysis. SGA involves automated crossing of
yeast strain containing a gene deletion of interest to ~4700 viable yeast gene deletion
strains. Inviability of haploid double deletion mutants is inferred to be due to synthetic
lethal interactions between two genes. Two mutations are considered synthetically lethal
if in combination in a haploid cell, result in cell death, but each by itself leads to a viable
cell (Tong 2001). Synthetic lethal interactions identify genes acting in the same essential
pathway or in parallel redundant pathways, if product of one gene functionally
compensates for defect due to another.
84
3.3. Experimental Procedures
Material
Synthetic defined media and yeast nitrogen base were obtained from Q-biogene (MP
Biomedicals).
Myristoyl
lysophosphatidylethanolamine
and
oleoyl
[1-14C]
lysophosphatidylserine were from Avanti Polar Lipids (Alabaster, AL).
Palmitoyl–lysoPC (55mCi/mmol) was from Perkin-Elmer Life Sciences.
All other
chemicals were obtained from either Sigma or Fisher.
Yeast strains
Molecular biology and yeast genetic procedures were performed according to
conventional protocols (Ausubel 1998). Deletion mutant strains for SLC1 and LPT1 were
generated by homologous recombination in a W303-1B haploid (MATa ade2–1, can1–1,
trp1–1, ura3–1, his3–11, 15, leu2–3, 112) (Thomas 1989) by transformation with PCR
derived products containing 50 bp of gene-specific sequence flanking the Kluyveromyces
lactis
URA3
sequence
(Ito
1983;
Rothstein
1991):
for
LPT1,
LPT1F,
5'
ATGTACAATCCTGTGGACGCTGTTTTAACAAAGATAATTACCAACTATGGAC
ATGGCAATTCCCGGGGATCGL
and
LPT1R,
5’
CTACTCTTCCTTTTTTGAAATAGGCTTTGGTGAGTAACCACTAAAACTCATCA
ACATGGTGGTCAGCTGGAATT;
for
SLC1:
SLC1F,
5’
ATGAGTGTGATAGGTAGGTTCTTGTATTACTTGAGGTCCGTGTTGGTCGTACA
TGGCAATTCCCGGGGATCG
and
SLC1R,
5’
TTAATGCATCTTTTTTACAGATGAACCTTCGTTATGGGTATTGACATCGTTCA
ACATGGTGGTCAGCTGGAATT;
for
YBR042,
YBR042F,
5’
GATATATCAGGTCCACTGGTATTGAGATTGCTAGCGAGGTCAATAAGCTGCT
85
GTACTTCCTTGTTCATGTGTG
and
YBR042R,
5’
TCAAAAAATAAAACAATAAAGTTTATAAACTAACCAAATTATTGTTAGAGAC
CTGTATTCCTTTACATCCTCC
and
for
YDR018
YDR018F,
5’
GAAATGAACAAACAACCCTACGTACGACTGTGTTTTGCAGTTTAAGAAGGCC
TGATTCTTGATCTCCTTTAGC
and
YDR018R,
5’
TCAATGATTTTTTTTCATCACAAATACAAGAATAAGAAAAGCGAAGAACCGT
TCAGAATGACACGTATAGAATG. Successful deletion was confirmed by PCR using
gene specific primers. Yeast were grown in YP media (1% yeast extract, 2% peptone)
with 2% glucose (YPD) or in synthetic complete (SC) media .
Synthetic lethality screen
Synthetic genetic array (SGA) analysis was performed by Michael Costanzo and Dr.
Charles Boone, University of Toronto, Toronto, Canada. A Mat α slc1∆:: NatMX4
can1∆:: STE2 prSp his5 lyp1∆ strain was crossed to an array containing the set of ~
5,000 viable deletion mutant strains (Tong 2001).
Yeast Expression Plasmid Construction
A PCR product including the LPT1 open reading frame, 90 bp of 5’- flanking sequence
and 46 bp of 3’-flanking sequence was generated using the primers: 175-1,
CAAAATACAGGCACAGGTCAAGC; 175-2, GACAACAAGACTGTGACTTCCAC,
and W303-1B genomic DNA. The 2.0-kb PCR product was cloned into pCR 2.1 TOPO
(Invitrogen). The LPT1 DNA fragment was digested by NotI / SacI and subsequently
subcloned into similarly digested pRS423GP to create pRS423GP-LPT1. This was
performed by Dr. Peter Oelkers.
86
Pulse-labeling
A dilute inoculation (1/1000 of a saturated culture) of each strain into YP + 2% dextrose
was grown overnight at 30°C into logarithmic phase (OD660 = 0.55–0.80). 0.5 μCi of
[3H] oleate (58,000 dpm / pmol) was added to 4 ml of cells and incubated at 30° C for 30
min. with shaking (Oelkers 2002). Cells were washed and cellular lipids extracted as
described previously. After resolving phospholipids by thin layer chromatography in
chloroform: methanol: acetic acid: water (50:25:8:4), each lane was cut according to lipid
standards and counted by liquid scintillation (Oelkers 2002). Assays were performed on a
minimum of two independent strains of each genotype on two different days.
Preparation of cell lysates, mitochondria and microsomes
Yeast cells were grown in YP containing either 2% glucose or 3% glycerol at 30°C into
early stationary phase (O.D.660 = 1.0). SC-His medium containing 2% galactose was used
for yeast harboring a plasmid. The cells were harvested, washed and cell lysates prepared
as described earlier (Oelkers 2002). Mitochondria were prepared using a previously
published protocol. Briefly, cells were grown in YP media containing 3% glycerol,
harvested, lysed and crude mitochondria were precipitated by centrifugation at 12,000 x
g.
Resuspension of the pellet, followed by sucrose step gradients allowed purified
mitochondria to be collected (Meisinger 2000). The microsomes were purified from the
12,000 x g supernatant by precipitation by centrifugation at 100,000 x g for 1 hour
(Oelkers 2002). Lowry assays were used to measure protein concentration.
87
AGPAT and LPLAT assays, spectrophotometric method
AGPAT activity was measured by the reaction of thiol groups of the released CoA with
5,5’-dithiobis (2-nitrobenzoic acid) (DTNB) resulting in absorbance at 412nm
(Yamashita 1981) The reaction mixture contained 100mM Tris-HCl, pH 7.4, 1.5 mM
DTNB, 50 μM lysophosphatidic acid (lysoPA), 50μM acyl-CoA, cell lysate (210 - 840
μg) in a total volume of 1 ml. The reaction was monitored in real time for 3 minutes in a
Spectronic Genesys 2 spectrophotometer at room temperature. A molar absorbance of
13,600 M-1 cm-1 was used to calculate relative specific activity.
Lysophospholipid
acyltransferase (LPLAT) activity was measured by replacing lysoPA with lysoPC,
lysoPE, or lysoPI.
LPCAT assay, radioactive substrate
LPCAT activity was measured by the incorporation of [1-
14
C] palmitoyl lysoPC into
PC. The reaction contained 100 mM Tris-HCl, pH 7.4, 50 μM [1- 14C] palmitoyl lysoPC
(50,000 dpm/nmol), 1 - 110 μM of the respective acyl-CoA, and 3μg of cell lysate
protein in a final volume of 100 μl. Fixed time assays were performed for 5 minutes at
28°C. The reactions were stopped by adding chloroform: methanol (2:1) and lipids were
extracted and resolved as described elsewhere (Nakanishi 2006) . EZ – fit software was
used for nonlinear regression, curve fit analysis to calculate apparent Km and Vmax
(Perrella 1988). To calculate Vmax / Km, Vmax was first change to nM / min / mg to
remove volume from the units of the ratio.
88
Statistical analysis
The statistical analyses involved comparing two means by t tests and greater than two
means by employing ANOVA. F test for equality of variance among two samples was
conducted before comparing means of two samples by t test. Levene’s test of
homogeneity was used to establish equality of variances before analyzing the data by
ANOVA. Post hoc tests were conducted after ANOVA analysis to find out which means
significantly differed from each other. Tukey’s test was used for post hoc analysis if the
variances were equal and Tamhane’s T2 or Dunnett’s T3 were used if the variances were
not equal. The statistical analysis was done by using SPSS 16 and Excel software. All the
experiments were done at least 3 times on 3 different days with at least two different
strains with the same genotype to account for day to day and strain to strain variation.
89
3.4 Results
Identification of LPT1 in yeast by SGA analysis
To identify the novel AGPAT that mediates phosphatidic acid synthesis in yeast
in the absence of SLC1, SGA was carried out using a slc1∆ query strain (Tong 2001).
Synthetic-lethal genetic interactions were identified with 52 single-gene deletion strains.
Of these 52 genes, 17 genes encode for proteins involved in DNA repair, transcription,
translation, and protein transport. 13 of the deleted genes encode for proteins with known
function of which only one gene, fatty acid elongase (ELO2) is involved in lipid
metabolism (Oh 1997). The remaining 22 uncharacterized genes included YOR175c
(from here on referred to as LPT1).
This gene, along with PMT5 which encodes for a protein O-mannosyltransferase,
was previously shown to be required for the viability of slc1∆ mutants (Schuldiner 2005).
To test this further, independent slc1Δ and lpt1Δ haploid strains were generated and
crossed to form compound heterozygous diploids. Following meiosis, eighty haploid
spores were isolated by tetrad dissection. Twenty spores failed to grow into colonies. Of
the sixty viable haploids, genotyping showed that all were normal, slc1Δ or lpt1Δ. In line
with Hardy Weinberg equilibrium, ¼ of the progeny were therefore inviable and
slc1Δlpt1Δ, confirming the synthetic lethality.
In addition to synthetic lethality, a candidate gene approach was used to identify
the protein that mediates Slc1-independent AGPAT activity. Two unassigned open
reading frames YBR042C and YDR018C were identified by amino acid sequence
homology to known AGPATs in eukaryotes. The sequence databases Gene Bank and
90
alignment tool BLASTP was used. YBR042 and YDR018 encoded proteins are ~ 16%
identical to characterized AGPATS: Slc1, AGPAT1 and AGPAT2. AGPAT3-5 have not
been biochemically characterized and share 23% identity with YBRO42 and YDR018
predicted proteins. YBR042 and YDR018 encoded proteins are 37% identical to each
other. The ybr042∆, ydr018 single deletion and ybr042∆ydro18∆ double deletion yeast
strains were generated. We also generated ybr042∆, ydr018∆ and ybr042∆ydro18∆
strains in the slc1∆ background. Unlike lpt1∆, ybr042∆, ydr018∆ and ybr042∆ydro18∆
strains did not show any growth defects in slc1∆ background. To find out whether these
two candidate genes had any effect on triglyceride and phospholipid synthesis, normal
and above mentioned single and multiple deletion strains grown to exponential phase in
YPD were pulse labeled with [3H] oleate for 30 minutes (Figure 3.2). Consistent with its
role as an AGPAT in yeast, absence of Slc1 resulted in significant reduction in
diglyceride and phospholipid levels in comparison to the normal and ybr042∆, ydr018∆
single and double deletions strains. Interestingly the triglyceride levels were significantly
increased in slc1∆ strain in comparison to normal and other ydr018∆, ybr042∆ single or
double deletions strains. A previous study also reported two fold increase in cellular
triglyceride levels in slc1∆ strain in comparison to the normal strain during logarithmic
growth phase (Athenstaedt 1997). One would expect, however, that defect in
phosphatidic synthesis an intermediate required for both phospholipids and triglyceride
synthesis, would affect the phospholipid as well as triglyceride levels. This selective
increase in triglyceride over phospholipid levels or vice versa has also been reported in
yeast strains deficient in Gat1 and Gat2, the enzymes which catalyze first step in
triglyceride and phospholipid synthesis (Zaremberg 2002).
3
30
(% of total lipids)
[ H] oleate incorporation into DG,TG,P
91
*
20
*
10
*
% DG
0
% TG
Normal
slc1Δ
ydr018Δ
ybr042Δ
% PL
Figure 3.2 Incorporation of [3H] oleate into diglyceride, triglyceride and
phospholipids in slc1Δ, ydr018Δ, ybr042Δ. Normal, slc1Δ, ydr018Δ, ybr042Δ yeast
strains were grown in YPD to logarithmic phase and pulse-labeled with [3H] oleate for 30
minutes. Diglyceride (DG), triglyceride (TG), phospholipids were measured as described
in "Experimental Procedures". The data represent mean ± S.D. n = 3. Asterisk indicates
statistically significant difference between normal and slc11Δ (p<0.05)
30
20
10
or
m
al
0
N
3
[ H] oleate incorporation into DG,TG,PL
(% of total lipids)
92
% DG
% TG
% PL
Figure 3.3 Incorporation of [3H] oleate into diglyceride, triglyceride and
phospholipids in ybr042∆, ydr018∆ and ybr042∆ydr018∆ in slc1∆ background.
Normal and indicated yeast strains were grown in YPD to logarithmic phase and pulselabeled with [3H] oleate for 30 minutes. Diglyceride (DG), triglyceride (TG),
phospholipids were measured as described in "Experimental Procedures". The data
represent mean ± S.D. n = 3.
93
However, YDR018 and YBR042 gene deletions in conjunction with SLC1 showed similar
effects as SLC1 deletion by itself. There was no significant difference in triglyceride,
diglyceride levels and phospholipid levels in the ybro42∆ and ydr018∆ single and double
deletions in logarithmic phase. This coupled with the fact that no growth defect or
lethality was seen in ydr018∆ and ybr042∆ single double and triple deletion strains in slc1
background led us to focus on LPT1. The inviability of lpt1∆slc1∆ double deletion strain
and the presence of acyltransferase motif in LPT1 further strengthened the possibility of it
being a candidate AGPAT. Studies on the physiological role of YBR042 and YDR018
genes are being conducted by other members of Oelkers lab.
Lpt1 is a member of MBOAT family:
LPT1 is predicted to encode for a 619 amino acid protein with seven
transmembrane domains. The C terminus of Lpt1 has a dilysine motif which functions as
an ER retention signal (KKXX) (Vincent 1998) . Analysis of yeast strains expressing
green fluorescent protein tagged proteins have indicated that Lpt1 is localized to
endoplasmic reticulum (Huh 2003). LPT1 belongs to membrane bound-O-acyltransferase
(MBOAT) superfamily of proteins. Members of this superfamily are postulated to encode
for enzymes that catalyze transfer of fatty acyl groups to hydroxyl groups (Hofmann
2000).
Lpt1 shares 25% sequence similarity to three characterized members of the
MBOAT family which utilize diacylglycerol and cholesterol as substrates (Figure 3.4).
Lpt1 contains the conserved hydrophobic region with putative catalytic histidine residue
typical of an acyltransferase (Hofmann 2000).
94
LPT1 (341 )
ACAT1(418 )
ACAT2(382 )
DGAT1(374 )
WNMN TNKWLK YSVYLR VT.KKG KK PGFRSTLFT FLTSAF WHGTRP GYYLTF A
WNVV VHDWLY YYAYKD FLWFFS KR FKSAAMLAV FAVSAV VHEYAL AVCLSF F
WNVV VHDWLY SYVYQD GLRLLG AR ARGVAMLGV FLVSAV AHEYIF CFVLGF F
WNIP VHKWCI RHFYKP MLR..R GS SKWMARTGV FLASAF FHEYLV SVPLRM F
Figure 3.4 Alignment of LPT1 and 3 human members of the MBOAT gene family.
The four amino acid sequences are aligned over the MBOAT motif (Pfam PFO3062).
Positions where 3 out of 4 amino acids are conserved are boxed. In parentheses is the
position of the first amino acid. Acyl-CoA cholesterol acyltransferase (ACAT); acyl-CoA
diacylglycerol acyltransferase (DGAT)
Determining if AGPAT activity is decreased in lpt1∆
Initial experiments examined whether lpt1∆ deletion affected AGPAT activity.
AGPAT activity in cell lysates was measured by a spectrophotometric assay. This assay
estimated AGPAT activity by measuring the release of coenzyme from the acyl-CoA
added to the reaction mixture containing lysophosphatidic acid. Cell lysates prepared
from normal, slc1∆ and lpt1∆ strains were assayed in the presence and absence of
lysophosphatidic acid (Figure 3.5). AGPAT activity was calculated by subtracting
coenzyme A generation in the absence of lysophosphatidic acid from that in the presence
of lysophosphatidic acid.
There was no difference in AGPAT independent activity in slc1∆, lpt1∆ and
normal yeast strain. AGPAT assays were conducted with saturated and monounsaturated
acyl-CoAs. In line with previous studies, slc1∆ cell lysates showed 63% reduction in
AGPAT activity in comparison to normal yeast. However, in lpt1∆ cell lysates no
statistically significant reduction in AGPAT activity was observed.
95
Since the depletion of Lpt1 did not affect the AGPAT activity, we further studied
whether the overexpression of Lpt1 would influence AGPAT activity. Overexpression of
LPT1 led to 7-fold increase in AGPAT activity suggesting that Lpt1 can mediate this
reaction (Figure 3.5). These results indicate that Slc1 contributes to most of AGPAT
activity in the yeast cells grown to early stationary growth phase.
Lpt1 mediates esterification of other lysophospholipids
LPCAT activity has been described in yeast (Yamada 1977; Richard 1998), and the
enzyme mediating this reaction has not been identified. We examined whether Lpt1 can
mediate LPCAT activity in yeast. Spectrophotometric assays were conducted with
lysophosphatidylcholine (lysoPC) and three different acyl donors: palmitoyl-CoA, oleoylCoA and arachidonoyl-CoA. LPCAT activity with monounsaturated and polyunsaturated
acyl-CoAs was 4-7 fold higher than the saturated acyl-CoA at a fixed concentration of
50μM (Figure 3.6). No LPCAT activity was observed in lpt1∆ strain with any of the acyl
donors. Similar results were obtained when [14C] lysoPC and oleoyl-CoA were used. Cell
lysates of lpt1∆ cell lysates showed no activity while wild type cell lysates showed robust
activity (55.6 ± 4.7 nmol/min/mg). These results suggest that Lpt1 is a major LPCAT in
yeast. The possibility exists that other yeast LPCATs might not be expressed or active in
the growth or assay conditions used in present study or might require acyl-CoAs of
particular chain length.
