Download The putative phosphatase All1758 is necessary for normal growth

Microbiology (2012), 158, 380–389
DOI 10.1099/mic.0.054783-0
The putative phosphatase All1758 is necessary for
normal growth, cell size and synthesis of the minor
heterocyst-specific glycolipid in the
cyanobacterium Anabaena sp. strain PCC 7120
Sasa K. Tom and Sean M. Callahan
Correspondence
Sean M. Callahan
[email protected]
Received 16 September 2011
Revised 30 October 2011
Accepted 1 November 2011
Department of Microbiology, University of Hawaii, Honolulu, HI 96822, USA
The filamentous cyanobacterium Anabaena sp. strain PCC 7120 differentiates nitrogen-fixing
heterocysts arranged in a periodic pattern when deprived of a fixed source of nitrogen. In a
genetic screen for mutations that prevent diazotrophic growth, open reading frame all1758, which
encodes a putative serine/threonine phosphatase, was identified. Mutation of all1758 resulted in a
number of seemingly disparate phenotypes that included a delay in the morphological
differentiation of heterocysts, reduced cell size, and lethality under certain conditions. The mutant
was incapable of fixing nitrogen under either oxic or anoxic conditions, and lacked the minor
heterocyst-specific glycolipid. Pattern formation, as indicated by the timing and pattern of
expression from the promoters of hetR and patS fused transcriptionally to the gene for green
fluorescent protein (GFP), was unaffected by mutation of all1758, suggesting that its role in the
formation of heterocysts is limited to morphological differentiation. Transcription of all1758 was
constitutive with respect to both cell type and conditions of growth, but required a functional copy
of all1758. The reduced cell size of the all1758 mutant and the location of all1758 between the
cell division genes ftsX and ftsY may be indicative of a role for all1758 in cell division. Taken
together, these results suggest that the protein encoded by all1758 may represent a link between
cell growth, division and regulation of the morphological differentiation of heterocysts.
INTRODUCTION
Heterocysts are terminally differentiated, non-dividing cells
that allow the simultaneous execution of two incompatible
processes, fixation of nitrogen and oxygen-evolving photosynthesis, in some filamentous cyanobacteria. They
maintain a micro-oxic environment where oxygen-labile
nitrogenase can function. The envelope of heterocysts
includes a layer of distinct glycolipid that reduces the
diffusion of molecular oxygen into cells and an outer layer of
heterocyst-specific exopolysaccharides that protect the
integrity of the glycolipid layer, and increased respiration
reduces the level of molecular oxygen that does enter
heterocysts (Murry & Wolk, 1989). Fixed nitrogen from
heterocysts supports the growth of vegetative cells in the
filament, which in turn supply heterocysts with fixed carbon
(Meeks et al., 1978; Wolk, 1968). In the cyanobacterium
Anabaena sp. PCC 7120, under conditions that require
fixation of nitrogen for growth, heterocysts are arranged in a
periodic pattern at intervals of approximately 10 cells along
unbranched filaments (Wolk et al., 1994).
Abbreviations: HGL, heterocyst-specific glycolipid; ORF, open reading
frame; pNPP, 4-nitrophenol phosphate.
380
Activation of the heterocyst differentiation signalling
pathway in response to nitrogen limitation leads to an
accumulation of the metabolite 2-oxoglutarate in cells
(Laurent et al., 2005). Binding of 2-oxoglutarate stimulates
the DNA-binding activity of the global transcriptional
regulator of nitrogen and carbon metabolism in cyanobacteria, NtcA (Vázquez-Bermúdez et al., 2002). NtcA indirectly leads to upregulation of the master regulator of
heterocyst differentiation, hetR, which feeds back on the
regulation of transcription of ntcA (Muro-Pastor et al.,
2002) and, together with NtcA, directly or indirectly
activates genes involved in the patterning and morphogenesis of heterocysts (Olmedo-Verd et al., 2005). Induction of
differentiation, pattern formation and morphogenesis
involves the transcription of hundreds of genes specific for
the formation of heterocysts.
The reversibility of protein phosphorylation mediated by
kinases and phosphatases is an essential part of many
signalling cascades and regulatory networks. In Anabaena
sp., genes with homology to signalling components have
been reported to influence nitrogen metabolism and the
early regulatory stages of heterocyst development. NrrA,
which encodes a response regulator of the OmpR family,
acts early in the differentiation process by directly
Downloaded from www.microbiologyresearch.org by
054783 G 2012 SGM
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
Printed in Great Britain
all1758 and heterocyst development
upregulating hetR expression (Ehira & Ohmori, 2006). The
PP2C-type protein phosphatases PrpJ1 and PrpJ2 are also
involved in the initiation of heterocyst development
through mutual regulation of both ntcA and hetR (Jang
et al., 2009). The protein kinases Pkn41 and Pkn42, which
contain serine/threonine kinase and histidine kinase
domains, respectively, are cotranscribed specifically under
iron-deficient conditions and regulated by NtcA (Cheng
et al., 2006). The nitrogen regulatory protein PII encoded by
glnB is differentially modified in the two cell types. It goes
from a phosphorylated to a non-phosphorylated state during
transition from vegetative cell to heterocyst (Laurent et al.,
2004). The pknE gene lies 301 bp downstream from the
protein phosphatase 1/2A/2B homologue encoded by prpA.
Both pknE and prpA inactivation mutants produce aberrant
heterocysts (Zhang et al., 1998). Overexpression of the
putative Ser/Thr kinase encoded by pknE from its native
promoter inhibited heterocyst development, possibly
through inhibition of HetR (Saha & Golden, 2011).
Another protein that appears to affect HetR, PatA, contains
a phophoacceptor domain with homology to the response
regulator CheY, although a corresponding histidine kinase
has not been isolated. It appears to attenuate the negative
regulation of heterocyst differentiation by PatS and HetN
(Orozco et al., 2006), while promoting the activity, and
limiting the accumulation, of HetR (Risser & Callahan,
2008).
Protein phosphorylation has also been implicated in the
later stages of development, in particular during the
process of heterocyst maturation. Formation of the minor
heterocyst-specific glycolipid (HGL) involves two protein
kinases of the hstK family, Pkn30 and Pkn44, which
contain both an N-terminal serine/threonine kinase
domain and a C-terminal histidine kinase domain (Shi
et al., 2007). PrpJ1 has been shown to regulate the synthesis
of the major HGL (Jang et al., 2007). Alr0117 and HepK
(All4496) both encode putative two-component system
sensory histidine kinases that appear to be involved in the
induction of hepA, one of the genes responsible for
synthesis of the heterocyst polysaccharide layer (Ning &
Xu, 2004; Ramı́rez et al., 2005; Xu et al., 2003). The
manganese-dependent serine/threonine protein phosphatase of the PPP family DevT (Alr4674) accumulates in
mature heterocysts, is not regulated by NtcA and appears
to have a role in the later steps of heterocyst differentiation
(Espinosa et al., 2010). In this study, the isolation and
characterization of a gene encoding a putative PP2C-type
protein phosphatase, all1758, is described.
