Download Role of tumor necrosis factor alpha gene polymorphism in childhood

EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
El-Damarany & Saleh
TUMOR NECROSIS FACTOR ALPHA GENE POLYMORPHISM IN
BRONCHIAL ASTHMA CHILDREN
By
Eman El-Masry El-Damarany* and Abla Saleh**
Departments of *Medical Biochemistry, El-Minia Faculty of Medicine,
and **Pediatrics, Cairo Faculty of Medicine
ABSTRACT:
Bronchial asthma is a common disease with multiple determinants that include genetic
variation, environmental exposures, and gene–environment interactions. Tumor
necrosis factor alpha (TNF-α) has a role in asthma and wheezing pathophysiology.
Single nucleotide gene polymorphisms, may be important as genetic predisposition to
increase the production of TNF-α.
Aim: we aim to investigate whether genetic variation in TNF-α is associated with
asthma and wheezing and whether the association is related to the severity of the
disease and other epidemiological factors.
Methods and Results: Frequencies of TNF-a 308G/A polymorphism were compared
in 50 asthmatic children, 50 wheezy infants and 50 control school children. Genotype
frequencies for the TNF-a 308 G/A OR were significantly more in asthmatic children
from controls OR 0.4 95%CI (0.1 – 1.9) p <0.001 also a significantly higher
frequency of the GA polymorphism in wheezy infant compared to the control group
OR 0.2 95%CI (0.04 – 0.9) p <0.001.No association was found between the
polymorphism and the severity of the disease, the total eosinophil count and total IgE
in both groups.
Conclusion: We can conclude that genetic variation in TNF- α may contribute to
childhood asthma and wheezing, these findings may have implications for future early
intervention studies by helping to identify infants and children at increased risk for
wheezing and childhood asthma.
KEY WORDS:
TNF-α
Asthma, wheezes.
Single nucleotide polymorphism
with inflammatory response that
characterizes human asthma. One such
mediator is tumor necrosis factor alpha
(TNF-α), which has been implicated in
asthmatic inflammation by a broad
series of in vitro, ex vivo, in vivo and
genetic studies2.
INTRODUCTION:
Epidemiological studies have
firmly established a genetic component
of asthma disease. However, the genes
involved in asthma are still unknown
and are likely to be numerous1. Asthma
is recognized as a T-helper type 2
(Th2) disease with a particular profile
of cytokine release, including interleukin 4 (IL4) and interleukin 5 (IL5).
However, increasing evidence indicates that other cytokines, which were
classically considered to belong to
Th1-type profiles, are also associated
Several lines of evidences
indicate that high levels of TNF-α are
directly linked to asthmatic complications. The bronchial epithelial, endothelial and smooth muscle cells are the
primary targets of TNF-α. It causes
227
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
substantial damage in the normal
bronchial epithelial cells and the
bronchi of the allergic mouse model3.
In severe bronchial allergic inflammation TNF-α dependent leakage of
epithelial and endothelial cells may
have severe pathophysiological conesquences4. In bronchial smooth muscle
cells TNF-α dependent hyperplasia and
vasoconstriction are important.
El-Damarany & Saleh
PATIENTS AND METHODS:
Hundred and fifty children
were enrolled in this study. They were
divided into 2 main groups; the patient
group (100) and the control group (50).
the patient group was subdivided into
two groups; group I included 50 infant
wheezers up to, 2-yrs old admitted to
the hospital with ≥2 episodes of
persistent or recurrent wheeze; the
other group II included 50 asthmatic
children aged between 5–12 yrs. All
asthmatic patients had the clinical
symptoms and the physical examination compatible with asthma. The
patients were classified according to
disease severity as recommended by
the National Institutes of Health Expert
Panel Report9.
The TNF- alpha gene is located
within the class III region of the major
histocompatibility complex (MHC)
close to the HLA-B locus on chromosome 6p. A polymorphism in the
promoter region of theTNF- alpha gene
at nucleotide -308, relative to the
transcription start site, may be important in determining the host TNFalpha response5. There are two alleles
at the polymorphic site, TNF- alpha 308G (TNF1) and TNF- alpha -308A
(TNF2). In normal populations, TNFalpha -308G homozygosity is the
predominant genotype6. The TNF –
308A allele is of interest because it is
associated with increased in vitro
transcription of TNF and with
increased TNF levels in stimulated
human white blood cells7. A number
of studies have tried to determine
whether the polymorphism influences
TNF-α expression or susceptibility to
certain diseases. A recent review
suggested that the TNF- alpha -308G/
Apolymorphism does have a small, but
significant, functional effect, with the
A allele being associated with higher
constitutive and inducible levels of
transcription for TNF-α than the G
allele8.
All patients were recruited from
the outpatient department; Allergy
Clinic: New Children Hospital; Cairo
University. A full verbal and written
explanation of the study was given to
all family members; who gave their
consent and participated in this study.
Ethical approval was obtained from the
institutional review board of each
hospital.
Fifty age, gender and socioeconomic matching controls were
included in the study. Normal subjects
answered negatively to a screening
questionnaire for respiratory symptoms.