96
A
AGPAT activity
(nmol/min/mg)
20
15
∗
10
5
0
∗
WT
lpt1Δ
slc1Δ
B
∗
AGPAT activity
(nmol/min/mg)
100
80
60
40
20
0
pRS423GP
pRS423GP-LPT1
Figure 3.5 In vitro 1-acyl-sn-glycerol-3-phosphate acyltransferase (AGPAT) assays.
(A) Cell lysates from wild-type, lpt1Δ and slc1Δ haploids, grown to late logarithmic
phase, were assayed for AGPAT activity by the spectrophotometric method described in
"Experimental Procedures". The assay contained 50μM 1-oleoyl lysophosphatidic acid,
50μM acyl-CoA, 1.5 mM DTNB, 0.42-0.84 mg cell lysate and 100 mM Tris-HCl, pH 7.4.
palmitoyl-CoA (black), oleoyl-CoA (grey). The data represent mean ± S.E. n = 3-5.
Asterisk indicates statistically significant difference compared with wild-type strain (p<
0.05). B. Similar assays were performed with cell lysates from wild-type cells
transformed with pRS423GP or pRS423GP-LPT1.
97
LPCAT activity
nmol/min/mg
A
LPCAT activity
nmol/min/mg
B
16
14
12
10
8
6
4
2
0
∗
WT
∗ ∗
lpt1Δ
200
∗
150
100
50
0
pRS423GP
pRS423GP-LPT1
Figure 3.6 Lysophosphatidylcholine acyltransferase (LPCAT) activity is absent in
lpt1Δ. (A). Cell lysates from wild-type, lpt1Δ and slc1Δ haploids, grown to late logarithmic
phase, were assayed for LPCAT activity by the spectrophotometric method described in
"Experimental Procedures" except lysoPA was replaced with lysoPC. Palmitoyl-CoA
(black), oleoyl-CoA (grey) and arachidonyl-CoA (striped). The data represent mean ± S.E.
n = 3-4. Asterisks indicate statistically significant difference compared with wild-type
strain (p< 0.01). (B) Similar assays were performed with cell lysates from wild-type cells
transformed with pRS423GP or pRS423GP-LPT1
98
To verify that Lpt1 was not an accessory protein required for true LPCAT activity,
LPT1 was over expressed in wild type yeast. LPCAT activity was increased by 7-fold in
comparison to the wild type yeast transformed with empty vector (Figure 3.6). This
correlated with the role of Lpt1 as LPCAT. We further examined substrate specificity of
Lpt1 for other lysophospholipid acyl acceptors with palmitoyl-CoA and oleoyl-CoA as
acyl-donors (Figure 3.7). Wild type cell lysates showed lysophosphatidylethanolamine
(LysoPE), lysophosphatidylinositol (LysoPE) and lysophosphatidylserine (Lyso PS)
acyltransferase activities. These activities were 6-12 fold higher with oleoyl-CoA in
comparison to palmitoyl-CoA, each at 50μM. In lpt1∆ strain very little to no lyso PI,
lysoPS and lysoPE acyltransferase activity was left. Assays with oleoyl-CoA as acyl
donor established that lysoPC, lysoPI and lysoPS were better substrates for Lpt1 in
comparison to LysoPE. These results suggest that Lpt1 has broad substrate specificity for
lysophospholipids and is a lysophospholipid acyltransferase (LPLAT).
LPLAT Activity (nmol/min/mg)
99
15
10
5
*
0
Normal
lpt1Δ
LysoPI
*
*
*
Normal
lpt1Δ
LysoPE
Normal
lpt1Δ
LysoPS
Figure
3.7
Lysophospholipid
substrate
specificity
of
Lpt1p.
Lysophosphatidylethanolamine (lysoPE),
lysophosphatidylinositol (lysoPI) and
lysophosphatidylserine (lysoPS) were used as acyl acceptors and LPLAT activity was
determined by the spectrophotometric method using cell lysates prepared from wild-type
yeast. palmitoyl-CoA (black), oleoyl-CoA (textured). The data represents mean ± S.E. n
= 3. Asterisk indicates statistically significant difference (p<0.01) between wild-type and
lpt1Δ.
100
Acyl-CoA substrate specificity of Lpt1
To determine whether Lpt1 was responsible for establishing acyl chain asymmetry
in phospholipids by esterifying lysophospholipids, we determined acyl-CoA substrate
specificity of Lpt1 with [14C] lysoPC as acyl acceptor. We predicted that Lpt1 consistent
with its role in phospholipid remodeling would use unsaturated acyl-CoAs preferentially.
Substrate concentration series experiments were performed with [14C] lysoPC and five
acyl-CoA species: palmitoyl-CoA (16:0), palmitoleoyl-CoA (16:1), stearoyl-CoA (18:0),
oleoyl-CoA (18:1) and arachidonyl-CoA (20:4) (Figure 3.8.1-3). Except arachidonoylCoA, the other four acyl-CoA substrates are the most abundant acyl chains in yeast
phospholipids. The kinetic data was analyzed by EZ – fit software to obtain apparent Km
and Vmax by fitting Michaelis Menten curve or sigmoidal curve to data (Table 3.1). There
was discordance in Km and Vmax values obtained by these two methods. Then the data was
transformed and Lineweaver-Burk and Eadie Hofstee plots were used to determine Vmax
and Km. The data could not be analyzed for most of the acyl-CoAs due to the lack of
linear relationship and when analyzed gave inflated Km and Vmax values.
The kinetic data was then analyzed by Hill plot to obtain apparent K0.5 and Vmax
for different acyl-CoAs (Table 3.1). The Hill number ranged from 1.5-2 for all the acylCoAs suggesting that kinetics did not follow the Michaelis Menten equation and were, in
fact, cooperative. LPCAT activity showed low apparent K0.5 and Vmax for palmitoyl-CoA
(16:0) and stearoyl-CoA (18:0). Higher apparent K0.5 and Vmax for palmitoleoyl-CoA
(16:1) and oleoyl-CoA (18:1) was seen for the monounsaturated acyl-CoA substrates
while polyunsaturated arachidonoyl-CoA (20:4) showed intermediate values.
101
LPCAT activity
(nmol/min/mg)
A
10
8
6
4
2
0
0
10
20
30
Palmitoyl - CoA (μM)
40
B
120
LPCAT activity
(nmol/min/mg)
100
80
60
40
20
0
0
10
20
30
40
50
Palmitoleoyl - CoA (μM)
60
Figure 3.8.1 Acyl-CoA substrate specificity of Lpt1. Cell lysates from lpt1Δ yeast
transformed with pRS423GP / LPT1 were assayed for LPCAT activity by the radioactive
substrate method described in "Experiemental Procedures". The reaction contained 50μM
[1-14C] palmitoyl lysophosphaitdylcholine, 1 - 50 μM of acyl-CoA, 3μg of cell lysate ,
and 100 mM Tris-HCl, pH 7.4 and incubated for 5 minutes at 28°C. A. palmitoyl-CoA B.
palmitoleoyl-CoA. The data represent mean ± S.E. n = 3 - 5.
102
LPCAT activity
(nmol/min/mg)
C
14
12
10
8
6
4
2
0
0
5
10
15 20 25 30
Stearoyl-CoA (μM)
35
40
20
40 60 80 100 120 140 160
Oleoyl - CoA (μM)
D
LPCAT activity
(nmol/min/mg)
100
80
60
40
20
0
0
Figure 3.8.2 Acyl-CoA substrate specificity of Lpt1p. Cell lysates from lpt1Δ yeast
transformed with pRS423GP / LPT1 were assayed for LPCAT activity by the radioactive
substrate method described in "Experiemental Procedures". The reaction contained 50μM
[1-14C] palmitoyl lysophosphaitdylcholine, 1 - 140 μM of acyl-CoA, 3μg of cell lysate ,
and 100 mM Tris-HCl, pH 7.4 and incubated for 5 minutes at 28°C. C. stearoyl-CoA D.
oleoyl-CoA. The data represent mean ± S.E. n = 3 - 5.
103
E
40
LPCAT activity
(nmol/min/mg)
30
20
10
0
0
20
40
60
Arachidonoyl - CoA (μM)
80
Figure 3.8.3 Acyl-CoA substrate specificity of Lpt1p. Cell lysates from lpt1Δ yeast
transformed with pRS423GP / LPT1 were assayed for LPCAT activity by the radioactive
substrate method described in "Experiemental Procedures". The reaction contained 50μM
[1-14C] palmitoyl lysophosphaitdylcholine, 2.5 - 75 μM of arachidonoyl-CoA, 3μg of cell
lysate , and 100 mM Tris-HCl, pH 7.4 and incubated for 5 minutes at 28°C. The data
represent mean ± S.E. n = 3 - 5.
104
Table 3.1 Comparison of different methods used to calculate kinetic parameters of
Lpt1. Kinetic data from Figure 3.8.1-3 was used to calculate apparent Vmax and Km of
Lpt1 for different acyl-CoAs.
Acyl-CoA
Palmitoyl-CoA
(16:0)
Palmitoleoyl-CoA
(16:1)
Stearloyl-CoA
(18:0)
Oleoyl-CoA
(18:1)
Arachidonyl-CoA
(20:4)
Hill Plot Analysis
Michaelis Menten
(Curve to fit data)
Km
Vmax
(nmol
/ min / mg)
(μM)
Km
(μM)
Vmax
(nmol / min / mg)
2.2
6.8
1.8
7.8
11
105
21
142
4.7
9.6
5.9
12
30.5
95.4
49
125
10.5
34.4
11
58
Table 3.2 Kinetic parameters of Lpt1: Endogenous acyl-CoA profile in wild type (S288C
background) yeast strain was obtained from literature (Faergeman 2001).
*
The
concentration in (μM) was calculated by assuming a yeast haploid cell volume of 75 μm3.
Acyl-CoA
K0.5
(μM)
In vitro acylCoA conc.*
(μM)
Palmitoyl-CoA (16:0)
Palmitoleoyl-CoA (16:1)
Stearloyl-CoA (18:0)
Oleoyl-CoA (18:1)
Arachidonyl-CoA (20:4)
2.2
11
5.5
30.4
10.5
5.4
7.9
6.2
2.9
-
Expected
LPCAT
Activity at in
vitro acyl conc.
(nmol/min/mg)
7.2
30
5
5
Vmax
(nmol /
min /
mg)
Vmax / K0.5
(min-1
mg-1)
6.8
105
11.6
95.4
34.4
44
95
21
31
33
105
The ratio of Vmax/Km or the efficiency of enzyme can be used to find out what the
preferred substrate is (Table 3.2). The value for efficiency of the enzyme was highest for
palmitoleoyl-CoA followed by palmitoyl-CoA. The Vmax/Km ratio was in general higher
for unsaturated acyl-CoAs in comparison to saturated acyl-CoA, although palmitoyl-CoA
was an exception due to its low apparent K0.5.
Subcellular distribution of LPLAT activity
Acyl-CoA dependent LPCAT activities have been identified in yeast microsomes
and mitochondria. Yamada et al., have shown that yeast LPCAT activity was localized
mainly in microsomes and that mitochondrial fraction had much lower activity (4%of the
microsomal activity). Acyl-CoA dependent LPCAT activity in mitonchodria was reported
in yeast, although the percentage recovery of protein and activity in this subcellular
fraction was not examined (Yamada 1977; Testet 2005).
To verify the location of LPLAT activity we used sucrose gradients to purify
mitochondria, microsomes, and cell lysates by differential centrifugation. LPCAT activity
(representative of LPLAT activity) was measured in these subcellular fractions (Table
3.3). The microsomal fraction was highly enriched for LPLAT activity and had 10- fold
higher activity than cell lysates. The mitochondrial fraction did not show any enrichment
in LPLAT activity. No LPLAT activity independent of Lpt1 was detected in lpt1∆
mitochondria. This suggested that there is no acyl-CoA dependent mitochondrial LPCAT.
106
Table 3.3 Subcellular localization of acyl-CoA dependent LPCAT activity. Wild-type
yeast were grown in YP with 3% glycerol to O.D.660 = 1. Cell lysates, mitochondria and
microsomes were isolated as described under "Experimental Procedures". LPCAT
activity was measured using the spectrophotometric method as described in fig. 3. The
data represent mean ± S.E. n = 3.
Subcellular
fraction
LPCAT activity
(nmol / min / mg)
Fold
enrichment
Percent
recovery
Cell lysate
10.2 ± 0.5
Mitochondria
8.1 ± 1.9
0.8 ± 0.1
1.9 ± 0.9
Microsomes
99.2 ± 2.7
9.7 ± 0.2
65.1 ± 14.5
107
Counts per minute x 103
A
Counts per minute x 103
B
50
40
30
*
20
10
∗
0
Normal
lpt1Δ
100
80
60
40
20
0
Normal
lpt1Δ
Figure 3.9 Incorporation of [3H] oleate into phospholipids and neutral lipids. Wildtype and lpt1Δ yeast were grown in YPD to logarithmic phase and pulse-labeled with
[3H]oleate for 30 minutes. A. Incorporation into the major phospholipids (PC, black; PE,
white; PS/PI, striped) B. neutral lipids (diglyceride, dark gray; triglyceride, light gray;
ergosterol ester, hatched) was measured as described in "Experimental Procedures". The
data in counts per minute represent mean ± S.E. n = 4. Asterisk indicates statistically
significant difference between wild-type and lpt1∆ (p<0.05)
108
Role of Lpt1 in oleate incorporation into glycerolipids
We further studied the physiological role of Lpt1 mediated LPLAT activity in
yeast. Wild type and lpt1∆ strains were pulse labeled with [3H]oleate for 30 minutes and
the incorporation of radioactive label in different phospholipid species and neutral lipids
was measured (Figure 3.9). The lpt1∆ strains incorporated 30% less label in PC than the
wild type strain. PS, PE, PI and neutral lipids did not differ between lpt1∆ strain and wild
type yeast.
The effect on PC synthesis may be due to reduction in AGPAT activity or LPLAT
activity mediated by Lpt1. AGPAT mediates the synthesis of phosphatidic acid (PA), an
important intermediate in the de novo synthesis of phospholipids and triglycerides.
Therefore, one would expect that changes in Lpt1 mediated AGPAT activity would
decrease the incorporation of oleate in triglycerides and phospholipids. Thus it is more
likely that selective reduction in oleate incorporation in PC in lpt1∆ strains is due to the
contribution of LPLAT activity mediated by Lpt1 towards PC synthesis. Since Lpt1 has
the ability to esterify other lysophospholipids it is difficult to say why the effect was
limited to PC.
109
3.5 Discussion
AGPAT mediates the acylation of lysophosphatidic acid to phosphatidic acid, an
essential intermediate in the de novo triglyceride and phospholipid synthetic pathway. The
basic synthetic pathways of triglyceride and phospholipids (with some exceptions) in S.
cerevisiae are same as in higher eukaryotes. Human AGPAT-1 and AGPAT-2 were
cloned by homology to Slc1, the yeast AGPAT. The slc1∆ mutants are viable and
microsomes prepared from slc1∆ strain retain the ability to synthesize phosphatidic acid
(Athenstaedt 1997) indicating that alternative pathway or another AGPAT must exist in
yeast. We initiated the present study to identify the novel AGPAT in yeast, and
potentially identify novel AGPAT members of the existing human AGPAT family or a
new family of enzymes with AGPAT activity.
Yeast is a versatile model system with well-defined genetic system making it
possible to conduct a systematic analysis of lethality and other phenotypes associated
with deletion of a gene in yeast. Because of the essential requirement of phosphatidic acid
for the synthesis of membrane phospholipids in yeast, and indeed all eukaryotes, absence
of enzymes synthesizing PA should prove lethal to cell. Therefore the present study
employed synthetic lethal screen to identify candidate AGPAT genes which when deleted
in conjunction with SLC1 would lead to cell inviability. SGA analysis utilizing slc1∆
mutant was undertaken and a total of 52 synthetic lethal interactions were identified.
Among the 13 synthetic lethal genes with known functions, FEN1 (ELO2) encodes
protein required for the synthesis of very long chain fatty acids (VLCFA).
110
ELO2 and ELO3 belong to elongase family of proteins and have been shown to
catalyze elongation of C16 to C18 fatty acids to C24-C26 respectively. These VLCFA are
required for sphingolipid synthesis. Simultaneous disruption of ELO2 and ELO3 in a
haploid cell is synthetically lethal (Dickson 2008). Sphingolipids are made up of long
chain base (LCB), very long chain fatty acids (usually C26) and a polar head group. LCBs
are required for cell viability; however strains lacking LCBs have been isolated. These
lcb1- defective cells can grow because of a suppressor mutation in SLC1. SLC1-1 mutant
cells, with Q44L substitution in the Slc1 protein suppresses the defect in sphingolipid
synthesis by incorporating long chain acyl groups (C26) in the sn-2 position of inositol
containing glycerolipids (Nagiec 1993). This novel lipid is postulated to mimic ceramides
required for sphingolipid synthesis. Overexpression studies on SLC1-1 and SLC1 have
shown that Slc1 shows AGPAT activity in the presence of 22:1-CoA and 24:0-CoA (Zou
1997). Although this activity is only 21%-33% of that of SLC1-1 encoded mutant protein
it might be sufficient to compensate for loss of sphingolipid synthesis in yeast. It is
possible that ELO3 in conjunction with SLC1 can compensate for the defect in
sphingolipid synthesis caused by the absence of ELO2. A yeast strain with a disruption in
SLC1, ELO3 and LCB1 (lcb1∆slc1∆elo3) has been shown to be inviable (Dickson 2008).
LPT1, a member of MBOAT superfamily, was also identified by the synthetic
lethality screen and further characterized. The MBOAT superfamily which consists of
membrane bound acyltransferases is evolutionarily conserved. 5 members of this family
that are found in Saccharomyces cerevisiae are sterol acyltransferases Are1, Are2;
glycosylphosphatidylinositol anchor remodeling enzyme Gup1, Gup2 and Lpt1.
111
In humans the MBOAT family consists of 16 members of which ACAT1,
ACAT2, and DGAT1 are the only members whose biochemical role has been established.
Lpt1 does not share sequence homology with Slc1 or any other AGPAT family members
including lysophosphatidylcholine acyltransferases, LPCAT1 and LPCAT2. Lpt1 shares
24%, 21% and 22% amino acid sequence identity with human MBOAT1, 2 and 5
respectively. Further studies on the human counterparts of Lpt1 have been described later.