METHODS
Bacterial strains and growth conditions. Strains used in this study
are detailed in Table 1. Growth of Escherichia coli and Anabaena sp.
strain PCC 7120 and its derivatives; concentrations of antibiotics;
induction of heterocyst formation in BG-110 medium, which lacks a
combined-nitrogen source; regulation of PpetE expression; and
conditions for photomicroscopy were as previously described
(Risser & Callahan, 2007). Images were processed in Adobe
http://mic.sgmjournals.org
Photoshop CS2. To avoid complications from the vacuolization
phenotype observed with strains UHM183 and UHM184 upon
growth in BG-11 liquid medium, which contains a source of
combined nitrogen, these strains were transferred from solid BG-11
medium to liquid BG-110 medium for induction of heterocyst
differentiation. Plasmids were conjugated from E. coli into Anabaena
strains as described by Elhai & Wolk (1988).
Construction of plasmids. Plasmids used in this study are detailed
in Table 1 and oligonucleotides in Table 2. Constructs derived by PCR
were sequenced to verify the integrity of the sequence. Plasmid
pST112 was used to delete most of the coding region of all1758. An
852 bp region containing the first 30 bp of the all1758 coding region
and upstream DNA was amplified from the chromosome (with
primers 1758 up F and 1758 up R) and fused to an 848 bp region
containing the last 30 bp of the all1758 coding region and
downstream DNA (using primers 1758 down F and 1758 down R)
via overlap extension PCR. The 1700 bp fragment was cloned into
pRL277 as a BglII–SacI fragment using restriction sites introduced on
the primers to generate pST112.
Plasmid pST114 was used to replace most of the coding region of
all1758 with an V interposon. The 1700 bp fragment used for
construction of pST112 was moved into the EcoRV site of pBluescript
SK+ (Stratagene) to generate pST110. The 1700 bp fragment was
moved from pST110 into pRL278 as a BglII–SacI fragment to create
pST113. To generate pST114, the 2082 bp V interposon, which
confers resistance to spectinomycin and streptomycin (Fellay et al.,
1987), was introduced into pST113 at a SmaI site generated during
overlap extension PCR.
pST141 is a mobilizable shuttle vector containing the putative
promoter and coding regions of all1758. An 1866 bp fragment was
amplified from the chromosome (using primers Pall1758 BamHI F
and all1758 SacI R) and cloned into pAM504 as a BamHI–SacI
fragment using restriction sites engineered on the primers to generate
pST141.
The translational all1758–gfp reporter fusion under the control of
the all1758 promoter was created using primers Pall1758 BamHI F
and all1758 SmaI R to amplify the 1866 bp fragment from the
chromosome. The fragment was moved as a BamHI–SmaI fragment
into pSMC232, a replicating plasmid used to generate translational
fusions to gfp (Risser & Callahan, 2008), to give pST150.
To create the gfp transcriptional reporter for all1758, a 474 bp region
upstream of all1758 was amplified from the chromosome with
primers Pall1758 SacI F and all1758 15 bp up SmaI R and cloned into
pAM1956 as a SacI–SmaI fragment to create pST151. To create the gfp
transcriptional reporter for all1759, a 304 bp region upstream of
all1759 was amplified from the chromosome using primers Pall1759SacI-F and Pall1759-SmaI-R and moved into the EcoRV site of
pBluescript SK+ to generate pST252. The fragment was moved from
pST252 as a SacI–SmaI fragment into pAM1956 to create pST249.
Two plasmids carrying a PpetE–all1758 transcriptional fusion were
constructed. Plasmid pST156 is a mobilizable shuttle vector carrying a
transcriptional fusion between the petE promoter and all1758. The
1392 bp coding region of all1758 was amplified from the chromosome
using primers all1758 OE EcoRI F and all1758 OE BamHI R and ligated
into the EcoRV site of pBluescript SK+ to create pST184. The fragment
was moved from pST184 as an EcoRI–BamHI fragment into pKH256
(Higa & Callahan, 2010), which is designed to create transcriptional
fusions to the petE promoter, to generate pST156. Plasmid pST367
differs from pST156 in the engineered ribosome-binding site that was
introduced by using primer all1758 EcoRI rbs F in place of all1758 OE
EcoRI F to amplify all1758 from the chromosome. The PCR fragment
was moved into the EcoRV site of pBluescript SK+ to generate pST365,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
381
S. K. Tom and S. M. Callahan
Table 1. Strains and plasmids used in this study
Strain or plasmid
Anabaena sp.
PCC 7120
UHM103
UHM128
UHM183
UHM184
Plasmids
pAM504
pAM505
pAM1951
pAM1956
pDR138
pDR211
pDR320
pPROEX-1
pRL277
pRL278
pSMC127
pSMC148
pSMC188
pSMC232
pST112
pST114
pST141
pST150
pST151
pST156
pST188
pST249
pST367
pST368
Relevant characteristic(s)
Wild-type
DhetR
Dpbp6
Dall1758
Dall1758 with V cassette
Pasteur Culture Collection
Buikema & Haselkorn (2001)
Nayar et al. (2007)
This study
This study
Shuttle vector for replication in E. coli and Anabaena; Kmr Neor
Shuttle vector pAM504 with inverted multiple cloning site
pAM505 with PpatS–gfp
pAM505 bearing promoterless gfp for transcriptional fusions
pAM504 carrying PhetR–hetR
pAM504 carrying PpetE–patS
pAM504 carrying PpetE–hetN
Expression vector for generating polyhistidine epitope-tagged proteins; Apr
Suicide vector; Smr Spr
Suicide vector; Neor
pAM504 carrying PhetR–gfp
pPROEX-1 carrying hetR
pAM504 bearing Pnir for transcriptional fusions
pAM504 bearing promoterless gfp for translational fusions
Suicide plasmid used to delete all1758
Suicide plasmid used to replace all1758 with an V interposon
pAM504 carrying Pall1758–all1758
pSMC232 with Pall1758–all1758
pAM1956 with Pall1758 fused to gfp
pAM505 bearing PpetE–all1758
pPROEX-1 carrying all1758
pAM1956 with Pall1759 fused to gfp
pAM505 bearing PpetE–all1758
pAM504 bearing Pnir–all1758
Wei et al. (1994)
Wei et al. (1994)
Yoon & Golden (2001)
Yoon & Golden (2001)
Nayar et al. (2007)
Risser & Callahan (2009)
Risser & Callahan (2009)
Life Technologies
Black et al. (1993)
Black et al. (1993)
Callahan & Buikema (2001a)
Risser & Callahan (2008)
Risser & Callahan (2007)
Risser & Callahan (2008)
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
and subsequently moved from pST365 as an EcoRI–BamHI fragment
into pKH256 to generate pST367.
