Download Mutations File

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Site-specific recombinase technology wikipedia , lookup

Genome (book) wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Designer baby wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Genome evolution wikipedia , lookup

History of genetic engineering wikipedia , lookup

BRCA mutation wikipedia , lookup

Gene wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Expanded genetic code wikipedia , lookup

Koinophilia wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Oncogenomics wikipedia , lookup

Microsatellite wikipedia , lookup

NEDD9 wikipedia , lookup

Population genetics wikipedia , lookup

Mutagen wikipedia , lookup

Epistasis wikipedia , lookup

Genetic code wikipedia , lookup

Microevolution wikipedia , lookup

Haplogroup G-P303 wikipedia , lookup

Mutation wikipedia , lookup

Frameshift mutation wikipedia , lookup

Point mutation wikipedia , lookup

Transcript
Mutations
Go to this site: http://evolution.berkeley.edu/evolibrary/article/0_0_0/mutations_02
And answer the following questions
1. Give an example of how a silent substitution mutation could occur with the codon of GGA using
the table below and explain why it would be considered silent.
2. Write out the amino acid sequence for this strand of mRNA using the table above then divide it
into codons by adding spaces between the bases:
AUGAGAACUUUUUGUCGUGGUCCCCCCUGA
3.
Replace the second ”A” with “C”
a. What type of mutation is this? (substitution, insertion, or deletion?)
b. Would it be considered a frameshift mutation? Why or why not?
c. Rewrite the amino acid sequence with the mutated strand.
d. Is this considered a “silent” mutation (a mutation that causes no changes) or is it an
“expressed” mutation (a mutation that causes a change in the amino acid sequence, and
therefore a change in the protein?)
4. Take the same strand and remove the 4th "A" then divide the strand into codons by adding
spaces between the bases:
AUGAGAACUUUUUGUCGUGGUCCCCCCUGA
a. What type of mutation is this? (substitution, insertion, or deletion?)
b. Would it be considered a frameshift mutation? Why or why not?
c. Rewrite the amino acid sequence with the mutated strand.
d. Is this considered a “silent” mutation (a mutation that causes no changes) or is it an
“expressed” mutation (a mutation that causes a change in the amino acid sequence, and
therefore a change in the protein?)
5. What are two sources of mutations?
6. A chemical or agent that causes mutations are known as a “mutagen” do a google search to see
if you can identify 2 common mutagens that humans can be exposed to.
7. In what type of cell does a mutation have to occur to in order to pass the mutation on to an
offspring?
8. Spiderman was bitten by a radioactive spider that mutated the DNA in every cell of his body in
exactly the same way *(extremely unlikely to happen). If Spiderman has kids, will his kids get
the mutated DNA?
9. Define “phenotype” (use google)
10. What are 3 common effects of mutations?
11. Why are Hox Genes so powerful? Give an example of a mutation that can occur when a Hox
Gene is mutated.
Hemoglobin is a protein found in red blood cells. The function of hemoglobin is to
absorb oxygen from the lungs and rel ease it to body cells that require oxygen.
Sickle cell anemia is a genetic disorder that causes a change in the shape of
hemoglobin
12. Look at the mutation in the DNA sequence that causes sickle cell. What type of mutation is this?
(insertion, deletion or substiution?)
13. What happens to the hemoglobin that has the mutation?
14. What are the negative effects at the cellular and whole organism level?
15. What is the positive effect of sickle cell anemia at the whole organism level?
16. A scientist samples the occurrences of the sickle cell gene in two populations. One population is
near the equator in a hot, humid climate that breeds mosquitos whose bite can infect people
with malaria. The other population lives in a dry arid region that has few mosquitoes. Where
would you expect to have the higher occurrences of sickle cell genes and why?
17. Cleaning products, hand sanitizers and hand soaps can now be bought in an “antibacterial”
variety. Do you see any potential issues with constantly using antibacterial products?
18. Hospitals often use antibiotics to sterilize. Hospitals have also been the site of “super bacteria;”
bacteria that are resistant to many antibiotics. Why do you think these hospitals becoming
breeding grounds for these strains of bacteria? Why might this present a big problem?