To investigate whether Lpt1 was responsible for AGPAT activity in slc1∆ strain,
we compared the AGPAT activity in lpt1∆ and slc1∆ cell lysates. AGPAT activity was
reduced by 60% in the absence of SLC1, the known AGPAT in yeast. This is consistent
with the results of a previous study that showed 54% reduction in microsomal
phosphatidic acid synthesis in slc1∆ in comparison to the wild type yeast strain. However,
AGPAT activity in lpt1∆ yeast strain was not statistically different from that in wild type
strain. It is possible that in the absence of Lpt1, Slc1 is up regulated and hence AGPAT
activity is unaffected. However, overexpression of LPT1 in a wild type yeast strain
increased AGPAT activity by 7-fold. Also, simultaneous deletion of SLC1 and LPT1 in
haploid cell lead to inviability suggesting that LPT1 is the novel AGPAT in yeast
responsible for phosphatidic acid synthesis in the absence of SLC1.
Additional experiments in the present study demonstrated that LPT1 is the major
lysophospholipid acyltransferase in yeast. There is a complete loss of the ability to
esterify sn-2 lysophosphatidylcholine upon LPT1 deletion in the assay conditions here
employed. This LPCAT activity was mostly associated with microsomes (65%), which
was in agreement with previous studies which showed that Lpt1 localizes to ER (Huh
2003).
112
Loss of 1/3 of LPCAT activity might have been due to degradation of enzyme or
inefficiency in the process of preparation of subcellular fractions. Acyl-CoA dependent
LPCAT activity has been described in mitochondria (Testet 2005) but we found very little
LPCAT activity (2%) to be associated with mitochondrial fraction in wild type strain and
no activity in mitochondrial fractions prepared from an lpt1∆ strain.
The wild type strain showed the ability to esterify other lysophospholipids
(lysoPE, lysoPI and lysoPS) by an acyl-CoA dependent reaction. The acylation rate of
different lysophospholipids was in the order lysoPC=lysoPI=lysoPS>lysoPE when each
was included at 50 μM. The lpt1∆ yeast strain showed very little to no ability to esterify
lysoPC, lysoPE and lysoPI. In lpt1∆ yeast strain, around 15% of lysoPS acyltransferase
activities with unsaturated aycl doors and 50% activity with saturated acyl-CoAs
remained. It is possible that there are yet to be identified lysoPS acyltransferases in yeast.
Lysates of slc1∆ yeast strain transformed with yeast expression vector containing coding
region of SLC1 (pYEUra3-SLC1) showed no lysophospholipid acyltransferase activity
with 45μM lysoPC, lysoPE and lysoPI and 18 μM [14C] 18:1-CoA (Zou 1997). Since in
these assays lysoPS was not included as acyl acceptor it is possible that Slc1 is
responsible for residual lysoPS acyltransferase activity in the absence of Lpt1.
In yeast, the role of lysoPE esterification was proposed in uptake and synthesis of
PE from exogenous lysoPE (Riekhof 2006), however the enzyme mediating this
esterification was not identified. Microsomal lysoPI acyltransferase activity has been
described in rat brain (Baker 1973), pancreas (Rubin 1983) and bovine brain (Sanjanwala
1989). Acyl-CoA dependent conversion of lysoPS to phosphatidylserine is also known to
occur in rat liver (Holub 1980).
113
The ability of Lpt1 to transfer acyl groups to sn-2 position of wide variety of
lysophospholipids and the absence of activity upon its deletion shows that Lpt1 is the
major LPLAT in yeast and may be the first characterized member of a LPLAT branch of
the MBOAT gene family.
Since Lpt1 esterifies lysophospholipids at the sn-2 position, we examined whether
acyl-CoA selectivity of Lpt1 contributes to asymmetrical distribution of acyl groups in
phospholipids. Using lysoPC as the acyl acceptor, low Km and Vmax values were obtained
with saturated acyl-CoAs while unsaturated acyl-CoA showed higher Km and Vmax values.
In comparison to previously described LPCAT activity in yeast (Km-152 μM; Vmax- 10.9
nmol/min/mg), the Km for oleoyl-CoA was lower and the Vmax was higher. Vmax/Km ratio
was used to compare the utilization of acyl-CoAs by the enzyme. In general the efficiency
was higher for the unsaturated acyl-CoAs compared to the saturated acyl-CoAs.
Comparison of LPLAT activity at physiological concentration of each acyl-CoAs would
give better idea about the acyl-CoA specificity of Lpt1. There are very few studies which
have measured the intracellular acyl-CoA pool in yeast.
Endogenous levels of acyl-CoA species in wild type yeast cells grown to
exponential phase (O.D
660
0.8) in YEPD media have been measured in nmol/ 2 * 109
cells (Faergemann 2001). The average volume of haploid yeast is about 70 μm3 and this
information allows us to calculate the concentration of each acyl-CoA in the cell
(Sherman 2002). At these concentrations the Lpt1 will utilize the acyl-CoAs in the
following order: 16:1-CoA> 16:0-CoA> 18:1-CoA = 18:0 CoA (Table 3.2). As can be
derived from our data, small changes in acyl-CoA species concentration may change the
substrate used the most by Lpt1.
114
The physiological role of Lpt1 mediated LPLAT activity on glycerolipid synthesis
was studied by pulse labeling wild type and lpt1∆ strain with [3H] oleate. 30% reduction
in incorporation of label in PC was seen in lpt1∆ strain. This decrease is less likely to be
due to decrease in AGPAT activity that mediates the synthesis of phosphatidic acid, a
precursor for all phospholipid species and triglyceride. Since no changes were seen in
incorporation of label in any other phospholipids and triglyceride in lpt1∆ strain, it is
more likely that the absence of LPLAT activity affects the PC synthesis via a remodeling
pathway. Lpt1 can mediate esterification of lysoPE, lysoPI and lysoPS and a lack of
effect on these phospholipids might be due to their low abundance or low turn over in
cell. Mitochondrial phospholipase A2 activity in yeast has been reported but the
preference for phospholipid species is not known (de Kroon 2007). Yeast phospholipase
B, Nte1 selectively degrades PC synthesized by CDP-choline pathway, producing
glycerolphosphocholine
(Zaccheo
2004).
Recently,
glycerophosphocholine
acyltransferase (GPCAT) activity was reported in yeast however, no gene–enzyme
relationship was established. It was suggested that glycerophosphocholine is sequentially
acylated by GPCAT and Lpt1 to synthesize phosphatidylcholine (Stalberg 2008).
Another reaction which produces lyso-PC in yeast is the transfer of an acyl group
from PC to diglyceride to synthesize triglycerides (Oelkers 2000). This acyl-CoA
independent reaction catalyzed by Lro1, may contribute to substrates for Lpt1. In addition
to membrane remodeling Lpt1 might be required to regulate intracellular levels of
lysophospholipids in the event of increased rate of phospholipid turnover. The
esterification of lysophospholipids to synthesize phospholipids might be energetically
favorable for cell in comparison to de novo synthesis of phospholipids.
115
Phospholipids in general have saturated acyl chains in the sn-1 position and
unsaturated acyl chains in sn-2 position. This asymmetrical distribution of acyl chains in
phospholipids is thought to occur by phospholipid remodeling requiring lysophospholipid
acyltransferase activity (Lands 1960). In Saccharomyces cerevisiae, Lpt1 mediates most
of the lysophospholipid acyltransferase activity with a preference for unsaturated acylCoAs suggesting its role in phospholipid remodeling. Absence of SLC1 in conjunction
with LPT1 leads to cell lethality, suggesting a minor but important role of LPT1 as an
AGPAT.
After the publication of the present study, Ict1 a novel soluble yeast AGPAT was
identified (Ghosh 2008). This AGPAT is expressed in yeast cells upon exposure to
organic solvents and perhaps contributes to the phospholipid synthesis in conditions in
which requirement of phospholipids for repair is increased. Further studies will be
required to examine the contribution of Slc1, Lpt1 and Ict1 in synthesis of PA, an
important intermediate for triglyceride and phospholipid synthesis. Parallel studies by
other investigators also identified LPT1 by using different genetic approaches (Benghezal
2007; Chen 2007; Riekhof 2007). Identification of LPT1, a member of MBOAT
superfamily will allow us to understand the functional role of the mammalian orthologues
in establishing phospholipid acyl chain composition.
116
CHAPTER 4: IDENTIFICATION AND BIOCHEMICAL CHARACTERIZATION
OF HUMAN LYSOPHOSPHATIDYLCHOLINE ACYLTRANSFERASE-3
(LPCAT3)
4.1. Abstract
Phospholipids are important constituents of membranes. They are synthesized by
a de novo synthetic pathway and are remodeled by the Lands cycle to achieve the
asymmetric distribution of acyl chains commonly found in the phospholipids. The Lands
cycle has two components, deacylation by phospholipase to form lysophospholipids and
reacylation by lysophospholipid acyltransferases to form phospholipids. Recently, we
characterized Lpt1, a lysophospholipid acyltransferase with broad substrate specificity in
Saccharomyces cerevisiae.
In this study we describe the characterization of lysophosphatidylcholine
acyltransferase 3 (LPCAT3), a human homolog of Lpt1 which specifically esterifies
lysophosphatidylcholine. LPCAT3, when expressed in insect cells, resulted in 10 fold
higher LPCAT activity in cell lysates over endogenous activity. No other acyltransferase
activity was detected with a variety of other acyl acceptors including lysophosphatidic
acid. The LPCAT3 activity did not display specificity towards acyl chains present in the
sn-1 position of lysophosphatidylcholine. Concentration series experiments with
saturated, monounsaturated and polyunsaturated acyl-CoAs, showed that LPCAT3 has a
low apparent K0.5 (5μM) and Vmax (50 nmol/min/mg) for saturated acyl-CoA and higher
K0.5 (46.5 μM) and Vmax (759 nmol/min/mg) with monounsaturated aycl-CoA.
Polyunsaturated acyl-CoA showed intermediate values.
117
Electrospray ionization-mass spectrometric analysis of phospholipids in Sf9 cells
expressing LPCAT3 showed a relative increase in phosphatidylcholine containing
saturated acyl chains and a decrease in phosphatidylcholine containing unsaturated acyl
chains. This shift in acyl chain composition of phospholipids agrees with the in vitro
preference of LPCAT3 for saturated acyl-CoA when physiological acyl-CoA
concentrations are less than or equal to 5 μM. Characterization of molecular nature of
human LPCAT3 will enable us to investigate whether other human MBOAT protein
acylate lysophospholipids and help us understand the role of this family in phospholipid
remodeling.
118
4.2 Introduction
Lysophosphatidylcholine (LysoPC) is a major lysophospholipid in plasma with
concentrations around 200µM (Murph 2007). It is mainly produced by phospholipase A2
and lecithin:cholesterolacyltransferase (LCAT) (Albers 1976). High levels of
lysophosphatidylcholine lead to apoptosis (Takahashi 2002; Han 2008), cell lysis
(Weltzien 1979) and inflammation (Kougias 2006). The enzyme systems that utilize this
lysophospholipid and might clear it from plasma include lysophospholipases and
lysophosphatidylcholine acyltransferases (LPCAT) (Wang 1999). LPCATs are also part
of the acylation arm of Lands Cycle to synthesize remodeled phosphatidylcholine (PC) in
rat liver (Lands 1960).
Remodeling of phospholipids helps to maintain acyl chain composition of
membrane lipids and allows for the incorporation of arachidonic acid in the sn-2 position
of phosphatidylcholine which when released by cytosolic PLA2 is a substrate for
eicosanoids (Funk 2001). The acyl chain composition of the peritoneal macrophage
membrane phospholipids, when enriched for saturated fatty acids, showed a reduction in
endocytosis
and
bilayer
fluidity
(Mahoney
1980).
Thus,
the
acylation
of
lysophospholipids might regulate their plasma levels and maintain membrane function.
The lysophospholipid acyltransferases esterify lysophospholipids by utilizing acyl groups
of varying chain length and saturation (Lands 1960). These enzyme systems might
catalyze the formation of remodeled phospholipids with specific biological function in a
particular tissue.
119
Mouse LPCAT1 is highly expressed in lung and is suggested to catalyze the
formation of dipalmitoyl lysophosphatidylcholine, a pulmonary surfactant (Nakanishi
2006).
LPCAT2 primarily synthesizes platelet activating factor in inflammatory cells (Shindou
2007). Previous studies have shown that lysoPC in rat liver microsomes is acylated in
vitro preferentially by oleoyl-CoA and arachidonoyl Co-A (Yamashita 1997). Similarly,
LPCAT activity in guinea pig gall bladder utilizes oleoyl CoA as a preferred acyl donor
(Niederhiser 1978). This suggests that there are other yet to be identified LPCATs, which
are tissue specific and maintain acyl chain composition of membranes or quench excess
lysophospholipids in their environment.
We previously cloned LPT1, a novel lysophospholipid acyltransferase (LPLAT)
in Saccharomyces cerevisiae with broad substrate specificity for lysophospholipids (Jain
2007). LPT1 is a member of membrane bound O-acyltransferase (MBOAT) super family.
Members of this family are membrane proteins and have a conserved histidine in their
active site (Hofmann 2000). The human homologues of LPT1 shared no sequence
similarity to the LPCAT1 and LPCAT2 family and most of them have not been
biochemically characterized. MBOAT1 gene disruption due to translocation was
associated with a novel brachydactyly-syndactyly syndrome (Dauwerse 2007). Recently,
one of the members of the MBOAT family LENG4, encoded protein was characterized as
lysophosphatidylinositol acyltransferase (Lee 2007). In this study, we report the
identification and biochemical characterization of human LPCAT3, a LPT1 homolog and
a member of MBOAT family.
120
4.3 Experimental Procedures
Materials
Lysophosphatidylethanolamine
(lysoPE),
lysophosphatidylserine
(lysoPS),
lysophosphatidylinositol (lysoPI), 1-O-alkyl lysoPC, and lysoPG were from Avanti Polar
Lipids (Alabaster, AL). [1-14C] palmitoyl- lysoPC (55mCi/mmol) was from Perkin-Elmer
Life. All other chemicals were obtained from Sigma or Fisher.
Protein sequence analysis
Full-length sequences were aligned using clustalW2 (Labarga 2007). For percent
identity, the conserved amino acids were counted and divided by the length of the shorter
of the two proteins compared. Transmembrane domains were predicted by the
transmembrane helix prediction hidden Markov model (TMHMM) 2.0 program (Krogh
2001).
Insect cell expression
A 4.4 kb human LPCAT3 cDNA clone (GenBank Acc. # BC065194) was obtained from
the American Type Culture Collection in pCMVsport6. Restriction digest with SmaI,
PvuII released the open reading frame with 45 bp of 5'UTR and 121 bp of 3'UTR. This
fragment was ligated into StuI digested pFastbac and sequenced. Subsequent baculovirus
expression in Sf9 insect cells was performed by Dr. David Schultz, Wistar Institute
Protein Expression Core Facility. The pFastbac / LPCAT3 plasmid and a pFastbac /
Glutathione S-transferase (GST) control were transposed into DH10Bac cells.
121
Recovered bacmid DNAs were screened by PCR for proper transposition of the transfer
vector into the baculovirus genome. Positive bacmid DNAs were transfected into Sf9
cells and passage 1 (P1) virus stocks were recovered 96 hours post-transfection. A hightiter P2 virus stock was generated by infecting Sf9 at a multiplicty of infection (MOI) of
~0.1, followed by incubation for 96-120 hours. For productions, 1 x 106 Sf9 cells/ml in
Sf900-II medium (Invitrogen) were infected with viruses at an MOI of 1. Cells were
harvested 48 hours post-infection.
Generating cell lysates for enzymatic assays
Sf9 cells were homogenized in 1 mM EDTA / 200 mM sucrose / 100 mM Tris-HCl, pH
7.4 by 10-15 passages through a 26.5 gauge needle (Yen 2002). Unlysed cells were
removed by centrifugation at 1,000 x g for 5 min. at 4° C and the supernatant was stored
frozen (-70° C) prior to assays.
LPCAT assay, radioactive substrate
Lysophosphatidylcholine acyltransferase (LPCAT) activity was measured by the
incorporation of [1-14C] palmitoyl lysoPC into phosphatidylcholine (PC). The reaction
contained 100 mM Tris-HCl, pH 7.4, 50 μM [1-14C]palmitoyl lysoPC (50,000 dpm /
nmol), 1 - 150 μM of the respective acyl-CoA, and 1 μg of cell lysate protein in a total
volume of 100μl. Fixed time assays were performed for 7.5 minutes at 28° C. Reactions
were stopped by adding chloroform: methanol (2:1) and lipids were extracted, resolved
by thin layer chromatography (TLC), and quantified as described elsewhere (Nakanishi
2006). EZ-Fit software was used for non-linear regression, curve fit analysis to calculate
apparent K0. and Vmax. To calculate Vmax / Km, Vmax was first changed to nM / min / mg to
122
remove volume from the units of the ratio. Hill plot analysis was done to obtain Hill
number.
LPLAT assays, spectrophotometric
These assays were essentially performed as described in the previous chapter. The
reaction mixture contained 100 mM Tris-HCl, pH 7.4, 50 μM of the respective lysoPL,
50 μM oleoyl CoA, 1 mM DTNB, and 2 - 5μg cell lysate protein in a total volume of 1
ml. Real time assays were performed for 5 minutes at room temperature.
Bligh-Dyer lipid extraction
Cellular phospholipids were extracted using chloroform and methanol according to the
method of Bligh and Dyer (Bligh 1959). Following transfection, Sf9 cells were
homogenized in 3 mL of methanol: water (2:0.8), transferred to a glass test tube and 1.25
mL chloroform was added. Tubes were vortexed for 30 seconds and allowed to sit for 10
minutes on ice. After centrifugation at 213 x g for 1 minute the chloroform layer was
collected. The extraction was repeated and the lipid extracts were combined, dried under
argon, reconstituted with 50μL of methanol: chloroform (2:1), and stored at -20°C.
Lipid phosphorus assay
This was performed by Dr. Brian Cummings, Department of Pharmaceutical and
Biomedical Sciences, The University of Georgia, Athens, GA. 10 μL of lipid extract was
dried under argon. 200 μL of perchloric acid was added and heated at 130° C for 2-3
hours. To this was added 1 mL of dH2O, 1.5 mL of reagent C (4.2 g ammonium
molybdate tetrahydrate in 100 mL 5 N HCl and 0.15 g malachite green (Zhou 1992)
oxalate in 300 mL dH20) and 200 μL of 1.5% (v/v) Tween 20. After 25 minutes at room
temperature, the A590 was measured.