The pPROEX-1 (Life Technologies) derivative, pST188, was used to
overexpress all1758 in E. coli and facilitate purification. A 1392 bp
region containing the coding region for all1758 was amplified from
the chromosome using primers all1758-NdeI-F and all1758-NH6NotIR, and moved into the EcoRV site of pBluescript SK+ to create
pST192. To generate pST188, the fragment was moved as a NdeI–NotI
fragment into the pPROEX-1 backbone derived from pSMC148
(Risser & Callahan, 2008) digested with NdeI–NotI. The resulting
open reading frame (ORF), designated all1758(H6), encodes a
glycine, then six histidine codons preceding a 16-residue spacer
(DYDIPTTENLYFQGAH, which contains a sequence recognized by
the Tobacco Etch Virus protease) fused to all1758 followed by a stop
codon after the last codon of all1758.
The transcriptional fusion Pnir–all1758 present on plasmid pST368 was
created using the primers all1758 rbs EcoRI F and all1758 OE BamHI R
to amplify all1758 from the chromosome. The fragment was ligated
into the EcoRV site of pBluescript SK+ to generate pST366. To create
pST368, the fragment was moved as an EcoRI–BamHI fragment into
pSMC188, a replicating plasmid used to generate transcriptional
fusions to the nirA promoter (Risser & Callahan, 2007)
Strain construction. Deletion of the all1758 coding region was
performed as previously described (Borthakur et al., 2005), using
382
Source or reference
plasmid pST112 or pST114 and Anabaena sp. strain PCC 7120 to
yield strains UHM183 and UHM184, respectively. The resultant
strains were screened via colony PCR with primers all1758 flank up F
and all1758 flank down R, which anneal outside the chromosomal
region introduced onto pST112 and pST114 for deletion of all1758,
and tested for sensitivity and resistance to the appropriate antibiotics.
Primers all1758 39 F and all1757 59 R were used in a PCR to test if
recombination between plasmid pST141, which harbours Pall1758–
all1758, and the chromosomal locus of all1758 of strain UHM183 had
occurred.
Overexpression and purification of recombinant All1758 and
phosphatase assays. Recombinant All1758 was produced from
E. coli BL21(DE3) transformed with pST188 using Ni-NTA affinity
chromatography (Qiagen) as described previously (Risser & Callahan,
2007) with the following exception: 4 ml wash buffer (50 mM
NaH2PO4, 300 mM NaCl, 20 mM imidazole, 20 %, v/v, glycerol) was
added to the column twice, followed by four 500 ml volumes of
elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole,
20 % glycerol), each diluted fourfold directly into a total volume of
1.5 ml capture buffer (50 mM NaH2PO4, 300 mM NaCl) upon
elution from the column.
Assays for phosphatase activity were conducted as described by
Ruppert et al. (2002). The substrate, 4-nitrophenol phosphate
(pNPP), was dissolved in pNPP buffer containing 10 mM Tris/HCl,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
Microbiology 158
all1758 and heterocyst development
Table 2. Oligonucleotides used in this study
Primer no.
Primer name
Sequence (5§ to 3§)
1
2
3
4
5
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
1758 up F
1758 up R
1758 down F
1758 down R
all1758 flank up F
all1758 flank down R
all1758 39 F
all1757 59 R
Pall 1758 BamHI F
all1758 SacI R
all1758 SmaI R
Pall1758 SacI F
all1758 15 bp up SmaI R
Pall1759-SacI-F
Pall1759-SmaI-R
all1758 OE EcoRI F
all1758 OE BamHI R
all1758-NdeI-F
all1758-NH6-NotIR
all1758 EcoRI rbs F
all1758 rbs EcoRI F
asr5349 RT F
asr5349 RT R
asr5350 RT F
asr5350 RT R
all1757 RT F
all1757 RT R
all1759 RT F
all1759 RT R
rnpB RT F
rnpB RT R
AGATCTGGTGGTGCGATCGCTTGGAG
GCCACGACTGTCCCCGGGTGCCTGTTGTTATTATCACG
ACGGACAACAATAATCCCGGGCGGTGCTGACAG
GAGGCTCGCAGCCGCCCAGCTGTATCTAC
GCCCAAGCACGAAATACAG
CTTCCCGGTAAACTGTTGG
GCTAGAACCTGGTGATACAG
ACAGACTGAGAGTTACGTGC
TATATGGATCCTAGAAGCTCTCTTGAGTGGC
ATATAGAGCTCCCCAGTCCCTTTTATACTCG
ATATACCCGGGATTCGATCTGTAAGACCAC
TATATGAGCTCTAGAAGCTCTCTTGAGTGGC
ATATACCCGGGAAAGGGGTTAATTTTAGATTGAC
TATATGAGCTCCCAAAAAAAGGCGCTGAGTG
ATATACCCGGGTAGTTGTTACGAGTTATGAG
TATATGAATCCATGTGCCTGTGC CTCCATTTTC
TATATGGATCCCCCAGTCCCTTTTATACTCG
ATATACATATGCCTGTGCCTCCATTTTCCTCTCAAC
TTACTGCGGCCGCTTTTCGATCTGTAAGACCACTAAAGTC
TATATGAATTCAGGAGGTGATTGTGCCTGTGCCTCCATTTTC
TATATAAGGAGGAATTCTGTGCCTGTGCCTCCATTTTC
AACTAAATCTAGTGAGCATGG
AAGCATATAAAAGGTGATGGT
ATGGCATTCATCAAGATACAG
AACGCTTGACTCTTGATATTG
CTGCCGTCAGTACTGTTAC
AGTCCAGGCTTGCTCTTTAG
GGTTCCGTCGTCAAACTAACG
CACGCCAGTTGTTTGTACTG
ATAGTGCCACAGAAAAATACCG
AAGCCGGGTTCTGTTCTCTG
pH 8.5, 1 mM DTT and 50 mM NaCl with addition of either 2 mM
MnCl2 or 5 mM MgCl2 and supplemented with either 10 or 100 mM
cAMP or cGMP. As a test for hydrolysis of pNPP by the putative
phosphatase activity of All1758, 2 mg of the recombinant protein was
added to the cocktail at a final reaction volume of 1 ml. Absorbance
at 400 nm was monitored as a measure of hydrolysis of pNPP at
25 uC every 30 s for the first 30 min after addition of protein to the
cocktail, then at 45 min, and at 1, 2, 5 and 24 h.
Acetylene reduction, glycolipid and exopolysaccharide assays.