123
Electrospray ionization-mass spectrometry (ESI-MS)
This was performed in collaboration with Dr. Brian Cummings, Department of
Pharmaceutical and Biomedical Sciences, The University of Georgia; Athens, GA. Lipid
extracts (500 pmol/μl) were prepared by reconstituting in chloroform: methanol (2:1).
Mass spectrometry was performed as described previously (Taguchi 2000). Samples were
analyzed using a Trap XCT ion-trap mass spectrometer (Agilent Technologies, Santa
Clara, CA) equipped with an ESI source. 5 μL of sample was introduced by means of a
flow injector into the ESI source at a rate of 0.2 ml/min. The elution solvent was
acetonitrile: methanol: water (2:3:1, v/v/v) containing 0.1% (w/v) ammonium formate
(pH 6.4). The mass spectrometer was operated in the positive and negative ionization
modes. The nitrogen drying gas flow-rate was 8.0 L/min at 350°C, nebulizer pressure
was 30 psi, and capillary voltage was 3 kV. As previously described (Taguchi 2000)
qualitative identification of individual PL molecular species was based on their calculated
theoretical monoisotopic mass values and subsequent MSn fragmentation to identify the
polar head groups. Relative quantification was done by comparison to the most abundant
phospholipid in each sample, which corresponded to m/z 760 or, 34:1 (16:0-18:1) PC.
MassLynx 4.0 software was used for data analysis. MSn fragmentation was performed on
the same instrument under similar conditions except that the ion source and ion optic
parameters were optimized with respect to the positive molecular ion of interest.
Statistical Analysis
Data from four separate Sf9 infections underwent analysis of variance using SAS
software. Individual means were compared by post hoc tests.
124
4.4 Results
Identification of MBOAT5/ C3F as a LPT1 homolog
To characterize functional homologs of Lpt1, we performed homology search of amino
acid sequence data bases using Lpt1 amino acid sequence as the query. Three human
proteins, MBOAT1, MBOAT2 and MBOAT5 (C3F) with approximately 25% identity to
Lpt1 were identified. MBOAT5 (also called C3F) was chosen for initial analysis because
of the conservation of the KKME motif at the C-terminal as an endoplasmic retention
signal (Figure 4.1). Immunofluorescence studies using antibody against a peptide
sequence of C3F have shown that C3F has endoplasmic reticulum localization in both
HeLa and HEK293 cells (Hodges 2005). MBOAT5/C3F is predicted to encode for 487
amino acid protein. Analysis of the predicted protein sequence by TMHMM 2.0 program
identified seven transmembrane domains (Figure 4.2).
Biochemical characterization of MBOAT5/C3F encoded Lysophosphatidylcholine
acyltransferase activity
To determine whether MBOAT5/C3F encoded protein was a functional homolog of Lpt1,
a lysophospholipid acyltransferase in Saccharomyces cerevisiae, a putative full length
cDNA clone for MBOAT5 was found in the mammalian gene collection and inserted
into baculovirus. Insect cells were infected with the recombinant hMBOAT5 baculovirus
to express MBOAT5 protein. To account for the endogenous acyltransferase activity,
parallel infections with a GST-encoding virus were done.
125
Figure 4.1 Alignment of Lpt1p and MBOAT5 / C3F. ClustalW2 was used to align the
yeast Lpt1p (610 amino acids) and human MBOAT5 / C3F (487 amino acids) peptide
sequences. Numbers at the ends of lines refer to the location of the last residue. Not
shown are the C-terminal 107 amino acids of Lpt1p which terminate in KKEE.
Figure 4.2 Predicted transmembrane domains of LPCAT3. Seven transmembrane
domains (boxes in dark grey) were predicted by TMHMM 2.0 for LPCAT3
126
Cell lysates prepared from insect cells expressing human MBOAT5 showed 10-fold
higher [14C] lysoPC incorporation in PC with oleoyl-CoA over the GST-expressing
controls (Figure 4.3). We therefore renamed MBOAT5/C3F as LPCAT3. The yeast
ortholog, Lpt1 can utilize a variety of lysophospholipid species therefore we examined
the ability of LPCAT3 to esterify other lysophospholipids. Lysophosphatidylserine
(lysoPS) and lysophosphatidylethanolamine (lysoPE) were used as substrates but showed
8 fold less activity in comparison to lysoPC at 50μM. Lysophosphatidic acid (lysoPA),
lysophosphatidylglycerol (lysoPG), lysophosphatidylinositol (lysoPI) and lyso-platelet
activating factor (lysoPAF) were not used as acyl acceptors. LPCAT3 activity was not
affected by variation of chain length or by the presence of double bond in the sn-1 acyl
groups in lysoPC (Figure 4.4).
Kinetic analysis was carried out by examining the LPCAT activity with
increasing substrate concentrations of 1-palmitoyl-lysoPC and 50μM oleoyl-CoA (Figure
4.5). The kinetic data was analyzed by EZ – fit software to obtain apparent Km and Vmax
of LPCAT3 for different acyl-CoAs by fitting Michaelis Menten curve or sigmoidal
curve to data. There was discordance in apparent Km and Vmax values obtained by these
two methods (Table 4.1). Then the data was transformed and Lineweaver-Burk and Eadie
Hofstee plots were used to determine Vmax and Km. Using Lineweaver-Burk plot the Km
and Vmax for lysoPC were 85μM and 1666 nmol/min/mg respectively. By Eadie Hofstee
transformation the Km and Vmax for lysoPC were 64.5 μM and 1320 nmol/min/mg
respectively.
127
LPCAT activity
(nmol/min/mg)
600
*
500
400
300
200
100
0
hLPCAT3
GST
Figure 4.3 Lysophosphatidylcholine acyltransferase (LPCAT) activity in infected
Sf9 insect cells. Cell lysates from Sf9 cells with baculovirus-mediated expression of
MBOAT5 or GST were assayed for LPCAT activity by the radioactive substrate method.
50 μM [1-14C] palmitoyl-lysoPC, 50 μM oleoyl-CoA, 1 μg cell lysate, and 100 mM TrisHCl, pH 7.4 were incubated for 7.5 minutes at 28°C. Radioactive product (PC) was
resolved from substrate (lysoPC) by TLC. The data represent mean ± S.E. n = 4. Asterisk
indicates statistically significant difference (p< 0.001).
128
LPCAT activity
(nmol/min/mg)
1600
1200
800
400
0
14:0 16:0 18:0 18:1
LysoPC
14:0 18:1
LysoPE LysoPS
Figure 4.4 Lysophospholipid substrate specificity of LPCAT3. LPLAT activity was
measured using 50 μM oleoyl-CoA and 50 μM of lysoPC: 1-myristoyl (C14:0), 1palmitoyl (C16:0), 1-stearoyl (C18:0), 1-oleoyl (C18:1) and lysoPE 1-myristoyl (14:0),
lysoPS 1-oleoyl (18:1). The spectrophotometric method was used, as described in
Experimental procedures, with cell lysates prepared from LPCAT3 or GST infected Sf9
cells. The data represents mean ± S.E. n = 4.
129
A
LPCAT activity
(nmol/min/mg)
600
500
400
300
200
100
0
0
10
20
30 40 50 60
LysoPC (μM)
70
80
B
Hill Number = 1.8
Log (v/Vmax-v)
2
1
0
0
0.5
1
1.5
2
-1
-2
-3
Log (1-palmitoyl-lysoPC)
Figure 4.5 Kinetics of lysoPC utilization by LPCAT3. (A) LPCAT assays were
performed as described in Figure 4.2 except a range (5- 75 μM) of [1-14C] palmitoyl
lysoPC was used. The data represent the mean of the net LPCAT activity S.E. n = 4 (B)
Hill plot for the data in panel A.
130
Analysis of the velocity at varying concentrations of oleoyl-CoA by Hill plot
yielded a Hill number of 1.8 and apparent K0.5 of 12.5 μM for lysoPC. The enzyme
exhibited positive cooperative kinetics with respect to concentration of lysoPC. Therefore
sigmoidal curve was fitted to the data to obtain the apparent Vmax.
Next, we analyzed the acyl-CoA selectivity of LPCAT3 using [1-14C] palmitoyllysoPC as an acyl acceptor. Increasing concentrations of saturated (stearoyl-CoA),
monounsaturated (oleoyl-CoA), polyunsaturated, omega-6 (arachidonic acid), and
polyunsaturated, omega-3 (linolenoyl-CoA) acyl-CoAs were used (Figures 4.6, 4.7, 4.8
4.9). The sigmoidal curve was fitted to the data to obtain the apparent Vmax for each of
the acyl-CoAs (Table 4.1). The Michaelis Menten analysis of kinetic data gave higher
Vmax and Km values for acyl-CoAs. The data could not be analyzed for all the acyl-CoAs
by Lineweaver-Burk and Eadie Hofstee plots due to the lack of linear
relationship.Subsequent analysis of the kinetic data by Hill equation yielded a Hill
number and Km values. The Hill number for all the acyl-CoAs except linolenoyl-CoA
were greater than 1 therefore LPCAT3 shows positive cooperative kinetics with respect
to the varying concentration of acyl-CoAs (Table 4.1). Linolenoyl-CoA was the only
substrate for which concentrations higher than 110 μM did not inhibit activity and hence
a correct estimate of apparent Vmax and Km could not be obtained. According to the
apparent Km values of LPCAT3 for acyl-CoAs, stearoyl-CoA was the preferred acyl
donor (Table 4.1). Oleoyl-CoA was the most preferred substrate based on the capacity of
enzyme (Vmax).
131
A
LPCAT activity
(nmol/min/mg)
60
40
20
0
0
2
4
6
8 10 12 14 16 18 20 22
Stearoyl-CoA (μM)
B
Hill Number = 2.7
Log(v/Vmax-v)
2
1
0
0
0.4
0.8
1.2
1.6
-1
-2
Log (Stearoyl-CoA conc.)
Figure 4.6 Kinetics of Stearoyl-CoA (18:0-CoA) utilization by LPCAT3. (A) LPCAT
assays were performed as described except a range (2- 20 μM) of Stearoyl-CoA was
used. For each data point, net LPCAT activity was obtained by subtracting LPCAT
activity in Sf9-GST lysates from Sf9-LPCAT3 lysates. The data represent mean ± S.E. n
= 4. (B) Hill plot for the data in panel A
132
A
LPCAT activity
(nmol/min/mg)
800
600
400
200
0
0
20
40
60
80
Oleoyl-CoA (μM)
100
120
B
Hill Number = 2
1
Log (v/Vmax-v)
0
0
0.5
1
1.5
2
-1
-2
-3
Log (Oleoyl-CoA conc.)
Figure 4.7 Kinetics of Oleoyl-CoA (18:1-CoA) utilization by LPCAT3. (A) LPCAT assays
were performed as described except a range (5- 110 μM) of oleoyl-CoA was used. For
each data point, net LPCAT activity was obtained by subtracting LPCAT activity in Sf9GST lysates from Sf9-LPCAT3 lysates. The data represent mean ± S.E. n = 4. (B) Hill
plot for the data in panel A
133
A
LPCAT activity
(nmol/min/mg)
C
600
400
200
0
0
20
40
60
80 100
Arachidonoyl-CoA (μM)
120
140
B
Hill Number = 2
2
Log (v/Vmax-v)
1
0
0
0.5
1
1.5
2
-1
-2
-3
-4
Log ( Arachidonoyl-CoA conc.)
Figure 4.8 Kinetics of Arachidonoyl-CoA (20:4-CoA) utilization by LPCAT3. (A) LPCAT
assays were performed as described except a range (10-130 μM) of arachidonoyl-CoA
was used. For each data point, net LPCAT activity was obtained by subtracting LPCAT
activity in Sf9-GST lysates from Sf9-LPCAT3 lysates. The data represent mean ± S.E. n
= 4. (B) Hill plot for the data in panel A
134
A
LPCAT activity
(nmol/min/mg)
160
120
80
40
0
0
20
40
60
80
100 120 140 160
Linolenoyl-CoA (μM)
B
Hill Number = 1
2
Log(v/Vmax-v)
1
0
0
1
2
3
4
-1
-2
-3
Log (Linolenoyl-CoA conc.)
Figure 4.9 Kinetics of Linolenoyl-CoA (18:3-CoA) utilization by LPCAT3. (A) LPCAT
assays were performed as described except a range (20-150 μM) of arachidonoyl-CoA
was used. For each data point, net LPCAT activity was obtained by subtracting LPCAT
activity in Sf9-GST lysates from Sf9-LPCAT3 lysates. The data represent mean ± S.E. n
= 4. (B) Hill plot for the data in panel A
135
Table 4.1 Kinetic parameters of human LPCAT3. Kinetic data from figures 4.6-4.9
were used to calculate apparent Km and Vmax using Michaelis Menten analysis and Hill
equation.
Lyso-PC
Stearoyl-CoA
(18:0)
Oleoyl-CoA
(18:1)
ArachidonylCoA (20:4)
α-linolenyl- CoA
(18:3)
Hill Plot Analysis
Km
Vmax
(μM)
(nmol/min/m
g)
13
486
Michaelis Menten Analysis
Vmax
Vmax / Km Km
(nmol/min/mg)
(min-1 mg-1) (μM)
44
1010
5.1
50
9.8
19
117
46.5
759
16.3
419
3600
55.8
529
9.5
334
1794
214.1
268
1.3
338
354
136
The ratio of Vmax/Km or the efficiency of enzyme (assuming enzyme concentration is
constant for all reactions) can be used to find out which substrate an enzyme is likely to
turn into product faster. This value was the highest for oleoyl-CoA.
Effect of expressing LPCAT3 on phospholipid species in Sf9 cells
This was performed in collaboration with Dr. Brian Cummings, Department of
Pharmaceutical and Biomedical Sciences, University of Georgia, Athens, GA. To begin
to examine the physiological role of LPCAT3 in phospholipid metabolism, the effect of
expressing LPCAT3 on the phospholipid profile in Sf9 cells was measured. We
hypothesized that if LPCAT3 preferentially incorporates unsaturated acyl-chains into
phospholipids then the cells expressing LPCAT3 will show abundance of unsaturated
aycl chains in phsopholipids in comparison to the cells expressing GST. ESI-MS was
performed on four independent cell lysates expressing LPCAT3 and GST (Figure 4.10).
To account for alteration in ionization efficiency, the relative abundance of each PL
species was expressed relative to the most abundant species (34:1 PC; m/z 760) within
the sample. Normalizing to an added standard (28:0 PC, m/z 678) was also performed and
showed similar trends (data not shown).
After analyzing the abundance of 73 different m/z ratios in the positive mode, 10
showed a significant difference between the LPCAT3 and GST expressing cells.
Assigning specific PL species to m/z values was based on their calculated theoretical
monoisotopic masses and verified by MS-MS.
137
Relative Phospholipid Abundance
.
1.0
0.8
0.6
0.4
0.2
0.0
30:0 32:0 36:0 34:2 36:1 36:2 32:0 32:0 34:1 34:2
PE
ePC
PC
Figure 4.10 Effect of LPCAT3 expression on Sf9 phospholipid species. Lipids were isolated
from Sf9 cells expressing GST or LPCAT3. After lipid phosphorous content
determination, 250 nmol was analyzed by ESI-MS as described in Experimental
Procedures. The results from 4 independent Sf9 infections were averaged. The
abundance of each PL species is expressed relative to that of the most abundant within
the sample (34:1 PC in each case). Of the 73 m/z values analyzed, all the ones that
significantly differed (p<0.05) are shown. ePC = ether PC.
138
The five species that increased with LPCAT3 expression were 32:0 PE, 32:0 PC,
36:0 PC, 32:0 (1-alkyl) PC, and 34:1 (1-alkyl) PC. The five species that decreased were
30:0 PC, 34:2 PC, 36:1 PC, 36:2 PC, and 34:2 (1-alkyl) PC (Fig. 4.10) became less
abundant. One thing to note is that when normalized to the added standard, 34:1 PC was
about 30% more abundant in the LPCAT3 expressing cells. The overall trend was that the
abundance of PC with more saturated chains increased with LPCAT3 expression while
PC with more unsaturated chains. No differences between LPCAT3 and GST expressing
cells were detected in the negative mode, suggesting that PI and PS species were
unaffected.
Tissue distribution of human LPCAT3
The expression pattern of LPCAT3 in human tissues was obtained from GNF
SymAtlas and GeneNote, databases of human genes and their expression profiles in
healthy human tissues. According to the GNF SymAtlas, LPCAT3 was expressed in all
the 79 tissues and cell types. LPCAT3 was expression was 7-10 folds higher in
adipocytes and bone marrow endothelial cells (CD34+, CD71+, or CD105+) when
compared to most other tissues. Modest expression of LPCAT3 (3 fold over the basal)
was seen in placenta and prostrate. The GeneNote microarray data found no differences
in LPCAT3 expression in 12 tissues including bone marrow but not adipose tissue.
139
4.5. Discussion
In this study, we identified and characterized a human LPCAT3. hLPCAT3 was
identified by its sequence similarity to previously characterized Lpt1, a lysophospholipid
acyltransferase in S.cerevisiae (Benghezal 2007; Jain 2007; Riekhof 2007; Tamaki 2007).
Our findings suggest that the LPCAT3 encodes for a protein that catalyzes the LPCAT
reaction. Firstly, the cDNA of human LPCAT3 when overexpressed in insect cells confers
a 10-fold increase in incorporation of radioactive [1-14C] lysoPC in PC over the
endogenous activity. Secondly, the activity was specific for lysophosphatidylcholine.
Other acyl acceptors lysoPA, lysoPI, lysoPG, lysoPAF were not used as substrates. The
enzyme could use lysoPE and lysoPS as acyl acceptors, but the activity was eight fold
less than that for lysoPC suggesting its specificity for lysoPC. However, this preference
for acyl acceptors is limited to only one fixed concentration (50μM) of lysophospholipids
used in the assay. These findings reaffirm that the hLPCAT3 cDNA encodes for a protein
with LPCAT activity. We realize LPCAT3 has been designated in literature as
MBOAT5/C3F and changes in enzyme nomenclature make the integration with previous
reports troublesome. However, the consistent approach of incorporating the reaction
catalyzed in any protein’s name provides clarity.
LPCAT3 does not share sequence homology to previously identified LPCAT1 and
LPCAT2 genes (Nakanishi 2006; Shindou 2007). It is a member of the MBOAT super
family, which includes enzymes responsible for transfer of fatty acids to their substrates
(Hofmann 2000). There are 16 proteins that belong to this super family (MBOAT1 and
MBOAT2, each has 2 isoforms and Porcupine gives rise to 4 isoforms by alternative
splicing) and a conserved histidine residue is thought to be the catalytic site (Figure 4.11).
140
Figure 4.11 Dendogram showing members of human MBOAT family
141
Acyl-CoA cholesterol acyltransferases (ACAT1 and ACAT2) that esterify
cholesterol and diacylglycerol acyltransferase-1 (DGAT1) which utilizes diacylglycerol
are the only members whose biochemical role has been established (Cases 1998).
LPCAT3 encoded protein is 20% identical to MBOAT1 and MBOAT2 proteins.
MBOAT1 and MBOAT2 are overall 52% identical. The disruption of MBOAT1 is
associated with brachydactyly-syndactyly syndrome (Dauwerse 2007). The protein
encoded by Drosophila homolog of LPCAT3 known as nessy, is 32% identical to the
human counterpart and is regulated by homeotic (HOX) proteins during embryogenesis.
HOX proteins are found in wide variety of organisms including Drosophila, mouse, and
humans and are known to regulate morphognetic processes (Zaffran 1999). It is possible
that LPCAT3 is a target of human HOX proteins and thus has a regulatory role in
developmental processes.
MBOAT3, MBOAT4, Porcupine and Leng4 share 15% amino acid sequence
similarity with LPCAT3. MBOAT3, shares sequence similarity to mammalian hedgehog
acyltransferase (HHAT) but does not show in vitro HHAT activity (Abe 2007).
Porcupine has been associated with processing and secretion of Wnt signaling proteins
(Tanaka 2000; Caricasole 2002). Besides these studies very little information exists about
the biochemical role of by these orthologs.
LPT1, the yeast homolog of LPCAT3, encodes for LPLAT activity and utilizes all
major lysophospholipids. It is possible that each human homolog utilizes specific
lysophospholipid species as substrate and is tissue specific in expression. Recently
LENG4 encoded protein was shown to have lysophophotidylinositol acyltransferase
142
(LPIAT) activity (Lee 2007). In the assay conditions used in this study, LPCAT3 showed
robust activity with lysoPC. A comparison of LPCAT3 affinities for lysoPC and acylCoAs with that of identified LPCAT1 and LPCAT2 will give us an idea about the likely
contribution of each LPCAT at varying substrate concentrations.
LPCAT1 has lower apparent Km for lysoPC in comparison to LPCAT3 (2.3 μM
vs. 13.1 μM).
Inspite of LPCAT3 having a higher Vmax than LPCAT1, both the
enzymes seem to saturate with lysoPC at concentrations between 25-35 μM. The kinetic
paramters of LPCAT2 are not known. Regarding acyl chain specificity it is expected that
LPCATs would preferentially introduce unsaturated acyl groups in the sn-2 position of
phospholipids to maintain asymmetrical distribution of acyl chains in phsopholipids.
However, LPCAT1 utilizes wide variety of acyl donors at a single concentration of 25
μM (Nakanishi 2006). LPCAT2 has lower apparent Km for arachidonoyl-CoA in
comparison to acetyl-CoA (21.1 Μm vs 50.4 μM) (Shindou 2007). Whether or not
LPCAT2 utilizes acyl-CoAs other than arachidonoyl-CoA and acetyl-CoA is not known.
LPCAT3 showed lower apparent Km for stearoyl-CoA but higher capacity for
oleoyl-CoA. At concentrations ≤ 5 μM stearoyl-CoA was a better substrate for LPCAT3
than oleoyl-CoA. However, LPCAT3 showed highest catalytic efficiency for oleoyl-CoA
among all acyl-CoAs. The enzyme showed similar affinity for arachidonoyl-CoA and
oleoyl-CoA but lesser capacity. LPCAT3 showed higher apparent Km for arachidonoylCoA compared to LPCAT2 (55.8 μM vs. 21.1 μM). Depending on physiological
concentrations of arachidonoyl-CoA, LPCAT3 might be responsible for enrichment of
this acyl group in the sn-2 position of phosphatidylcholine. Previous studies have shown
that lysoPC in rat liver microsomes is acylated in vitro preferentially by oleoyl CoA (4-
143
fold higher) in comparison to the stearoyl-CoA at 15μM (Lands 1963). It is not known
whether LPCAT3 is responsible for the LPCAT activity reported in liver. The enzyme
activity seems to be not only affected by the presence of a double bond but also by the
position of the double bond. Linolenoyl CoA, a n-3 fatty acyl CoA was utilized at higher
concentrations compared to other acyl donors and showed activity even at concentrations
beyond 150 µM at which the LPCAT activity declined for oleoyl and arachidonoyl CoA.
Thus the kinetic parameters for linolenoyl CoA could not be accurately measured. The
enzyme did not seem to show robust activity with linolenoyl CoA in comparison to n-9 or
n-6 fatty acyl CoA. Perhaps, the position of the double bond hinders in the effective
formation of enzyme substrate complex. The ability of the enzyme to discern between the
substrates with different position of double bonds might spare linolenic acid as precursor
to docosahexaenoic acid and eicosapentaenoic acid. Interestingly, endogenous LPCAT
activity in Sf-9 cells had low Km for all the acyl donors. Calcium independent PLA2 has
been reported in the Sf-9 cells (Yeh 1997) however, lysophospholipid acyltransferase
activity has not been characterized. Identification of this LPCAT activity in insect cells
will be the subject of future studies.
The physiological role of LPCAT3 mediated activity in the maintenance of acyl
chain composition of phospholipids can only be speculated by its expression pattern in
various tissues. LPCAT3 is highly expressed in adipose tissue and endothelial cells of
bone marrow (CD34+, CD71+, or CD105+). In adipocytes, LPCAT3 might be involved in
regulation of the acyl chain composition of the adipocyte membrane phospholipids which
in turn might regulate the properties of adipocyte membranes.
144
The binding property of insulin receptor has been shown to be affected by the acyl
group composition of surrounding phospholipids in membrane (Gould 1982). Adipocytes
from rats fed on diet rich in polyunsaturated fats bound more insulin than the cells from
animals fed diets rich in saturated fats (Field 1988). It is possible that LPCAT3 mediated
changes in acyl chain composition of membrane phospholipids in adipocytes has a role in
modulating the insulin sensitivity. In addition, LPCAT3 introduced arachidonic acid in
lysoPC when released by PLA2 might prime the formation of eicosanoids in adipocytes.
Arachidonic acid derived eicosanoids PGF2α and PGJ2 have been shown to act as
ligands for peroxisome proliferator-activated receptor gamma, a nuclear receptor that
plays an important role in adipocyte differentiation (Reginato 1998). Recently, mouse
lysocardiolipin acyltransferase (LyCAT) a member of AGPAT gene family, part of
cardiolipin remodeling pathway, was shown to be required for hematopoietic and
endothelial cell development in mouse embryonic stem cells. High LyCAT mRNA levels
were detected in CD31+ and CD45- endothelial cells in adult mouse bone marrow.
Overexpression of LyCAT in mouse stem cells increased hematopoietic and endothelial
gene expression while siRNA mediated knock down of the gene showed an opposite
effect (Wang 2007). The substrates modified by LyCAT that might have mediated this
effect were not described. Whether LPCAT3 has similar role in bone marrow endothelial
cells is not known. Lysophosphatidylcholine has been shown to be proinflammatory in
nature and has been shown to be a ligand for G-protein- coupled receptors expressed in
endothelial cells. The lysophospholipid G-protein-coupled receptors regulate a variety of
cellular functions: cell proliferation and survival, migration and chemotaxis, cytoskeletal
architecture, cell-cell-contacts and adhesion, Ca2+ homoeostasis and Ca2+-dependent
145
functions (Meyer 2007). It would be interesting to study whether LPCAT3 has any role in
regulating the levels of ligands for GPCRs. To understand the physiological function of
LPCAT3, the abundance of phospholipid species was analyzed in Sf-9 cells expressing
LPCAT3. Increased levels of disaturated PC (32:0 and 34:0) and decreased levels of
unsaturated acyl chains in PC (34:2, 36:1, 36:2) was seen. To account for this change in
acyl chain composition of phospholipids, the endogenous saturated acyl-CoA
concentrations in Sf-9 cells proposed to be ≤ 5 μM for preferential incorporation of
saturated acyl groups in phosphatidylcholine by LPCAT3. It needs to be established
whether similar effect are seen by in vitro or in vivo studies in mammalian system.
Finally, the identification of human LPCAT3 will enable us to investigate whether other
human MBOAT protein acylate lysophospholipids and help us understand the role of this
family in phospholipid remodeling.
146
CHAPTER 5: SUMMARY
Triglyceride (TG) molecules allow storage of surplus energy in form of fatty acyl
chains that are esterified to glycerol molecule. The TG synthetic pathway shares
substrates (acyl-CoA and glycerol 3-phosphate) and initial steps with phospholipid
synthesis (Kennedy 1961). The de novo glycerolipid synthetic pathway begins with
acylation of glycerol-3-phosphate at the sn-1 and sn-2 position in the first two steps to
form first lysophosphatidic acid (1-acyl glycerol 3-phosphate) and then phosphatidic acid
(PA) (Figure 1.1).Glycerol 3-phosphate acyltransferase (GPAT) and 1-acyl glycerol-3phosphate (AGPAT) catalyze the first and second reaction respectively. Phosphatidic
acid can be either dephosphorylated by phosphatidic acid phosphatase (PAP) to form
diacylglycerol (DG) or used as precursor for phospholipid synthesis. The DG formed
from this reaction is esterified with a third acyl-CoA at the sn-3 position to form TG. This
terminal reaction is unique to TG synthesis and is mediated by diacylglycerol
acyltransferase (DGAT). Alternatively, DG can be used by CDP-choline pathway to
synthesize phosphatidylethanolamine (PE) and phosphatidylcholine (PC) (Kennedy
1961).
Cells must maintain a balance between TG and phospholipid synthesis to allow
for energy storage as well as cell growth. Regulation at the branch point of TG and
phospholipid synthesis seems likely. Hence we hypothesized that that the rate of TG
synthesis is regulated at the step of DG esterification and that the DG esterifying enzymes
147
are regulated. Another hypothesis was that cells unable to esterify DG to TG will increase
glycogen synthesis as an alternative to store energy.
To understand the intracellular regulation of TG synthesis at the step of
diacylglycerol esterification we used Saccharomyces cerevisiae as our model system.
Yeast cells synthesize TG and phospholipids by pathways largely homologous to those in
mammalian cells (Rajakumari 2008). In yeast the DG esterifying enzymes have been
completely characterized. Dga1 (a homologue of mammalian DGAT2), and Lro1 (a
homologue of mammalian lecithin cholesterol acyltransferase) contribute to 98% of TG
synthesis, and the residual activity is contributed by Are2 (a homologue of mammalian
DGAT1) (Oelkers 2002). To address our hypothesis we first identified genetic
backgrounds and growth conditions where TG synthesis was altered. Next step was to
determine whether in these conditions, changes in the mRNA, protein or activity levels of
Dga1 and Lro1 were responsible for altering TG synthesis. We also measured glycogen
levels in TG deficient yeast cells to examine any evidence of coordinated regulation of
energy stores.
Among the genetic backgrounds which were examined, disabling fatty acid
hydrolysis was found to increase TG synthesis by 75%. Addition of inositol and choline,
water soluble phospholipid precursors to growth media is known to affect the activity of
phospholipid synthetic enzymes (McCammon 1982) mainly though the presence of
upstream activating sequence known as inositol and choline responsive element (ICRE)
or UASINO (Carman 1999). Although ICRE motifs are not found upstream of DGA1 and
LRO1, genes encoding for DG esterifying enzymes in yeast (Saccharomyces Genome
Database) we hypothesized that perturbations in phospholipid synthetic pathway would
148
affect TG synthesis as these pathways share initial steps and have common intermdiates
of glycerolipid synthesis. However addition of inositol and choline did not affect TG
synthesis. Absence of glycogen synthesis did not stimulate storage of energy in TG and
vice versa. This result established TG and glycogen synthesis are not coordinately
regulated in the growth conditions utilized. Glycogen levels in wild type yeast have been
shown to increase 8 fold in response to poor nitrogen media (Francois 2001). It would be
interesting to see whether yeast cells unable to store glycogen in nitrogen poor media
upregulate their TG synthesis.
Variability in the measurement of mRNA and protein levels of the DG esterifying
enzymes did not allow us to examine the changes at transcriptional or translational level.
In vitro microsomal DGAT assays were performed and Dga1 mediated DGAT activity
showed cooperative kinetics with varying concentrations of oleoyl-CoA. Results from
studies on permeabilized rat hepatocytes in the presence of saturating amounts of glycerol
3-phosphate and DG suggest that the rate of TG synthesis might be determined by acylCoA supply and the affinity of DGAT for acyl-CoA (Stals 1994). Perhaps positive
cooperativity with oleoyl-CoA can amplify the response of the enzyme to the substrate.
At a fixed concentration of 50μM oleoyl-CoA and palmitoyl-CoA are preferred substrates
for Dga1 (Oelkers 2002).
To address the possibility of allosteric regulation of DG esterifying enzymes in
vitro microsomal DGAT activity assays were performed in the presence of metabolites
indicative of cellular energy status, ATP, ADP, AMP, NAD, NADH, acetyl-CoA and
malonyl-CoA. No changes in the kinetic parameters of Dga1 were seen by addition of
these metabolites. We further addressed the question whether the regulation of TG
149
synthesis occurs at the level of phosphatidic acid (PA), another branch point in the TG
and phospholipid synthetic pathway. Another possibility at the time was whether AGPAT
which catalyzes the synthesis of PA by introducing acyl chain at sn-2 position might
determine asymmetrical distribution of acyl groups (saturated at sn-1 and unsaturated at
sn-2 position) in phospholipids.
Slc1 was the only known AGPAT in yeast when we began our study. The fact that
slc1∆ deletion mutants retained ~ 50% of the total microsomal AGPAT activity indicated
the presence of another AGPAT (Athenstaedt 1997). Since synthesis of phosphatidic acid
is an essential requirement for de novo synthesis of phospholipids we hypothesized that
absence of SLC1 in conjunction with the novel AGPAT gene in a haploid cell would be
lethal. A synthetic lethality screen was performed by crossing a slc1∆ strain with each of
~ 5000 viable single deletion haploids in collaboration with Charlie Boone, University of
Toronto. Synthetic lethality screen identified LPT1 (YOR175c), a member of membranebound-O-acyltransferase (MBOAT) super family. LPT1 does not share sequence
similarity with SLC1. The lpt1∆ cell lysates did not show significant decrease in vitro
AGPAT activity, possibly due to up regulation of SLC1 activity.
Since the depletion of Lpt1 did not affect the AGPAT activity, we further studied
whether the overexpression of Lpt1 would influence AGPAT activity. Overexpression of
LPT1 led to 7-fold increase in AGPAT activity suggesting that Lpt1 can mediate this
reaction.
Subsequent experiments showed that Lpt1 can mediate lysophospholipid
acyltransferase (LPLAT) reaction by the introduction of acyl chains in the sn-2 position
of lysophospholipids. In lpt1∆ yeast cells there was a complete loss of LPLAT activity
suggesting that Lpt1 is the major LPLAT in yeast (Jain 2007). The acyl chain selectivity
150
studies on Lpt1 showed high capacity for unsaturated species but low affinity for
saturated species. LPLAT is the reacylation arm of Lands cycle, which involves acyl
chain remodeling of de novo synthesized phospholipids at the sn-2 position by
phospholipase A2 mediated deacylation followed by reacylation. This phospholipid
remodeling is believed to result in positional distribution of saturated acyl groups in sn-1
and unsaturated acyl groups in sn-2 position (Lands 1960). In yeast, LysoPC
acyltransferase activity was reported but the enzyme-gene relationship was not
established (Yamada 1977; Richard 1998). In lpt1∆ yeast cells there is 30% reduction in
incorporation of [3H] oleate in phosphatidylcholine (PC) presumably due to lack of
LPLAT activity in yeast. We established that Lpt1 is the novel LPLAT/AGPAT in yeast
which might be responsible for selective incorporation of acyl chains in sn-2 position of
lysophospholipids (Jain 2007). LPT1 does not share sequence similarity with lysoPC
acyltransferase-1 (LPCAT1) and lysoPC acyltransferase-2 (LPCAT2) the only LPCATs
which have been characterized so far and is a member of MBOAT family which is
conserved across species (Figure 5.1).The amino acid sequence of LPT1 encoded protein
is 25% identical to human MBOAT1, MBOAT2 and MBOAT5 proteins (Figure 5.2).To
determine whether MBOAT5 possessed LPLAT activity similar to Lpt1 we expressed
human MBOAT5 in Sf-9 cells. Cell lysates prepared from insect cells expressing human
MBOAT5 showed 10-fold higher [14C] lysoPC incorporation in PC with oleoyl-CoA over
the GST-expressing controls. Further experiments showed that MBOAT5 preferentially
utilized lysoPC compared to other lysophospholipid species suggesting that it is a
LPCAT. We therefore renamed MBOAT5 as LPCAT3. MBOAT5 similar to Lpt1 shows
more activity with unsaturated acyl-CoAs but has low affinity for saturated acyl-CoA.
151
Figure 5.1 Evolutionary dendogram showing homologs of Lpt1 in other eukaryotes
152
Figure 5.2 Dendogram showing Lpt1 homologs in human MBOAT family
153
There are 16 human MBOAT proteins of which only 3 have been characterized.