Acetylene reduction assays on three independent cultures were
performed as previously described (Borthakur et al., 2005). Glycolipid extraction for TLC and staining of exopolysaccharides were also
done as previously described (Callahan & Buikema, 2001b).
RESULTS
Measurement of cell size. Reported values for cell sizes were
obtained by measuring the ‘height’ of 100 randomly distributed cells
of Anabaena sp. strains PCC 7120 and UHM184. Height refers to the
dimension perpendicular to the longitudinal axis of the filament,
halfway between cell poles. Significance of differences in height
distributions was established using an unpaired t-test with a twotailed P-value of less than 0.0001. Approximate cell volumes were
calculated by treating cells as spheres, using the mean cell height as
the radius in the formula volumesphere54/3pr3.
RNA isolation and RT-PCR. Total RNA was extracted as
previously described (Risser & Callahan, 2008). For reversetranscription PCR (RT-PCR), 0.5 mg total RNA was used for the
synthesis of cDNA with reverse transcriptase and the corresponding
reverse primers for subsequent use in PCR, which was carried out
for 27 cycles using primers 23–32 as previously described (Risser &
Callahan, 2008).
http://mic.sgmjournals.org
Mutation of all1758 prevents diazotrophic growth
In an effort to identify genes necessary for diazotrophic
growth of Anabaena sp. strain PCC 7120, a genetic screen
using transposon mutagenesis both to increase and to mark
the sites of mutations was conducted as previously
described (Nayar et al., 2007). In one mutant the
transposon had disrupted ORF all1758 in the annotated
genome sequence, suggesting that all1758 was necessary for
diazotrophic growth. To verify a cause-and-effect relationship between inactivation of all1758 and the phenotype of
the mutant, an V interposon conferring spectinomycin and
streptomycin resistance was used to replace nucleotides
+31 to +1358 relative to the GTG translational initiation
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
383
S. K. Tom and S. M. Callahan
codon of all1758 in the wild-type strain. The resulting
mutant, UHM184, contained the first and last 30 nucleotides of all1758 flanking the V interposon and exhibited
impaired diazotrophic growth similar to that of the isolated
transposon mutant. Complementation of UHM184 with a
plasmid bearing all1758 preceded by 497 bp upstream of
all1758, including the 474 bp intergenic region between the
end of upstream gene all1759 and the start of all1758,
restored diazotrophic growth to the mutant and suggested
that inactivation of all1758 and not polar effects of the
transposon insertion was the cause of the mutant phenotype.
The all1758 gene is located between two genes transcribed in
the same orientation and predicted to have a role in cell
division, ftsX (all1757) and ftsY (all1759). To verify that
inactivation of all1758 was solely responsible for the
phenotypes of the mutants, nucleotides +31 to +1358
were cleanly deleted from the chromosome of the wild-type.
The resulting strain, UHM183, had an in-frame deletion of
all1758 and differed from UHM184 only by the absence of
the V interposon. The phenotype of this strain was similar to
that of UHM184. Strain UHM183 was complemented in the
same manner as for UHM184, and there was no evidence for
recombination between the plasmid and the chromosomal
locus of all1758, as indicated by the lack of a PCR product
using primers corresponding to the region of all1758 that is
deleted from the mutant chromosome and the coding region
of all1757. Lastly, transcripts of all1757 and all1759 were
detected by RT-PCR in RNA isolated from strains UHM184
and the wild-type (data not shown). Taken together, these
results indicated that a functional copy of all1758 was
required for diazotrophic growth of Anabaena sp. strain
PCC 7120.
The predicted 463 amino acid sequence encoded by all1758
was compared to sequences in the NCBI Protein Database.
Residues 45–200 appeared to comprise a GAF domain,
which is named after the types of proteins containing
the domain (cGMP-specific phosphodiesterases, adenylyl
cyclases and FhlA). Many of these proteins bind cyclic
nucleotides. Residues 270–463 were similar in sequence to
serine/threonine protein phosphatases of the PP2C superfamily, which comprises metallo-phosphatases that employ
two metal ions in the catalytic site. PP2C proteins generally
have a catalytic domain of approximately 290 amino acids
that includes eight absolutely conserved residues within
11 conserved motifs (Kennelly, 2001; Shi et al., 2007).
However, the predicted protein sequence of All1758 lacked
the invariant glycine present in motif 5 and, instead, had an
alanine in its place.
In an attempt to demonstrate phosphatase activity of
All1758, the 52 kDa protein with an N-terminal polyhistidine epitope tag was purified from E. coli strain
BL21(DE3) by affinity chromatography. Attempts to
characterize phosphatase activity using pNPP as a substrate were unsuccessful even after addition of either 10 or
100 mM cAMP or cGMP separately with the pNPP substrate, in an effort to support the potential role of the GAF
domain in phosphatase function.
384
Pleiotropic phenotype of all1758 null mutants
Although all1758 was discovered in a genetic screen designed
to isolate mutants incapable of growth on nitrogen-deficient
media, disruption of all1758 also affected viability on
nitrogen-replete media. Colonies of the mutant were pale
green rather than the vibrant green of the wild-type, and
after about 3 weeks of growth on BG-11 solid media with
either 17 mM nitrate or 2 mM ammonia as a source of fixed
nitrogen, growth appeared to cease, and the strain could not
be revived by subculturing onto fresh medium. In
comparison, the wild-type strain remained viable under
the same conditions for more than 3 months. However, the
strain could apparently be maintained indefinitely if
repeatedly subcultured onto BG-11 solid medium every
2 weeks. To test if loss of viability was the result of a change
in the medium over time, non-viable filaments of UHM184
were scraped from a plate culture 3 weeks after its
inoculation, and the resulting ‘conditioned’ solid medium
was streaked with PCC 7120. Growth of the wild-type strain
was indistinguishable from that on unconditioned medium.
Cells of UHM184 filaments cultured on BG-11 solid
medium were markedly smaller than those of the wild-type
grown under the same conditions. The mean (±SD)
vegetative cell height (measured perpendicular to the
longitudinal axis of the filament) of mutant cells was
2.88±0.25 mm, compared with 4.34±0.23 mm for cells of
the wild-type, which corresponded to a more than three-fold
reduction in cell volume for the mutant (Fig. 1a, b). This
diminutive phenotype persisted until loss of viability and
when cells were transferred to liquid medium lacking fixed
nitrogen.
Growth of the mutant in liquid BG-11 containing nitrate
or ammonium as a source of fixed nitrogen was different
from that on solid medium. Within 24 h of inoculation into
liquid medium, the cytoplasm was found on one side of the
cell, and the majority of the cell volume was occupied by
what appeared to be a single, large vacuole (Fig. 1c).
Alternatively, the plasma membrane may have pulled away
from the cell wall in a manner resembling plasmolysis in
plant cells. The process was unlikely to be attributable to the
formation of a large gas vesicle because mutant cells settled
to the bottom of growth vessels more readily than those of
the wild-type. Vacuole formation was accompanied by
enlargement of cells and resulted in cell lysis within 48 h. To
test if cell lysis and/or vacuolization of cells was in response
to a substance excreted into the medium by the mutant,
conditioned medium separated from cellular debris by
centrifugation was inoculated with PCC 7120. Growth of
PCC 7120 in medium conditioned by UHM184 was similar
to that in unconditioned medium, indicating that lysis of
UHM184 was not caused by alteration of the medium by the
mutant so as to make it unfit for growth of PCC 7120. The
pH of medium conditioned by growth of UHM184 was
similar to that of medium conditioned by the wild-type and
to unconditioned medium. In addition, the inverse
experiment, growing UHM184 in spent medium of strain
PCC 7120, did not rescue any of the mutant phenotypes.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
Microbiology 158
all1758 and heterocyst development
of degradation of phycobiliproteins, and polar cyanophycin granules associated with mature heterocysts. Note that
all of the mutant phenotypes were complemented by
introduction of all1758 on a plasmid to strain UHM184 as
described above.
Strain UHM184 is Fix– and lacks the minor
heterocyst-specific glycolipid
During the late stages of heterocyst development, deposition of heterocyst-specific polysaccharides contributes to
the creation of the micro-oxic environment necessary for
the function of nitrogenase, an oxygen-labile enzyme.
Heterocysts of strain UHM184 were readily stained by
Alcian Blue, indicative of the presence of heterocyst
envelope exopolysaccharides (Fig. 2). Thus, polysaccharide
synthesis and deposition appears unimpaired in the
mutant.
Just interior to the layer of exopolysaccharide, a layer of
heterocyst-specific glycolipid (HGL) also contributes to the
micro-oxic interior of a heterocyst. To determine if HGLs
were present in mutant strain UHM184, lipids from strains
PCC 7120, UHM184 and UHM103, the last being a hetR
mutant that served as a negative control, were extracted
after 72 h of combined-nitrogen deprivation, and separated by TLC for visualization (Fig. 3). Two HGLs have
been characterized in the wild-type (Gambacorta et al.,
1996; Lambein & Wolk, 1973; Soriente et al., 1995).
Although the more abundant, slower-migrating species
corresponding to 1-(O-a-D-glucopyranosyl)-3,25-hexacosanediol (the major HGL) was present in strains UHM184
and PCC 7120, the less abundant, faster migrating
glycolipid, 1-(O-a-D-glycopyranosyl)-3-keto-25-hexacosanol (the minor HGL), was absent from UHM184. As
expected, both HGLs were absent from strain UHM103,
which does not make heterocysts. The absence of the minor
HGL, which is necessary for a functional heterocyst, could
Fig. 1. Phenotype of the all1758 deletion strain, UHM184, under
different conditions. Note the diminutive cell size of UHM184 (b)
as compared with the wild-type strain Anabaena sp. PCC 7120
(a) cultured on solid BG-11 medium. At 24 h after culture in liquid
BG-11 medium, UHM184 develops intracellular vacuoles among
all cells of a filament (c). At 24 h after transfer from solid BG-11
medium to liquid BG-110 medium, which lacks a source of
combined nitrogen, heterocysts form in PCC 7120 (d) but not in
UHM184 (e). After 48 h of nitrogen starvation, UHM184 exhibits
heterocyst patterning among cells of diminutive size (f). Arrowheads indicate heterocysts. Bars, 10 mm.
UHM184 was incapable of growth in the absence of fixed
nitrogen, and morphologically distinct heterocysts were
not observed until 48 h after removal of fixed nitrogen,
about twice the time for the wild-type (Fig. 1d, e, f). The
periodic pattern of heterocyts along filaments was similar
to that of the wild-type. Heterocysts of UHM184 had
characteristic reduced levels of autofluorescence, indicative
http://mic.sgmjournals.org
Fig. 2. Heterocyst-specific exopolysaccharide of UHM184.
Bright-field images of heterocyst-specific exopolysaccharides
stained by Alcian Blue in strains PCC 7120 (a) and UHM184
(b) at 48 h after removal of combined nitrogen. Arrowheads
indicate heterocysts. Bars, 10 mm.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
385
S. K. Tom and S. M. Callahan
account for the inability of UHM184 to grow under
diazotrophic conditions. Typically, strains affected in HGL
synthesis lack both the minor and the major HGL, with one
exception. A double kinase mutant was shown by RT-PCR
to lack expression of two glycolipid synthesis genes, asr5349
and asr5350 (Shi et al., 2007). Conversely, transcripts of
asr5349 and asr5350 were detected by RT-PCR in RNA
isolated from strain UHM184 (data not shown).
Strains that lack one or both of the HGLs cannot fix
nitrogen in the presence of molecular oxygen (Fox2
phenotype) but can do so in its absence. Other strains
that are deficient in more than just the creation of microoxic heterocysts cannot fix under either condition (Fix2
phenotype). The nitrogenase activity of strain UHM184 at
48 h post-induction was assessed by acetylene reduction
assays under both oxic and anoxic conditions to determine
if it was a Fox2 or Fix2 strain. Under oxic conditions, rates
of acetylene reduction were 0.350±0.064 nmol ethylene
h21 ml 21 (OD750 unit)21 for PCC 7120 and undetectable
for strains UHM184, UHM103 (a Fix2 strain) and UHM128
(a previously characterized Fox2 strain: Leganés et al.,
2005; Nayar et al., 2007). Under anoxic conditions, rates
of acetylene reduction were 0.073±0.038 nmol ethylene
Fig. 3. HGLs of strain UHM184. Lipid extracts from the strains
indicated were separated by TLC 72 h after removal of combined
nitrogen. Lane 1, the all1758 mutant, UHM184, which lacks the
minor HGL; lane 2, PCC 7120; lane 3, the hetR mutant, UHM103,
which lacks both the minor and the major HGLs. The minor [1-(Oa-D-glycopyranosyl)-3-keto-25-hexacosanol] and the major [1-(Oa-D-glucopyranosyl)-3,25-hexacosanediol] HGLs are indicated by
the top and bottom arrows, respectively. Lipid extracts were
deposited at the origin, denoted by an asterisk.
386
h21 ml 21 (OD750 unit)21 for strain UHM128 and undetectable for strains UHM184 and UHM103. Thus, the
phenotype of UHM184 was Fix2, suggesting that lack of a
functional copy of all1758 disrupted more than just the
creation of micro-oxic conditions in heterocysts.