These characterized proteins include cholesterol acyltransferases (ACAT1 and ACAT2)
and DGAT1. While our study was in progress, MBOAT7 was characterized as a
lysophosphatidylinositol acyltransferase (Lee 2007). Perhaps each human MBOAT
protein specifically esterifies a lysophospholipid species unlike Lpt1 in yeast which has
broad substrate specificity. To elucidate the physiological role of LPCAT3, the
abundance of phospholipid species was analyzed in Sf-9 cells expressing LPCAT3. There
was an increase in PC species with saturated acyl chains and decrease in unsaturated PC
species in cells expressing LPCAT3. Although it needs to be established whether similar
effect are seen by in vitro or in vivo studies in mammalian system this finding does
suggest that LPCAT3 might be responsible for asymmetric distribution of acyl groups in
phosphatidylcholine in tissues where it is highly expressed (adipose and endothelial
cells).
Significance of the findings:
1. A new genetic background (pox1∆) in which TG synthesis is altered was
identified.The kinetic paramters (Km and Vmax) of Dga1, the DG esterifying
enzyme in S.cerevisiae were determined and it was shown that the enzyme
displays cooperative kinetics for oleoyl-CoA. The enzyme activity was not
regulated by AMP, ADP, ATP, NAD+, NADH, acetyl-CoA and malonyl-CoA, the
levels of which are sensitive to energy status of cell. No coordinated regulation in
triglyceride synthesis and glycogen synthesis was seen in energy rich conditions.
154
2. A novel AGPAT/ LPLAT, distinct from the known AGPAT or LPCAT families
was identified in Saccharomyces cerevisiae. Molecular characterization of the
novel AGPAT has completed the characterization of almost all of the enzymes in
the triglyceride synthetic pathway.
3. Human LPCAT3, a member of MBOAT family was identified by its sequence
similarity to LPT1. Other members of MBOAT family (MBOAT1 and MBOAT2)
that share sequence similarity to MBOAT5 will be the subject of future studies.
4. Identification of novel lysophospholipid acyltransferases will enable us to
understand the role of these acyltransferases in remodeling of acyl chains in
phospholipids and their physiologicsl role in the tissues where they are highly
expressed.
155
LIST OF REFERENCES
Abe, Y., Kita,Y., Niikura,T. (2007). "Mammalian GUP1, a homolog of Saccharomyces
cerevisiae glycerol uptake/ transporter 1, acts as a negative regulator for Nterminal palmitoylation of Sonic hedgehog." FEBS J. Dec.13(E published).
Adams, A., Gottschling, D.E., Kaiser, C., Stearns, T. (1997). "Methods in Yeast
Genetics: A Laboratory Course Manual, A Cold Spring Harbor Laboratory
Course Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Agarwal, A. K., Arioglu, E., De Almeida, S., Akkoc, N., Taylor, S.I., Bowcock, A.M.,
Barnes, R.I., Garg, A. (2002). "AGPAT2 is mutated in congenital generalized
lipodystrophy linked to chromosome 9q34." Nat Genet 1: 21-3.
Agarwal, A. K., Sukumaran, S., Bartz, R., Barnes, R.I., Garg, A. (2007). "Functional
characterization of human 1-acylglycerol-3-phosphate-O-acyltransferase isoform
9: cloning, tissue distribution, gene structure, and enzymatic activity." J
Endocrinol. 193(3): 445-457.
Aguado, B., Campbell, R.D. (1998). "Characterization of a human lysophosphatidic acid
acyltransferase that is encoded by a gene located in the class III region of the
human major histocompatibility complex." J Biol Chem. 273(7): 4096-105.
Albers, J. J., Cabana, V.G., Dee Barden, S. Y. (1976). "Purification and characterization
of human plasma lecithin:cholesterol acyltransferase." Biochemistry 15(5): 10847.
Alvarez, H. M., Steinbuchel,A. (2002). "Triacylglycerols in prokaryotic
microorganisms." Appl.Microbiol.Biotechnol. 60: 367-376.
Arthur, G., Choy, P.C. (1984). "Acyl specificity of hamster heart CDP-choline 1,2diacylglycerol phosphocholine transferase in phosphatidylcholine biosynthesis."
Biochim Biophys Acta 795(2): 221-9.
Athenstaedt, K., Daum,G. (1997). "Biosynthesis of phosphatidic acid in lipid particles
and endoplasmic reticulum of Saccharomyces cerevisiae." J Bacteriol 179: 76117616.
Atkinson, D. E., Hathway, J.A., Smith, E.C. (1965). "Kinetics of regulatory enzymes." J
Biol Chem 240(6): 2682-90.
156
Ausubel, F. M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.,
Struhl, K. (1998). "Current protocols in molecular biology." John Wiley & Sons,
New York.
Baker, R. R., Thompson, W. (1973). "Selective acylation of 1acylglycerophosphorylinositol by rat brain microsomes. Comparison with 1acylglycerophosphorylcholine." J Biol Chem. 248(20): 7060-5.
Balsinde, J., Pérez, R., Balboa, M.A. (2006). "Calcium-independent phospholipase A2
and apoptosis." Biochim Biophys Acta 1761(11): 1344-50.
Benghezal, M., Roubaty, C., Veepuri, V., Knudsen, J., Conzelmann, A. (2007). "SLC1
and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3phosphate O-acyltransferases of budding yeast." J Biol Chem 282(42): 30845-55.
Betz, A., Moore, C. (1967). "Fluctuating metabolite levels in yeast cells and extracts, and
the control of phosphofructokinase activity in vitro." Arch Biochem Biophys.
120(2): 268-273.
Bligh, E. G., Dyer, W.J. (1959). "A rapid method of total lipid extraction and
purification." Can J Biochem Physiol 37(8): 911-7.
Boumann, H. A., Damen, M.J., Versluis, C., Heck, A.J., de Kruijff, B., de Kroon, A.I.
(2003). "The two biosynthetic routes leading to phosphatidylcholine in yeast
produce different sets of molecular species. Evidence for lipid remodeling."
Biochemistry 42(10): 3054-9.
Brindley, D. N. (2004). "Lipid phosphate phosphatases and related proteins: Signaling
functions in development, cell division, and cancer." J.Cell.Biochem 92: 900-912.
Burr, O. G., Burr,M.M. (1929). "A new deficiency disease produced by the rigid
exclusion of fat from the diet." Journal of Biological Chemistry 82(2): 345-67.
Byers, S. D., Laroche, A., Smith, K.C., Weselake, R.J. (1999). "Factors enhancing
diacylglycerol acyltransferase activity in microsomes from cell-suspension
cultures of oilseed rape." Lipids 34(11): 1143-9.
Cao, J., Cheng, L., Shi, Y. (2007). "Catalytic properties of MGAT3, a putative
triacylgycerol synthase." J Lipid Res 48(3): 583-91.
Cao, J., Li, J.L., Li, D., Tobin, J.F., Gimeno, R.E. (2006). "Molecular identification of
microsomal acyl-CoA:glycerol-3-phosphate acyltransferase, a key enzyme in de
novo triacylglycerol synthesis." Proc Natl Acad Sci U S A. 103(52): 19695-700.
Caricasole, A., Ferraro,T., Rimland,J.M., Terstapen,G.C. (2002). "Molecular cloning and
initial characterization of the MG61/PORC gene, the human homologue of the
Drosophila segment polarity gene Porcupine." Gene 288: 147-157.
157
Carman, G. M. (1997). "Phosphatidate phosphatases and diacylglycerol pyrophosphate
phosphatases in Saccharomyces cerevisiae and Escherichia coli." Biochim
Biophys Acta 1348(1-2): 45-55.
Carman, G. M., Han, G.S. (2006). "Roles of phosphatidate phosphatase enzymes in lipid
metabolism." TRENDS Biochem Sci 31(12): 694-99.
Carman, G. M., Henry, S.A. (1989). "Phospholipid biosynthesis in yeast." Annu Rev
Biochem 58: 635-669.
Carman, G. M., Henry, S.A. (1999). "Phospholipid biosynthesis in the yeast
Saccharomyces cerevisiae and interrelationship with other metabolic processes."
Prog. Lipid Res. 38(361-399).
Cascales, C., Mangiapane, E.H., Brindley, D.N. (1984). "Oleic acid promotes the
activation and translocation of phosphatidate phosphohydrolase from the cytosol
to particulate fractions of isolated rat hepatocytes." Biochem J 219(3): 911-6.
Cases, S., Smith, S.J., Zheng, Y.W., Myers, H.M., Lear, S.R., Sande, E., Novak, S.,
Collins, C., Welch, C.B., Lusis, A.J., Erickson, S.K., Farese, R.V. (1998).
"Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a
key enzyme in triacylglycerol synthesis." Proc Natl Acad Sci U S A. 95(22):
13018-23.
Cases, S., Stone, S.J., Zhou, P., Yen, E., Tow, B., Lardizabal, K.D., Voelker, T., Farese,
R.V Jr. (2001). "Cloning of DGAT2, a second mammalian diacylglycerol
acyltransferase, and related family members." J Biol Chem 276(42): 38870-6.
Chen, X., Hyatt, B.A., Mucenski, M.L., Mason, R.J., Shannon, J.M. (2006).
"Identification and characterization of a lysophosphatidylcholine acyltransferase
in alveolar type II cells." Proc Natl Acad Sci U S A. 103(31): 11724-9.
Chen, Y., Kuo, M.S., Li, S., Bui, H.H., Peake, D.A., Sanders, P.E., Thibodeaux ,S.J.,
Chu, S., Qian, Y.W., Zhao, Y., Bredt, D.S., Moller, D.E., Konrad, R.J., Beigneux,
A.P., Young, S.G., Cao, G. (2008). "AGPAT6 Is a novel microsomal glycerol-3phosphate acyltransferase (GPAT)." J Biol Chem Jan 31 [Epub ahead of print].
Cheng, D., Meegalla, R.L., He, B., Cromley, D.A., Billheimer, J.T., Young, P.R. (2001).
"Human acyl-CoA:diacylglycerol acyltransferase is a tetrameric protein."
Biochem J. 359(3): 707-14.
Coleman, J. (1990). "Characterization of Escherichia coli cells deficient in 1-acyl-snglycerol-3-phosphate acyltransferase activity." J Biol Chem 265(28): 1721517221.
158
Coleman, R. A., Lee,D.P. (2004). "Enzymes of triacylglycerol synthesis and regulation."
Progress in Lipid Research 43: 134-176.
Cooper, T. C., Benedict, C.R. (1966). "The participation of acetyl-CoA in pyruvate
carboxylase." Biochemicam and Biophysical Research Communications 22(3):
285-290.
Corinne Maurel-Zaffran1, S. C., Nicolas Jullien, Raymond Miassod, Jacques Pradel and
Denise Aragnol (1999). "nessy, an evolutionary conserved gene controlled by
Hox proteins during Drosophila embryogenesis." Mechanisms of Development
86(1-2): 159-163.
Cronan, J. E., Gelmann, E.P. (1975). "Physical properties of membrane lipids: Biological
relevance and regulation." Bacteriology Reviews 39(3): 232-256.
Dauwerse, J. G., de Vries,BBA., Wouters, C.H., Bakker,E., Rappold,G., Mortier,G.R.,
Breuning,M.H., Peters, D.JM. (2007). "A t(4;6)(q12;p23) translocation disrupts a
membrane-associated O-acetyl transferase gene (MBOAT1) in a patient with a
novel brachydactyly-syndactyly syndrome." Eur J Hum Genet 15(7): 743-751.
de Kroon, A. I. (2007). "Metabolism of phosphatidylcholine and its implications for lipid
acyl chain composition in Saccharomyces cerevisiae." Biochim Biophys Acta.
1771(3): 343-52.
de Vries, Y., Arvidson, D.N., Waterham, H.R., Cregg, J.M., Woldegiorgis, G. (1997).
"Functional characterization of mitochondrial carnitine palmitoyltransferases I
and II expressed in the yeast Pichia pastoris." Biochemistry 36(17): 5285-92.
Dickson, R. C. (2008). "Thematic Review Series: Sphingolipids. New insights into
sphingolipid metabolism and function in budding yeast." J Lipid Res 49(5): 90921.
Donkor, J., Sariahmetoglu,M., Dewald,J.,Brindley,D,N., Reue,K. (2007). "Three
mammalian lipins act as phosphatidate phosphatases with distinct tissue
expression patterns." J Biol Chem 282(6): 3450-3457.
Drecktrah, D., Chambers, K., Racoosin, E.L., Cluett ,E.B., Gucwa, A., Jackson, B.,
Brown, W.J. (2003). "Inhibition of a Golgi complex lysophospholipid
acyltransferase induces membrane tubule formation and retrograde trafficking."
Mol Biol Cell 14(8): 3459-69.
Dyer, J. M., Chapital, D.C., Kuan, J.W., Mullen, R.T., Pepperman, A.B. (2002).
"Metabolic engineering of Saccharomyces cerevisiae for production of novel lipid
compounds." Appl Microbiol Biotechnol. 59(2-3): 224-30.
159
Eberhardt, C., Gray, P.W., Tjoelker, L.W (1997). "Human lysophosphatidic acid
acyltransferase. cDNA cloning, expression, and localization to chromosome
9q34.3." J Biol Chem 272(32): 20299-305.
Ericsson, J., Jackson, S.M., Kim, J.B., Spiegelman,B.M., Edwards,P.A. (1997).
"Identification of glycerol-3-phosphate acyltransferase as an adipocyte
determination and differentiation factor-1 and sterol regulatory element binding
responsive gene." J Biol Chem 272: 7298-305.
Faergemann, N. J., Black, N.P., Zhao, D.X., Knudsen, J., DiRusso, C.C. (2001). "The
Acyl-CoA synthetases encoded within FAA1 and FAA4 in Saccharomyces
cerevisiae function as components of the fatty acid transport system linking
import, activation, and intracellular Utilization." J Biol Chem 276(40): 37051-9.
Field, C. J., Ryan, E.A., Thomson, A.B., Clandinin, M.T. (1988). "Dietary fat and the
diabetic state alter insulin binding and the fatty acyl composition of the adipocyte
plasma membrane." Biochem J 253(12): 417-424.
François, J., Parrou, J.L. (2001). "Reserve carbohydrates metabolism in the yeast
Saccharomyces cerevisiae." FEMS Microbiol Rev. 25(1): 125-45.
Funk, C. D. (2001). "Prostaglandins and Leukotrienes: Advances in Eicosanoid Biology."
Science 294(5548): 1871-75.
Gale, S. E., Frolov, A., Han, X., Bickel, P.E., Cao, L., Bowcock, A., Schaffer, J.E., Ory,
D.S (2006). "A regulatory role for 1-acylglycerol-3-phosphate-O-acyltransferase
2 in adipocyte differentiation." J Biol Chem 281(16): 11082-9.
Ganji, S. H., Tavintharan, S., Zhu, D., Xing, Y., Kamanna, V.S., Kashyap, M.L. (2004).
"Niacin noncompetitively inhibits DGAT2 but not DGAT1 activity in HepG2
cells." J Lipid Res 45(10): 1835-45.
Ghosh, A. K., Ramakrishnan, G., Rajasekharan, R. (2008). "YLR099C (ICT1) encodes a
soluble Acyl-CoA-dependent lysophosphatidic acid acyltransferase responsible
for enhanced phospholipid synthesis on organic solvent stress in Saccharomyces
cerevisiae." J Biol Chem 283(15): 9768-75.
Gould, R. J., Ginsberg, B.H., Spector, A.A. (1982). "Lipid effects on the binding
properties of a reconstituted insulin receptor." J Biol Chem 257(1): 477-484.
Haagsman, H. P., de Haas, C.G., Geelen, M.J., van Golde, L.M. (1982). "Regulation of
triacylglycerol synthesis in the liver. Modulation of diacylglycerol acyltransferase
activity in vitro." J Biol Chem 257(18): 10593-8.
160
Han, G. S., Wu, W.I., Carman, G.M. (2006). "The Saccharomyces cerevisiae Lipin
homolog is a Mg2+-dependent phosphatidate phosphatase enzyme." J Biol Chem
281(14): 9210-8.
Han, M. S., Park,S .Y., Koei, S., Kim S., Chung, K.W.,Lee, J.H.,Kwon, C.H., Lee, K.W.,
Lee, H., Park, C.K., Chung, W.J., Hwang, J.S.,Yan, J., Song, K.D., Tsujimoto,
Y., Lee,M. (2008). "Lysophosphatidylcholine as a death effector in the
lipoapoptosis of hepatocytes." J.Lipid Res. 49: 84-97.
Hanahan, D. J., Brockerhoff, H., Barron, E.J. (1960). "The site of attack of phospholipase
(lecithinase) A on lecithin: a re-evaluation. Position of fatty acids on lecithins and
triglycerides." J Biol Chem 235(1917-23).
Henry, S. A., Halvorson, H.O. (1973). "Lipid synthesis during sporulation of
Saccharomyces cerevisiae." J Bacteriol 114(3): 1158-63.
Hodges, E., Redelius, J.S., Wu, W., Höög, C. (2005). "Accelerated discovery of novel
protein function in cultured human cells." Mol Cell Proteomics 4(9): 1319-27.
Hofmann, K. (2000). "A superfamily of membrane-bound O-acyltransferases with
implications for wnt signaling." Trends Biochem Sci. 25(3): 111-2.
Hollenback, D., Bonham, L., Law, L., Rossnagle, E., Romero, L., Carew, H., Tompkins,
C.K., Leung, D.W., Singer, J.W., White, T. (2006). "Substrate specificity of
lysophosphatidic acid acyltransferase beta -- evidence from membrane and whole
cell assays." J Lipid Res. 47(3): 593-604.
Holub, J. (1980). "The biosynthesis of phosphatidylserines by acylation of 1-acyl-snglycero-3-phosphoserine in rat liver." Biochim Biophys Acta. 618(2): 255-62.
Homann, M. J., Henry, S.A., Carman, G.M. (1985). "Regulation of CDP-Diacylglycerol
synthase activity in Saccharomyces cerevisiae." J Bacteriol 163(3): 1265-1266.
Homann, M. J., Poole, M.A., Gaynor, P.M., Ho, C.T., Carman, G.M. (1987). "Effect of
growth phase on phospholipid biosynthesis in Saccharomyces cerevisiae." J
Bacteriol 169(2): 533-9.
Hosaka, K., Yamashita, S. (1984). "Regulatory role of phosphatidate phosphatase in
triacylglycerol synthesis of Saccharomyces cerevisiae." Biochim Biophys Acta
796(1): 110-7.
Huh, W. K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman, J.S.,
O'Shea, E.K. (2003). "Global analysis of protein localization in budding yeast."