The all1758 ORF is constitutively expressed and
autoregulates its own expression
Expression of all1758 was assessed both temporally and
spatially using the gene for green fluorescent protein (GFP)
as a reporter. A uniform level of bright florescence was
observed in both vegetative cells and heterocysts when a
shuttle vector carrying the putative promoter region of
all1758 fused to gfp was introduced into the wild-type
strain. Similar levels of expression were seen with and
without nitrate in the medium (Fig. 4a). However, no GFPdependent fluorescence was observed when the same
plasmid was introduced into strain UHM184, which has
all1758 deleted from the chromosome (Fig. 4b).
No GFP-dependent fluorescence was observed from the
wild-type strain harbouring a plasmid bearing all1758
translationally fused to gfp under the control of its native
promoter in the presence or absence of nitrate (data not
shown). UHM184 bearing the same plasmid also remained
non-fluorescent, similar to the wild-type, although the cell
size had returned to the wild-type dimensions, apparently
Fig. 4. A functional all1758 gene is required for expression of
all1758 but not for patterned expression of patS. (a, b) Expression
of all1758 as visualized with a transcriptional Pall1758–gfp fusion
on plasmid pST151 in strains PCC 7120 (a) or UHM184 (b) at
24 h after removal of combined nitrogen. (c, d) Expression of patS
in PCC 7120 (c) and UHM184 (d) as visualized using the
transcriptional fusion patS–gfp on plasmid pAM1951 at 14 h after
induction of heterocyst formation. Micrographs show bright-field
(left panels) and fluorescence (right panels) images acquired using
identical microscope and camera settings. Arrowheads indicate
heterocysts. Bars, 10 mm.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
Microbiology 158
all1758 and heterocyst development
due to complementation by the fusion protein encoded on
the plasmid. In addition, overexpression of all1758 from
the copper-inducible petE promoter in the wild-type strain
had no apparent effect on heterocyst differentiation or cell
size, whereas extra copies of patS or hetN expressed from
the petE promoter on a plasmid in strain UHM184
prevented heterocyst differentiation, but the diminutive
cell phenotype remained (data not shown). Overexpression
of all1758 from the nirA promoter, which is induced under
both nitrate-replete conditions or conditions of nitrogen
starvation (Frı́as et al., 1997), yielded the same results as
those observed with use of the petE promoter (data not
shown).
all1758 is not required for the timing of pattern
formation
A null mutation in all1758 delays morphological differentiation of heterocysts. Prior to changes in the morphology of differentiating cells, the cells of filaments that will
differentiate are specified by the generation of a pattern of
gene expression. This pattern can be visualized using
fusions of the promoters of hetR or patS to gfp (Callahan &
Buikema, 2001a; Yoon & Golden, 2001). Strain UHM184
carrying a plasmid with the promoter of either hetR or
patS fused to gfp exhibited a pattern of GFP-dependent
fluorescence that was similar to that observed in the
wild-type carrying the same plasmid (Fig. 4c, d). Both the
number of cells between fluorescing cells and the timing of
the appearance of fluorescence were similar. The only
noticeable difference was the smaller size of the cells in
filaments of UHM184. Thus, all1758 was not required for
formation of the pattern that specifies which cells will
differentiate into heterocysts.
Bypass of mutation of all1758 by extra copies of
hetR
In an attempt to ascertain where in the regulatory network
controlling heterocyst differentiation all1758 may have
been acting, plasmid-borne copies of hetR were put into
UHM184 and the resulting strain was examined for
phenotypic differences. The strain with extra copies of
hetR had multiple contiguous heterocysts and reduced
spacing between groups of heterocysts in media with or
without nitrate as a fixed nitrogen source (data not shown).
The same Mch (multiple contiguous heterocysts) phenotype
was observed when the plasmid was introduced into the
wild-type strain. Extra copies of hetR bypassed the delay
in morphological differentiation of heterocysts, but the
diminutive cell phenotype and other associated phenotypes
remained.
DISCUSSION
Phosphorylation of proteins is widely used in the regulation
of various cellular processes. All1758 is predicted to be a
http://mic.sgmjournals.org
PP2C phosphatase, which is a member of the PPM family of
serine/threonine phosphatases that are dependent on the
presence of the divalent cation Mg2+ for catalytic function.
However, repeated attempts to demonstrate the role of
All1758 as a phosphatase were unsuccessful. The simplest
explanation for the lack of discernible phosphatase activity is
the absence of one of the eight absolutely conserved residues
in the protein sequence of all1758. PP2C proteins generally
have a catalytic domain of approximately 290 amino acids
that includes eight absolutely conserved residues within 11
conserved motifs (Kennelly, 2001; Shi et al., 2007). All1758
has an alanine residue, a conservative substitution, in lieu of
the glycine residue reported as invariant in motif 5.
Alternatively, phosphatase activity of the protein encoded
by all1758 may not be measurable under the conditions of
our assay due, for instance, to substrate specificity, lack of a
cofactor or improper folding of the recombinant protein.
The minor HGL, which is essential for provision of
microaerobic conditions necessary for the activity of
nitrogenase within the heterocyst, was absent in a strain
lacking all1758. However, the absence of nitrogen fixation
in the mutant strain even under anoxic conditions suggests
that all1758 is required for some cellular process(es) related
to fixation of nitrogen not related to diminution of
molecular oxygen in heterocysts. Indeed, a diverse and
seemingly unrelated range of phenotypes resulted from
mutation of all1758. For instance, the delay in heterocyst
formation in UHM184 may suggest the involvement of
all1758 in the timing of heterocyst morphology development. The diminutive cell size and associated decrease in
cell volume apparent upon mutation of all1758 may be
indicative of a change in the timing of cell division in the
mutant, which would prevent the cell from attaining a
normal and/or enlarged cell size. Inhibition of cell division
has been shown to prevent differentiation of heterocysts,
and heterocysts have twice the DNA content of vegetative
cells (Sakr et al., 2006a, b). The increased rate of cell
division in strains lacking all1758 may account for the
defect in heterocyst differentiation in the mutant. The
location of all1758 between the cell division genes ftsX and
ftsY may implicate all1758 as a cell division gene as well. In
E. coli, for example, the cell division gene ftsE (b3463) lies
between ftsX (b3462) and ftsY (b3464). Alternatively, a
defect in a process specific to heterocyst differentiation may
influence cell division. Also, the decrease in cell volume
may have perturbed the concentration of specific intracellular components, resulting in the observed phenotypes.
The relationship between cell division and heterocyst
differentiation remains enigmatic.
Unpatterned expression of all1758 in all cells was evident
under both nitrate-replete and nitrate-depleted conditions
using a GFP transcriptional reporter fusion, suggesting that
the gene is constitutively expressed. In contrast, GFPdependent fluorescence was not observed from an all1758
translational fusion in all background strains tested.
However, the fusion protein did appear to complement
strain UHM184, suggesting the fusion protein was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
387
S. K. Tom and S. M. Callahan
functional. The lack of detectable fluorescence may indicate
that levels of All1758 are very low in cells, so the associated
fluorescence from the fusion protein was below the level of
detection, or the GFP portion of the protein may have been
non-functional. This phenomenon is not new. In our
hands, plasmid constructs bearing hetR–gfp and hetF–gfp
translational fusions in hetR and hetF backgrounds,
respectively, also complement the inactivated gene, yet
visible fluorescence is lacking (Risser & Callahan, 2008).
kinase domain and a His kinase domain are regulated by NtcA in the
cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 188, 4822–
4829.
Alterations in the levels of expression of other genes involved
in heterocyst differentiation have been shown to affect cell
size. Inactivation of all2874, encoding a diguanylate cyclase,
results in a light intensity-dependent variability in heterocyst
frequency and reduction in vegetative cell size (Neunuebel &
Golden, 2008). Conversely, a strain lacking hetF has enlarged
cells, and extra copies of hetF on a plasmid result in a
diminutive cell phenotype (Risser & Callahan, 2008). In
contrast to the correlation between smaller cell size and a
delay in heterocyst differentiation in the all1758 mutant, a
strain with extra copies of hetF forms more heterocysts
than the wild-type. Overexpression of patA also results in
enlarged cells (Young-Robbins et al., 2010). There is no
evidence for the phosphorylation of HetF or PatA, but PatA
is similar in sequence to response regulators of twocomponent transduction systems (Liang et al., 1992). The
growing number of phosphatases and kinases implicated in
heterocyst differentiation indicates that protein phosphorylation plays a prominent role in the regulation of
differentiation. However, understanding the extent and
nature of that role is dependent on uncovering the targets of
kinase and phosphatase activity.
protein phosphatase, is essential for heterocyst function in the
cyanobacterium Anabaena sp. PCC 7120. Microbiology 156, 3544–
3555.
Ehira, S. & Ohmori, M. (2006). NrrA directly regulates expression
of hetR during heterocyst differentiation in the cyanobacterium
Anabaena sp. strain PCC 7120. J Bacteriol 188, 8520–8525.
Elhai, J. & Wolk, C. P. (1988). Conjugal transfer of DNA to cyano-
bacteria. Methods Enzymol 167, 747–754.
Espinosa, J., Brunner, T., Fiedler, N., Forchhammer, K., Muro-Pastor,
A. M. & Maldener, I. (2010). DevT (Alr4674), resembling a Ser/Thr
Fellay, R., Frey, J. & Krisch, H. (1987). Interposon mutagenesis of soil
and water bacteria: a family of DNA fragments designed for in vitro
insertional mutagenesis of gram-negative bacteria. Gene 52, 147–154.
Frı́as, J. E., Flores, E. & Herrero, A. (1997). Nitrate assimilation gene
cluster from the heterocyst-forming cyanobacterium Anabaena sp.
strain PCC 7120. J Bacteriol 179, 477–486.
Gambacorta, A., Romano, I., Trincone, A., Soriente, A., Giordano, M.
& Sodano, G. (1996). Heterocyst glycolipids from five nitrogen-fixing
cyanobacteria. Gazz Chim Ital 126, 653–656.
Higa, K. C. & Callahan, S. M. (2010). Ectopic expression of hetP can
partially bypass the need for hetR in heterocyst differentiation by
Anabaena sp. strain PCC 7120. Mol Microbiol 77, 562–574.
Jang, J., Wang, L., Jeanjean, R. & Zhang, C. C. (2007). PrpJ, a PP2C-
type protein phosphatase located on the plasma membrane, is
involved in heterocyst maturation in the cyanobacterium Anabaena
sp. PCC 7120. Mol Microbiol 64, 347–358.
Jang, J., Shi, L., Tan, H., Janicki, A. & Zhang, C. C. (2009). Mutual
regulation of ntcA and hetR during heterocyst differentiation requires
two similar PP2C-type protein phosphatases, PrpJ1 and PrpJ2, in
Anabaena sp. strain PCC 7120. J Bacteriol 191, 6059–6066.
Kennelly, P. J. (2001). Protein phosphatases – a phylogenetic
perspective. Chem Rev 101, 2291–2312.
ACKNOWLEDGEMENTS
We wish to thank Kelly C. Higa for plasmid pKH256. This work was
supported by the National Science Foundation, grant IOS-0919878.
Lambein, F. & Wolk, C. P. (1973). Structural studies on the glycolipids
from the envelope of the heterocyst of Anabaena cylindrica.
Biochemistry 12, 791–798.
Laurent, S., Forchhammer, K., Gonzalez, L., Heulin, T., Zhang, C. C.
& Bédu, S. (2004). Cell-type specific modification of PII is involved in
REFERENCES
the regulation of nitrogen metabolism in the cyanobacterium
Anabaena PCC 7120. FEBS Lett 576, 261–265.
Black, T. A., Cai, Y. & Wolk, C. P. (1993). Spatial expression and
Laurent, S., Chen, H., Bédu, S., Ziarelli, F., Peng, L. & Zhang, C.-C.
(2005). Nonmetabolizable analogue of 2-oxoglutarate elicits hetero-
autoregulation of hetR, a gene involved in the control of heterocyst
development in Anabaena. Mol Microbiol 9, 77–84.
Borthakur, P. B., Orozco, C. C., Young-Robbins, S. S., Haselkorn, R.
& Callahan, S. M. (2005). Inactivation of patS and hetN causes lethal
cyst differentiation under repressive conditions in Anabaena sp. PCC
7120. Proc Natl Acad Sci U S A 102, 9907–9912.
levels of heterocyst differentiation in the filamentous cyanobacterium
Anabaena sp. PCC 7120. Mol Microbiol 57, 111–123.
Leganés, F., Blanco-Rivero, A., Fernández-Piñas, F., Redondo, M.,
Fernández-Valiente, E., Fan, Q., Lechno-Yossef, S. & Wolk, C. P.
(2005). Wide variation in the cyanobacterial complement of
Buikema, W. J. & Haselkorn, R. (2001). Expression of the Anabaena
presumptive penicillin-binding proteins. Arch Microbiol 184, 234–
248.
hetR gene from a copper-regulated promoter leads to heterocyst
differentiation under repressing conditions. Proc Natl Acad Sci U S A
98, 2729–2734.
Callahan, S. M. & Buikema, W. J. (2001a). The role of HetN in
maintenance of the heterocyst pattern in Anabaena sp. PCC 7120. Mol
Microbiol 40, 941–950.
Liang, J., Scappino, L. & Haselkorn, R. (1992). The patA gene
product, which contains a region similar to CheY of Escherichia coli,
controls heterocyst pattern formation in the cyanobacterium
Anabaena 7120. Proc Natl Acad Sci U S A 89, 5655–5659.