Nature 425(6959): 686-91.
161
Illingworth, R. F., Rose, A.H., Beckett, A. (1973). "Changes in the lipid composition and
fine structure of Saccharomyces cerevisiae during ascus formation." J Bacteriol
113(1): 373-86.
Ingram, S. W., Barnes, L.D. (2000). "Disruption and overexpression of the
Schizosaccharomyces pombe aph1 gene and the effects on intracellular
diadenosine 5',5'''-P1, P4-tetraphosphate (Ap4A), ATP and ADP concentrations."
Biochem J. 350(3): 663-9.
Ito, H., Fukuda, Y., Murata, K.,Kimura, A. (1983). "Transformation of intact yeast cells
treated with alkali cations." J. Bacteriol. 153(1): 163-168.
Jackson, S. K., Parton, J. (2004). "Lysophospholipid acyltransferases in monocyte
inflammatory responses and sepsis." Immunobiology 209(1-2): 31-8.
Jain, S., Stanford, N., Bhagwat, N., Seiler, B., Costanzo, M., Boone, C., Oelkers, P.
(2007). "Identification of a novel lysophospholipid acyltransferase in
Saccharomyces cerevisiae." J Biol Chem 282(42): 30562-9.
Jeannet, A. F. (2004). "Fat storage in pancreas and in insulin -sensitive tissues in
pathogenesis of type 2 diabetes." International Journal of Obesity 28: S35-S57.
Kay, H. (2000). "A superfamily of membrane-bound O-acyltransferases with
implications for Wnt signaling." TIBS 25.
Kelley, M. J., Bailis, A.M., Henry, S., Carman, G.M. (1988). "Regulation of phospholipid
biosynthesis in Saccharomyces cerevisiae by inositol." J Biol Chem 263(34):
18078-18085.
Kennedy, E. P. (1961). "Biosynthesis of complex lipids." Fed Proc. 20: 934-40.
Kougias, P., Chai,H., Lin,H.P., Lumsden,B.A., Yao,Q., Chen,C. (2006).
"Lysophosphatidylcholine and secretory phospholipase A2 in vascular disease:
Mediators of endothelial dysfunction and atherosclerosis." Med.Sci.Monit. 12(1):
RA5-16.
Krebs, H. A. (1967). "The redox state of nicotinamide adenine dinucleotide in the
cytoplasm and mitochondria of rat liver." Adv Enzyme Regul 5(409-434).
Krey, G., Braissant,O., L'Horset,F., Kalkhoven,E., Perroud,M., Parker,M.G., Wahli,W.
(1997). "Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands
of peroxisome proliferator-activated receptors by coactivator-dependent receptor
ligand assay." Molecular Endocrinology 11(6): 779-791.
162
Krogh, A., Larsoon, B., von Heijne, G., Sonhammer, E.L. (2001). "Predicting
transmembrane protein topology with a hidden Markov model: application to
complete genomes." J Mol Biol. 305(3): 567-80.
Labarga, A., Valentin, F., Anderson, M., Lopez, R. (2007). "Web services at the
European bioinformatics institute." Nucleic Acids Res 35 (Web Server Issue):
W6-11.
Lands, W. E. (1958). "Metabolism of glycerolipides; a comparison of lecithin and
triglyceride synthesis." J Biol Chem 231(2): 883-8.
Lands, W. E. (1960). "Metabolism of glycerolipids. 2. The enzymatic acylation of
lysolecithin." J Biol Chem 235(2233-7).
Lands, W. E., Merkl, I. (1963). "Metabolism of glycerolipids. III. Reactivity of various
acyl esters of coenzyme A with alpha'-acylglycerophosphorylcholine, and
positional specificities in lecithin synthesis." J Biol Chem 238(898-904).
Lau, T. E., Rodriguez, M.A. (1996). "A protein tyrosine kinase associated with the ATPdependent inactivation of adipose diacylglycerol acyltransferase." Lipids 31(3):
277-83.
Leber, R., Zinser, E., Paltauf,F., Daum, G., Zellnig,G. (1994). "Characterization of lipid
particles of the yeast, Saccharomyces cerevisiae Yeast." Yeast 10(11): 1421-1428.
Lee, H. C., Inoue T, Imae R, Kono N, Shirae S, Matsuda S, Gengyo-Ando K, Mitani S,
Arai H. ( 2007). "Caenorhabditis elegans mboa-7, a Member of the MBOAT
Family, Is Required for Selective Incorporation of Polyunsaturated Fatty Acids
into Phosphatidylinositol." Mol Biol Cell Dec.19 (E published ahead of print).
Lehner, R., Kuksis,A. (1996). "Biosynthesis of triacylglycerols." Prog. Lipid Res. 35(2):
169-201.
Leung, D. W. (2001). "The structure and functions of human lysophosphatidic acid
acyltransferases." Front Biosci 6: D944-53.
Lewin, T. M., Granger, D.A., Kim, J.H., Coleman, R.A. (2001). "Regulation of
mitochondrial sn-glycerol-3-phosphate acyltransferase activity: response to
feeding status is unique in various rat tissues and is discordant with protein
expression." Arch Biochem Biophys 396(1): 119-27.
Lillie, S. H., Pringle, J.R. (1980). "Reserve carbohydrate metabolism in Saccharomyces
cerevisiae: responses to nutrient limitation." J Bacteriol 143(3): 1384-94.
163
Lin, S., Ford,E., Haigis, M., Liszt,G., Guarente, L. (2004). "Calorie restriction extends
yeast life span by lowering the level of NADH." Genes and Development 18: 1216.
Linden, D., Olsson, L.W., Rhedin,M., Asztely,A.K., Clapham, J.C., Schreyer,S. (2004).
"Overexpression of mitochondrial GPAT in rat hepatocytes leads to decreased
fatty acid oxidation and increased glycerolipid biosynthesis." J. Lipid Res 45(7):
1279-88.
Lu, B., Jiang, Y.J., Man, M.Q., Brown, B., Elias, P.M., Feingold, K.R. (2005).
"Expression and regulation of 1-acyl-sn-glycerol- 3-phosphate acyltransferases in
the epidermis." J Lipid Res 46(11): 2448-57.
Lu, B., Jiang, Y.J., Zhou, Y., Xu, F.Y., Hatch, G.M., Choy, P.C. (2005). "Cloning and
characterization of murine 1-acyl-sn-glycerol 3-phosphate acyltransferases and
their regulation by PPARalpha in murine heart." Biochem J 385(2): 469-477.
MacDonald, J. I., Sprecher, H. (1991). "Phospholipid fatty acid remodeling in
mammalian cells." Biochim Biophys Acta. 1084(2): 105-21.
Mahoney, E. M., Scott,W.A., Landsberger,F.R., Hamill,A.L., Cohn,Z.A. (1980).
"Influence of fatty acyl substitution on the composition and function of
macrophage membranes." J Biol Chem 255(10): 4910-7.
Manmontri, B., Sariahmetoglu, M., Donkor, J., Bou Khalil, M., Sundaram, M., Yao, Z.,
Reue, K., Lehner, R., Brindley, D.N. (2008). "Glucocorticoids and cAMP
selectively increase hepatic lipin-1 expression and insulin acts antagonistically." J
Lipid Res Feb 15 [Epub ahead of print].
Maurel-Zaffran, C., Chauvet, S., Jullien, N., Miassod, R., Pradel, J., Aragnol, D. (1999).
"nessy, an evolutionary conserved gene controlled by Hox proteins during
Drosophila embryogenesis." Mech Dev 86(1-2): 159-63.
Mavis, R. D., Vagelos, R.P. (1972). "The effect of phospholipid fatty acid composition
on membranous enzymes in Escherichia coli." J Biol Chem 247(3): 652-659.
Mayorek, N., Grinstein, I., Bar-tana, J. (1989). "Triacylglycerol synthesis in cultured rat
hepatocytes; The rate limiting role of diacylglycerol acyltransferase." Eur J.
Biochem 182: 395-400.
McCammon, M. T., Parks, L.W. (1982). "Lipid synthesis in inositol-starved
Saccharomyces cerevisiae." Biochim Biophys Acta 713(1): 86-93.
McCormick, K., Francesco, V.J., Sriwatanakul, K. (1983). "Inhibition by acetyl-CoA of
hepatic carnitine acyltransferase and fatty acid oxidation." Biochem.J. 216: 499502.
164
Meegalla, R. L., Billheimer, J.T., Cheng, D. (2002). "Concerted elevation of acylcoenzyme A:diacylglycerol acyltransferase (DGAT) activity through independent
stimulation of mRNA expression of DGAT1 and DGAT2 by carbohydrate and
insulin." Biochem Biophys Res Commun 298(3): 317-23.
Meisinger, C., Sommer, T., Pfanner, N. (2000). "Purification of Saccharomcyes
cerevisiae mitochondria devoid of microsomal and cytosolic contaminations."
Anal Biochem 287(2): 339-42.
Meyer, z. H. D., Jakobs, K.H. (2007). "Lysophospholipid receptors: signalling,
pharmacology and regulation by lysophospholipid metabolism." Biochim.
Biophys. Acta 1768(4): 923-940.
Millar, J. S., Stone, S.J., Tietge, U.J., Tow, B., Billheimer, J.T., Wong, J.S., Hamilton,
R.L., Farese, R.V. Jr., Rader, D.J. (2006). "Short-term overexpression of DGAT1
or DGAT2 increases hepatic triglyceride but not VLDL triglyceride or apoB
production." J Lipid Res 47(10): 2297-305.
Minskoff, S. A., Racenis,P.V., Granger,J., Larkins,L., Hajra,A.K., Greenberg,M.L.
(1994). "Regulation of phosphatidic acid biosynthetic enzymes in Saccharomyces
cerevisiae." J Lipid Res 35(12): 2254-62.
Mishra, R., Simonson,M.S. (2005). "Saturated fatty acids and apoptosis in microvascular
mesangial cells:palmitate activates proapoptotic signaling involving caspase 9 and
mitochondrial release of endonuclease G." Cardiovascular Diabetology 4(2).
Monetti, M., Levin, M.C., Watt, M.J., Sajan, M.P., Marmor, S., Hubbard, B.K., Stevens,
R.D., Bain, J.R., Newgard, C.B., Farese, R.V Sr., Hevener, A.L., Farese, R.V. Jr.
(2007). "Dissociation of hepatic steatosis and insulin resistance in mice
overexpressing DGAT in the liver." Cell Metab 6(1): 69-78.
Murph, M., Tanaka, T., Pang, J.,Felix, E., Lieu, S., Trost, R., Godwin, A.K., Newman,
R., Mills, G. (2007). "Liquid Chromatograpy mass spectrometry for quantifying
plasma lysophospholipids:potential biomarkers for cancer diagnosis." Methods
Enzymol 433: 1-25.
Nagiec, M. M., Wells, G.B., Lester, R.L., Dickson, R.C. (1993). "A suppressor gene that
enables Saccharomyces cerevisiae to grow without making sphingolipids encodes
a protein that resembles an Escherichia coli fatty acyltransferase." J Biol Chem
268(29): 22156-22163.
Nagle, C. A., Vergnes, L., Dejong, H., Wang, S., Lewin, T.M., Reue, K., Coleman, R.A.
(2008). "Identification of a novel sn-glycerol-3-phosphate acyltransferase
isoform, GPAT4 as the enzyme deficient in Agpat6-/- mice." J Lipid Res Jan 11
[Epub ahead of print].
165
Nakanishi, H., Shindou, H., Hishikawa, D., Harayama, T., Ogasawara, R., Suwabe, A.,
Taguchi, R., Shimizu, T. (2006). "Cloning and characterization of mouse lungtype acyl-CoA:lysophosphatidylcholine acyltransferase 1 (LPCAT1). Expression
in alveolar type II cells and possible involvement in surfactant production." J Biol
Chem 281(29): 20140-7.
Niederhiser, D. H., Harmon,C.K. (1978). "Lipid metabolism by the gall bladder: The in
vitro conversion of lysophosphatidylcholine tophosphatidylcholine." Biochim.
Biophys. Acta 530: 217-226.
O'Hara, L., Han, G.S., Peak-Chew, S., Grimsey, N., Carman, G.M., Siniossoglou, S.
(2006). "Control of phospholipid synthesis by phosphorylation of the yeast lipin
Pah1p/Smp2p Mg2+-dependent phosphatidate phosphatase." J Biol Chem
281(45): 34537-48.
Oelkers, P., Behari, A., Cromley, D., Billheimer, J.T., Sturley, S.L. (1998).
"Characterization of two human genes encoding acyl coenzyme A:cholesterol
acyltransferase-related enzymes." J Biochem 273(41): 26765-71.
Oelkers, P., Cromley, D., Padamsee, M., Billheimer, J.T., Sturley, S.L. (2002). "The
DGA1 gene determines a second triglyceride synthetic pathway in yeast." J Biol
Chem 277(11): 8877-81.
Oelkers, P., Tinkelenberg, A., Erdeniz, N., Cromley, D., Billheimer, J.T., Sturley, S.L.
(2000). "A lecithin cholesterol acyltransferase-like gene mediates diacylglycerol
esterification in yeast." J Biol Chem 275(21): 15609-12.
Oh, C. S., Toke, D.A., Mandala, S., Martin, C.E. (1997). "ELO2 and ELO3, homologues
of the Saccharomyces cerevisiae ELO1 gene, function in fatty acid elongation and
are required for sphingolipid formation." J Biol Chem 272(28): 17376-84.
Ozier-Kalogeropoulos, O., Fasiolo,F., Adeline, M.T., Collin, J., Lacroute, F. (1991).
"Cloning, sequencing and characterization of the Saccharomyces cerevisiae
URA7 gene encoding CTP synthetase." Mol Gen Genet 231(1): 7-16.
Parrou, J. L., Francois,J. (1997). "A simplified procedure for a rapid and reliable assay of
both glycogen and trehalose in whole yeast cells." Analytical Biochemistry 248:
186-188.
Perrella, F. W. (1988). "EZ-FIT: a practical curve-fitting microcomputer program for the
analysis of enzyme kinetic data on IBM-PC compatible computers." Anal
Biochem 174(2): 437-47.
Péterfy, M., Phan, J., Xu, P., Reue, K. (2001). "Lipodystrophy in the fld mouse results
from mutation of a new gene encoding a nuclear protein, lipin." Nat Genet 27(1):
121-4.
166
Polakis, E. S., Bartley, W. (1966). "Changes in the intracellular concentrations of
adenosine phosphates and nicotinamide nucleotides during the aerobic growth
cycle of yeast on different carbon sources." Biochem J. 99(3): 521-533.
Quinn, M. T., Parthasarathy, S., and Steinberg, D. (1988). "Lysophosphatidylcholine: a
chemotactic factor for human monocytes and its potential role in atherogenesis."
Proc. Natl. Acad. Sci. U.S.A. 85: 2805–2809.
Racenis, P. V., Lai, J.L., Das, A.K., Mullick, P.C., Hajra, A.K., Greenberg, M.L. (1992).
"The acyl dihydroxyacetone phosphate pathway enzymes for glycerolipid
biosynthesis are present in the yeast Saccharomyces cerevisiae." J Bacteriol
174(17): 5702-5710.
Rajakumari, S., Grillitsch, K., Daum, G. (2008). "Synthesis and turnover of non-polar
lipids in yeast." Prog. Lipid Res. 47(3): 157-71.
Ramaiah, A., Hathaway, J.A., Atkinson, D.E. (1964). "Adenylate as a metabolic
regulator." J Biol Chem 239(11): 3619-3622.
Reginato, M. J., Krakow, S.L, Bailey, S.T., Lazar, M.A. (1998). "Prostaglandins promote
and block adipogenesis through opposing effects on peroxisome proliferatoractivated receptor gamma." J Biol Chem 273(4): 1855-8.
Reue, K., Zhang, P. (2008). "The lipin protein family: dual roles in lipid biosynthesis and
gene expression." FEBS Lett 582(1): 90-6.
Rhode, M., Lim, F., Wallace, J.C. (1986). "Pyruvate carboxylase from Saccharomyces
cerevisiae. Quaternary structure, effects of allosteric ligands and binding of
avidin." Eur J Biochem 156(1): 15-22.
Richard, M., G., McMaster, C.R. (1998). "Lysophosphatidylcholine acyltransferase
activity in Saccharomyces cerevisiae: regulation by a high-affinity Zn2+ binding
site." Lipids 33(12): 1229-34.
Riekhof, W. R., Voelker, D.R. (2006). "Uptake and utilization of lysophosphatidylethanolamine by Saccharomyces cerevisiae." J Biol Chem 281(48):
36588-96.
Riekhof, W. R., Wu, J., Jones, J.L., Voelker, D.R. (2007). "Identification and
characterization of the major lysophosphatidylethanolamine acyltransferase in
Saccharomyces cerevisiae." J Biol Chem 282(39): 28344-52.
Ritsuko Takada, Y. S., Tomoko Kurata, Naoto Ueno, Shigemi Norioka, Hisato Kondoh,
Toshifumi Takao , and Shinji Takada (2006). "Monounsaturated Fatty Acid
Modification of Wnt Protein: Its Role in Wnt Secretion." Developmental Cell
11(6): 791-801.
167
Rodriguez, M. A., Dias, C., Lau, T.E. (1992). "Reversible ATP-dependent inactivation of
adipose diacylglycerol acyltransferase." Lipids 27(8): 577-81.
Rothstein, R. (1991). "Targeting, disruption, replacement, and allele rescue: integrative
DNA transformation in yeast." Methods Enzymol 194: 281-301.
Ruan, H., Pownall, H.J. (2001). "Overexpression of 1-acyl-glycerol-3-phosphate
acyltransferase-alpha enhances lipid storage in cellular models of adipose tissue
and skeletal muscle." Diabetes 50(2): 233-40.
Rubin, R. P. (1983). "Acyltransferase-catalyzed transfer of arachidonic acid to
lysophospholipids in rat pancreatic acini." Biochem Biophys Res Commun
112(2): 502-7.
Ruderman NB, S. A., Vavvas D, Witters LA. (1999). "Malonyl-CoA, fuel sensing, and
insulin resistance." Am J Physiol 276(1): E1-E18.
Rustow, B., Kunze, D. (1985). "Diacylglycerol synthesized in vitro from sn-glycerol 3phosphate and the endogenous diacylglycerol are different substrate pools for the
biosynthesis of phosphatidylcholine in rat lung microsomes." Biochim Biophys
Acta 835: 273-278.
Sanjanwala, M., Sun, G.Y., MacQuarrie, R.A. (1989). "Purification and kinetic properties
of lysophosphatidylinositol acyltransferase from bovine heart muscle microsomes
and comparison with lysophosphatidylcholine acyltransferase." Arch Biochem
Biophys. 271(2): 407-13.
Schjerling CK, H. R., Hansen JK, Borsting C, Mikkelsen JM, Kristiansen K, Knudsen J.
(1996). "Disruption of the gene encoding the acyl-CoA-binding protein (ACB1)
perturbs acyl-CoA metabolism in Saccharomyces cerevisiae." J Biol Chem
271(37): 22514-21.
Schuldiner, M., Collins, S.R., Thompson, N.J., Denic, V., Bhamidipati, A., Punna, T.,
Ihmels, J., Andrews, B., Boone, C., Greenblatt, J.F., Weissman, J.S., Krogan, N.J.
(2005). "Exploration of the function and organization of the yeast early secretory
pathway through an epistatic miniarray profile." Cell 123(3): 507-19.
Sherman, F. (2002). "Getting started with yeast." Methods Enzymol 350: 3-41.
Shin, D. H., Paulauskis, J.D., Moustaïd, N., Sul, H.S. (1991). "Transcriptional regulation
of p90 with sequence homology to Escherichia coli glycerol-3-phosphate
acyltransferase." J Biol Chem 266(35): 23834-9.
168
Shindou, H., Hishikawa, D., Nakanishi, H., Harayama, T., Ishii, S., Taguchi, R., Shimizu,
T. (2007). "A single enzyme catalyzes both platelet-activating factor production
and membrane biogenesis of inflammatory cells. Cloning and characterization of
acetyl-CoA:LYSO-PAF acetyltransferase." J Biol Chem 282(9): 6532-9.
Spector, A. A., Yorek, M.A. (1985). "Membrane lipid composition and cellular function."
J.Lipid. Res. 26: 1015-1035.
Stals, H. K., Top, W., Declercq, P.E. (1994). "Regulation of triacylglycerol synthesis in
permeabilized rat hepatocytes. Role of fatty acid concentration and diacylglycerol
acyltransferase." FEBS Lett 343(1): 99-102.
Stamps, A. C., Elmore, M.A., Hill, M.E., Kelly, K., Makda, A.A., Finnen, M.J. (1997).
"A human cDNA sequence with homology to non-mammalian lysophosphatidic
acid acyltransferases." Biochem J 1(326): 455-461.
Stein, Y., Stein, O. (1966). "Metabolism of labeled lysolecithin, lysophosphatidyl
ethanolamine and lecithin in the rat." Biochim Biophys Acta 116(1): 95-107.
Stone, S. J., Myers, H.M., Watkins, S.M., Brown, B.E., Feingold, K.R., Elias, P.M.,
Farese, R.V. Jr (2004). "Lipopenia and skin barrier abnormalities in DGAT2deficient mice." J Biol Chem 279(12): 11767-76.
Subbaiah, P. V., Sastry, P.S., Ganguly, J. (1969). "Acylation of lysolecithin to lecithin by
a brush-border-free particular preparation from rat intestinal mucosa." Biochem J
113(2): 441-2.
Taguchi, R., Hayakawa, J., Takeuchi, Y., Ishida, M. (2000). "Two-dimensional analysis
of phospholipids by capillary liquid chromatography/electrospray ionization mass
spectrometry." J Mass Spectrom 35(8): 953-66.
Takahashi, M., Okazaki, H., Ogata, Y., Takeuchi, K., Ikeda, U., Shimada, K. (2002).
"Lysophosphatidylcholine induces apoptosis in human endothelial cells through a
p38-mitogen-activated protein kinase-dependent mechanism." Atherosclerosis
161(387-394).
Takeuchi, M., Harigai, M., Momohara, S., Ball, E., Abe, J., Furuichi, K., Kamatani, N.
(2007). "Cloning and characterization of DPPL1 and DPPL2, representatives of a
novel type of mammalian phosphatidate phosphatase." Gene 399(2): 174-80.
Tamaki H, S. A., Ito Y, Ohya M, Takase J, Miyashita M, Miyagawa H, Nozaki H,
Nakayama R, Kumagai H. (2007). "LPT1 encodes a membrane-bound Oacyltransferase involved in the acylation of lysophospholipids in the yeast
Saccharomyces cerevisiae." J Biol Chem 282(47): 34288-98.
169
Tamaki, H., Shimada, A., Ito, Y., Ohya, M., Takase, J., Miyashita, M., Miyagawa, H.,
Nozaki, H., Nakayama, R., Kumagai, H. (2007). "LPT1 encodes a membranebound O-acyltransferase involved in the acylation of lysophospholipids in the
yeast Saccharomyces cerevisiae." J Biol Chem 282(47): 34288-98.
Tanaka, K., Kitagawa, Y., Kadowaki, T. (2002). "Drosophila segment polarity gene
product porcupine stimulates the posttranslational N-glycosylation of wingless in
the endoplasmic reticulum." J Biol Chem 277(15): 12816-12823.
Tanaka, K., Okabayashi, K., Asashima, M., Perrimon, N., Kadowaki, T. (2000). "The
evolutionarily conserved porcupine gene family is involved in the processing of
the Wnt family." Eur J Biochem 267(13): 4300-4311.
Tansey, F. A., Frosolono,M.F. (1975). "Role of 1-acyl-2-lyso-phosphatidylcholine acyl
transferase in the biosynthesis of pulmonary phosphatidylcholine." Biochem
Biophys Res Commun 67(4): 1560-6.
Taylor, F. R., Parks, L.W. (1979). "Triaglycerol metabolism in Saccharomyces
cerevisiae. Relation to phospholipid synthesis." Biochim Biophys Acta 575(2):
204-14.
Testet, E., Laroche-Traineau, J., Noubhani, A., Coulon, D., Bunoust, O., Camougrand,
N., Manon, S., Lessire, R., Bessoule, J.J. (2005). "Ypr140wp, 'the yeast tafazzin',
displays a mitochondrial lysophosphatidylcholine (lyso-PC) acyltransferase
activity related to triacylglycerol and mitochondrial lipid synthesis." Biochem J
387(3): 617-26.
Thomas, B. J., Rothstein, R. (1989). "Elevated recombination rates in transcriptionally
active DNA." Cell(56): 619-630.
Thomas, B. J., Rothstein, R. (1989). "Elevated recombination rates in transcriptionally
active DNA." Cell 56(4): 619-30.
Tong, A. H., Evangelista, M., Parsons, A.B., Xu, H., Bader, G.D., Pagé, N., Robinson,
M., Raghibizadeh, S., Hogue, C.W., Bussey, H., Andrews, B., Tyers, M., Boone,
C. (2001). "Systematic genetic analysis with ordered arrays of yeast deletion
mutants." Science 294(5550): 2364-8.
Turkish, A. R., Henneberry AL, Cromley D, Padamsee M, Oelkers P, Bazzi H, Christiano
AM, Billheimer JT, Sturley SL. (2005). "Identification of two novel human acylCoA wax alcohol acyltransferases: members of the diacylglycerol acyltransferase
2 (DGAT2) gene superfamily." J Biol Chem 280(15): 14755-64.
Vance, J. E., Vance, D.E. (2004). "Phospholipid biosynthesis in mammalian cells."
Biochem. Cell Biol. 82: 113-128.
170
Vincent, M. J., Martin, A.S., Compans, R.W. (1998). "Function of the KKXX motif in
endoplasmic reticulum retrieval of a transmembrane protein depends on the length
and structure of the cytoplasmic domain." J Biol Chem 273(2): 950-6.
Wagner, S., Paltauf, F. (1994). "Generation of glycerophospholipid molecular species in
the yeast Saccharomyces cerevisiae. Fatty acid pattern of phospholipid classes
and selective acyl turnover at sn-1 and sn-2 positions." Yeast 10(11): 1429-37.
Walsh, M., Durocher, V., Rodriguez, A. (1989). "Reversible ATP-dependent inactivation
of glycerolphosphate acyltransferase from rat adipose tissue." Biochem Cell Biol
67(1): 48-52.
Walton, P. A., Possmayer, F. (1984). "The role of Mg2+-dependent phosphatidate
phosphohydrolase in pulmonary glycerolipid biosynthesis." Biochim Biophys
Acta 796(3): 364-72.
Wang, A., Dennis,A.E. (1999). "Mammalian lysophospholipases." Biochim. Biophys.
Acta 1439: 1-16.
Wang, C., Faloon, P.W., Tan, Z., Lv, Y., Zhang, P., Ge, Y., Deng, H., Xiong, J.W.
(2007). "Mouse lysocardiolipin acyltransferase controls the development of
hematopoietic and endothelial lineages during in vitro embryonic stem-cell
differentiation." Blood 110(10): 3601-9.
Wang, S., Lee, D.P., Gong, N., Schwerbrock, N.M., Mashek, D.G., Gonzalez-Baró,
M.R., Stapleton, C., Li, L.O., Lewin, T.M., Coleman, R.A. (2007). "Cloning and
functional characterization of a novel mitochondrial N-ethylmaleimide-sensitive
glycerol-3-phosphate acyltransferase (GPAT2)." Arch Biochem Biophys 465(2):
347-58.
Webster, G. R., Alpern, R.J. (1964). "Studies on the acylation of lysolecithin by rat
brain." Biochem J 90(1): 35-42.
Weltzien, H. U. (1979). "Cytolytic and membrane-perturbing properties of
lysophosphatidylcholine." Biochim. Biophys. Acta, 559: 259–287.
West, J., Tompkins, C.K., Balantac, N., Nudelman, E., Meengs, B., White, T., Bursten,
S., Coleman, J., Kumar, A., Singer, J.W., Leung, D.W. (1997). "Cloning and
expression of two human lysophosphatidic acid acyltransferase cDNAs that
enhance cytokine-induced signaling responses in cells." DNA Cell Biol 16(6):
691-701.
Woolfitt, A. R., Kellett, G.L., Hoggett, J.G. (1988). "The binding of glucose and
nucleotides to hexokinase from Saccharomyces cerevisiae." Biochim Biophys
Acta 952(2): 238-243.
171
Wu, W., Carman,G.M. (1994). "Regulation of phosphatidate phosphatase activity from
the yeast Saccharomyces cerevisiae by nucletoides." J Biol Chem 269(47): 2949529501.
Yamada, K., Okuyama, H., Endo, Y., Ikezawa, H. (1977). "Acyltransferase systems
involved in phospholipid metabolism in Saccharomyces cerevisiae." Arch
Biochem Biophys 183(1): 281-9.
Yamashita, A., Sugiura, T., Waku, K. (1997). "Acyltransferases and transacylases
involved in fatty acid remodeling of phospholipids and metabolism of bioactive
lipids in mammalian cells." J Biochem 122(1): 1-16.
Yamashita, S., Hosaka, K., Miki, Y., Numa, S. (1981). "Glycerolipid acyltransferases
from rat liver: 1-acylglycerophosphate acyltransferase, 1acylglycerophosphorylcholine acyltransferase, and diacylglycerol
acyltransferase." Methods in enzymology 71(C): 528-536.
Yeh, L. P., Bajpai,R.K., Sun,G.Y. (1997). "Membrane lipid metabolism and
phospholipase activity in Spodoptera frugiperda 9 ovarian cells." Lipids 32(5):
481-487.
Yen, C. L., Farese, R.V Jr. (2003). "MGAT2, a monoacylglycerol acyltransferase
expressed in the small intestine." J Biol Chem 278(20): 18532-7.
Yen, C. L., Stone, S.J., Cases, S, Zhou, P., Farese, R.V. (2002). "Identification of a gene
encoding MGAT1, a monoacylglycerol acyltransferase." Proc Natl Acad Sci U S
A 99(13): 8512-7.
Yu, Y. H., Zhang, Y., Oelkers, P., Sturley, S.L., Rader DJ, Ginsberg HN. (2002).
"Posttranscriptional control of the expression and function of diacylglycerol
acyltransferase-1 in mouse adipocytes." J Biol Chem 277(52): 50876-84.
Zaremberg, V., McMaster, C.R. (2002). "Differential partitioning of lipids metabolized
by separate yeast glycerol-3-phosphate acyltransferases reveals that
phospholipase D generation of phosphatidic acid mediates sensitivity to cholinecontaining lysolipids and drugs." J Biol Chem 277(41): 39035-44.
Zheng, Z., Zou, J. (2001). "The initial step of the glycerolipid pathway: identification of
glycerol 3-phosphate/dihydroxyacetone phosphate dual substrate acyltransferases
in Saccharomyces cerevisiae." J Biol Chem 276(45): 41710-6.
Zhou, X., Arthur, G. (1992). "Improved procedures for the determination of lipid
phosphorus by malachite green." J Lipid Res 33(8): 1233-6.
172
Zou, J., Katavic, V., Giblin, E.M., Barton, D.L., MacKenzie, LS., Keller, W.A., Hu, Xu.,
Taylor, D.C. (1997). "Modification of seed oil content and acyl composition in
the brassicaceae by expression of a yeast sn-2 acyltransferase gene." Plant Cell
9(6): 909-23.
173
APPENDIX 1: GENERAL STRUCTURE OF GLYCEROLIPIDS
1. Glycerol
2. Fatty acids
Palmitate (16:0)
1
CH3 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 C
O
-
O
Oleate (18:1)
10
9
1 OCH3 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH CH CH2 CH2 CH2 CH2 CH2 CH2 CH2 C
O
Linoleate (18:2)
12
10
9
1 OCH3 CH2 CH2 CH2 CH2 CH CH CH2 CH CH CH2 CH2 CH2 CH2 CH2 CH2 CH2 C
O
Arachidonate (20:4)
14
11
8
5
1
CH3 CH2 CH2 CH2 CH2 CH CH CH2 CH CH CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 C
O
O
3. Monoacylglycerol
4. Diacylglycerol
5. Triacylglycerol or Triglyceride
-
174
6. Phosphatidylcholine
7. Phosphatidylethanolamine
8. Phosphatidylserine
9. Phosphatidylinositol
10. Phosphatidylglycerol
175
11. Cardiolipin
12. Platelet Activating Factor
176
APPENDIX 2: MISCELLANEOUS EXPERIMENTS
1. Effect of pox1∆, tgl3∆tgl4∆tgl5∆ on glycogen levels
Rationale: The pox1∆ shows 75% more incorporation of [3H] oleate in triglyceride
(TG) compared to the normal strain. The tgl3∆tgl4∆tgl5∆ was also chosen because
Tgl3, Tgl4 and Tgl5 are TG lipases hence absence of the lipases leads to
accumulation of TG in yeast cell. Cells store energy in form of TG and glycogen and
if there is coordinated regulation between these two energy reserves the glycogen
synthesis will be down regulated when TG accumulates in yeast cell.
1
7
Glycogen (mg/10 cells)
1.2
0.8
0.6
0.4
0.2
0
1.4
2
2.6
O.D. 660 nm
3
3.6
Normal
tgl3tgl4tgl5
pox1
Figure A1. Glycogen levels in pox1, tgl3∆tgl4∆tgl5∆ yeast strains.
Yeast strains were grown in YPD to an O.D.660 of 1.4 to 3.6. The cells
were lysed, boiled, treated with amyloglucosidase and glucose oxidase in
order to determine the amount of glycogen present. n=1
177
Result: Although the expected trend was seen in pox1∆ strain at O.D. 2.6-3.6 but
glycogen levels remain unchanged in tgl3∆tgl4∆tgl5∆ yeast strain for most part of the
growth curve. At O.D. 3.6 20% increase in triple deletion was seen which was contrary to
what we hypothesized. The experiment was not pursued due to ade2 mutation in pox1∆
strain which caused the strain to grow faster in comparison to other yeast strains.
2. Effect of cerulenin, fatty acid synthase inhibitor on glycogen levels
Rationale: Cerulenin specifically inhibits fatty acid synthesis in yeast. This would
decrease TG synthesis and would increase glycogen synthesis in case these energy
reserves are coordinately regulated.
Glycogen (mg/10 7 cells)
1.4
1.2
1
0.8
0.6
0.4
0.2
0
With Cerulenin
0 hr
0.5 hr
1 hr.
3 hrs.
Without Cerulenin
Figure A2. Effect of cerulenin on glycogen levels in wild type yeast strain Yeast
strains were grown in YPD to log phase. The cells were lysed, boiled, treated with
amyloglucosidase and glucose oxidase in order to determine the amount of glycogen
present. n=1
178
Experimental Set up: Wild type strain was grown to O.D. 3.6. 40 ml of the culture was
split into 8 tubes with 5 ml in each tube. 5μl of cerulenin was added to 4 tubes. The cells
were harvested at 0 hour, 0.5 hour, 1 hour and 3 hours after the addition of cerulenin. In
parallel cells were harvested from culture without cerulenin.
Result: No difference in glycogen levels were seen in wild type yeast strain treated with
cerulenin in comparison to untreated yeast strain.
3. Effect of inositol and choline on TG synthesis at different growth phases
Rationale: Addition of water soluble phospholipid precursors (inositol and choline or
both) would affect phospholipid synthetic enzymes (reviewed in chapter 1) and hence
[3H]oleate incorporation in TG
(% of total lipids)
TG synthesis.
40
30
20
10
0
0.6
1.6
O.D. 660 nm
3
Control
75 micromolar Inositol
1mM Choline
Inositol and Choline
Figure A3. Effect of inositol and choline on TG synthesis in wild type yeast
strain at different growth phases, n=1
Experimental Set up: Wild type yeast strain was grown to different growth
phases (O.D. 0.6 to 3) in synthetic complete media with 50µM inositol, 1 mM
choline or both to log phase and labeled with [3H] oleate.
179
Result: At O.D. 0.6 we have seen earlier that inositol alone or with choline shows
decrease in TG synthesis. However this result is not reproducible. At O.D. 1.6 the
addition of inositol or choline or both does not have a pronounced effect. At O.D.
3 the addition of inositol does not show any effect on TG synthesis while addition
of inositol and choline decreases TG synthesis. According to literature addition of
choline to inositol enhances its effects.
180