Callahan, S. M. & Buikema, W. J. (2001b). The role of HetN in
Meeks, J. C., Wolk, C. P., Lockau, W., Schilling, N., Shaffer, P. W. &
Chien, W.-S. (1978). Pathways of assimilation of [13N]N2 and 13NH4+
maintenance of the heterocyst pattern in Anabaena sp. PCC 7120. Mol
Microbiol 40, 941–950.
by cyanobacteria with and without heterocysts. J Bacteriol 134, 125–
130.
Cheng, Y., Li, J. H., Shi, L., Wang, L., Latifi, A. & Zhang, C. C. (2006). A
Muro-Pastor, A. M., Valladares, A., Flores, E. & Herrero, A. (2002).
pair of iron-responsive genes encoding protein kinases with a Ser/Thr
Mutual dependence of the expression of the cell differentiation
388
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
Microbiology 158
all1758 and heterocyst development
regulatory protein HetR and the global nitrogen regulator NtcA
during heterocyst development. Mol Microbiol 44, 1377–1385.
Murry, M. A. & Wolk, C. P. (1989). Evidence that the barrier to the
penetration of oxygen into heterocysts depends upon two layers of the
cell envelope. Arch Microbiol 151, 469–474.
Nayar, A. S., Yamaura, H., Rajagopalan, R., Risser, D. D. & Callahan,
S. M. (2007). FraG is necessary for filament integrity and heterocyst
maturation in the cyanobacterium Anabaena sp. strain PCC 7120.
Microbiology 153, 601–607.
Neunuebel, M. R. & Golden, J. W. (2008). The Anabaena sp. strain
Sakr, S., Jeanjean, R., Zhang, C.-C. & Arcondeguy, T. (2006a).
Inhibition of cell division suppresses heterocyst development in
Anabaena sp. strain PCC 7120. J Bacteriol 188, 1396–1404.
Sakr, S., Thyssen, M., Denis, M. & Zhang, C.-C. (2006b). Relationship
among several key cell cycle events in the developmental cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 188, 5958–5965.
Shi, L., Li, J. H., Cheng, Y., Wang, L., Chen, W. L. & Zhang, C. C.
(2007). Two genes encoding protein kinases of the HstK family are
involved in synthesis of the minor heterocyst-specific glycolipid in the
cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 189, 5075–
5081.
PCC 7120 gene all2874 encodes a diguanylate cyclase and is required
for normal heterocyst development under high-light growth conditions. J Bacteriol 190, 6829–6836.
Soriente, A., Bisogno, T., Gambacorta, A., Romano, I., Sili, C.,
Trincone, A. & Sodano, G. (1995). Reinvestigation of heterocyst
Ning, D. & Xu, X. (2004). alr0117, a two-component histidine kinase
glycolipids from the cyanobacterium, Anabaena cylindrica. Phytochemistry 38, 641–645.
gene, is involved in heterocyst development in Anabaena sp. PCC
7120. Microbiology 150, 447–453.
Olmedo-Verd, E., Flores, E., Herrero, A. & Muro-Pastor, A. M. (2005).
HetR-dependent and -independent expression of heterocyst-related
genes in an Anabaena strain overproducing the NtcA transcription
factor. J Bacteriol 187, 1985–1991.
Orozco, C. C., Risser, D. D. & Callahan, S. M. (2006). Epistasis
analysis of four genes from Anabaena sp. strain PCC 7120 suggests a
connection between PatA and PatS in heterocyst pattern formation.
J Bacteriol 188, 1808–1816.
Ramı́rez, M. E., Hebbar, P. B., Zhou, R., Wolk, C. P. & Curtis, S. E.
(2005). Anabaena sp. strain PCC 7120 gene devH is required for
Vázquez-Bermúdez, M. F., Herrero, A. & Flores, E. (2002). 2-
Oxoglutarate increases the binding affinity of the NtcA (nitrogen
control) transcription factor for the Synechococcus glnA promoter.
FEBS Lett 512, 71–74.
Wei, T.-F., Ramasubramanian, T. S. & Golden, J. W. (1994). Anabaena
sp. strain PCC 7120 ntcA gene required for growth on nitrate and
heterocyst development. J Bacteriol 176, 4473–4482.
Wolk, C. P. (1968). Movement of carbon from vegetative cells to
heterocysts in Anabaena cylindrica. J Bacteriol 96, 2138–2143.
Wolk, C. P., Ernst, A. & Elhai, J. (1994). Heterocyst metabolism and
synthesis of the heterocyst glycolipid layer. J Bacteriol 187, 2326–2331.
development. In The Molecular Biology of Cyanobacteria, pp. 769–823.
Edited by D. A. Bryant. Dordrecht: Kluwer Academic Publishers.
Risser, D. D. & Callahan, S. M. (2007). Mutagenesis of hetR reveals
Xu, W. L., Jeanjean, R., Liu, Y. D. & Zhang, C. C. (2003). pkn22
amino acids necessary for HetR function in the heterocystous
cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 189,
2460–2467.
Risser, D. D. & Callahan, S. M. (2008). HetF and PatA control levels of
HetR in Anabaena sp. strain PCC 7120. J Bacteriol 190, 7645–7654.
Risser, D. D. & Callahan, S. M. (2009). Genetic and cytological
evidence that heterocyst patterning is regulated by inhibitor gradients
that promote activator decay. Proc Natl Acad Sci U S A 106, 19884–
19888.
Ruppert, U., Irmler, A., Kloft, N. & Forchhammer, K. (2002). The
novel protein phosphatase PphA from Synechocystis PCC 6803
controls dephosphorylation of the signalling protein PII. Mol
Microbiol 44, 855–864.
Saha, S. K. & Golden, J. W. (2011). Overexpression of pknE blocks
heterocyst development in Anabaena sp. strain PCC 7120. J Bacteriol
193, 2619–2629.
http://mic.sgmjournals.org
(alr2502) encoding a putative Ser/Thr kinase in the cyanobacterium
Anabaena sp. PCC 7120 is induced by both iron starvation and
oxidative stress and regulates the expression of isiA. FEBS Lett 553,
179–182.
Yoon, H.-S. & Golden, J. W. (2001). PatS and products of nitrogen
fixation control heterocyst pattern. J Bacteriol 183, 2605–2613.
Young-Robbins, S. S., Risser, D. D., Moran, J. R., Haselkorn, R. &
Callahan, S. M. (2010). Transcriptional regulation of the heterocyst
patterning gene patA from Anabaena sp. strain PCC 7120. J Bacteriol
192, 4732–4740.
Zhang, C. C., Friry, A. & Peng, L. (1998). Molecular and genetic
analysis of two closely linked genes that encode, respectively, a protein
phosphatase 1/2A/2B homolog and a protein kinase homolog in the
cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 180, 2616–
2622.
Edited by: C.-C. Zhang
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 05:26:46
389