All children were subjected to the following:
o Complete clinical and physical
evaluation.
o Complete blood picture including
peripheral blood eonsinophil count,
measurement of total serum Ig-E
and TNF polymorphisms were
analyzed using PCR with sequence
specific primers (SSP). The
primers and protocols used were
based on those described by Perrey
et al.,10
The aim of the present study
was to investigate the genetics of TNFα production in terms of the TNFalpha -308 and their relationship to
childhood asthma and infant wheezing.
228
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
El-Damarany & Saleh
Taq DNA polymerase. The
amplification was accomplished by
35 cycles at 94°C for 30 s, 59°C for
30 s, 72°C for 30 s, and a final 10min extension at 72°C. After
amplification, a 20-µl aliquot of
digestion mixture containing 10 U
of NcoI (New England BioLabs,
Beverly, MA) was added to 20 µl
of PCR product and incubated at
37°C for at least 4 h. The -308G/A
alleles were differentiated by NcoI
restriction digestion (G allele, 87
and 20 bp; A allele, 107 bp.
Digested PCR fragments were
subjected to agarose gel electrophoresis (2%) and visualized by
ethidium bromide staining and UV
transillumination (Fig.1).
PROCEDURE:
o DNA
was
extracted
from
peripheral
blood
leukocytes.
Genotyping for the TNFα-G-308A
polymorphisms in genomic DNA
were analyzed by polymerase chain
reaction-restriction fragment length
polymorphism method.
o The primers sequences were: antisense
primer,
5'
TCTCGGTTTCTTCTCCATCG-3'
and
sense
primer,
5'
ATAGGTTTTGAGGGGCATGG3'. The reaction conditions used
were: 0.1 µg of genomic DNA in a
total volume of 20 µl of reaction
mixture containing 0.1 µM of each
primer, 200 µM of each dNTP,
20 mM Tris -HCl (pH, 8.4), 50 mM
KCl, 1.5 mM MgCl2, and 0.5 U of
Figure 1: NcoI digestion for the TNF- alpha -308 polymorphism. M indicates 100 bp
DNA molecular size marker. Lanes 1&2 are heterozygous (G/A); Lane 3 is
homozygous mutant (AA), lanes 4&5 are homozygous wild types (GG).
STATISTICAL METHODS:
Data was summarized as
mean±SD and percentage. NonParametric test (Mann Whitney U) was
used for analysis of two quantitative
variables as the data not symmetrically
distributed. Chi Square was used for
analysis of qualitative data. Logistic
regression was also done for detection
of risk factor of GA genotype in
wheezy infant and adult asthma in
relation to epidemiological and laboratory data.
P-value was consider
significant if ≤ 0.05
RESULTS:
The study included two groups;
group I included 50 infant wheezers
with age range was 4-24 month
(11.1±7.6), 10 males (20%) and 40
females (80%), 20% of patients had a
history of atopic dermatitis, while 20%
had a history of allergic rhinitis,
history of parental asthma was positive
in 40% of patients, 60% were exposed
to passive smoking due to parental
smoking, Family history of asthma was
positive in 48% of patients. (Table 1)
229
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
The group II (asthmatic group)
included 50 children whose age range
was 2-12 years (7.8±3.1), 30 patients
(60%) were suffering from mild persistent asthma, while the rest were
suffering from moderate persistent
asthma .Two patients had a history of
atopic dermatitis and two patients had
a history of allergic rhinitis. History of
parental asthma was positive in 18
patients, 28 patients had a positive
history of parental smoking, and only
32 patients had a positive family
history of asthma. (Table 1)
El-Damarany & Saleh
between the 2 groups with the wheezy
infant group (306.4±268.8) while the
asthmatic group (390.4±165.3), p=
0.09, also no significant difference was
found between the total IgE of both
groups with the wheezy infant group
(194.1±284.3) and asthmatic group
(377.3±105.2), p= 0.2. A significant
difference was found in the Hb, Ht (%)
as well as MCV where the wheezy
infant had a significantly lower Hb
8.3±1.2,
Ht(%)26.1±3.4,
MCV
60.9±6.8 compared to asthmatics Hb
10.5±1.5, Ht(%) 31.4±4.6, MCV
70.4±6.1, p =0.0001, 0.001, 0.0001
respectively. (Table 1)
The total eosinophil count
showed no significant difference
Table I: Demographic and clinical data of patients
VARIABLES
Age
Sex: (Males/ Females)
Atopic Dermatitis:%
Allergic Rhinitis: %
Parental Asthma: %
Passive Smoking: %
Family History%:
Disease Classification
WHEEZY INFANT
N = 50
11.1 ± 7.6 month
10/40
80%
Negative
20%
Positive
80%
Negative
20%
Positive
60%
Negative
40%
Positive
40%
Negative
60%
Positive
50%
Negative
50%
Positive
Onset of disease
<6 month: 42(84%)
>6month 8(16%)
CHILD ASTHMA
N= 50
7.8 ± 3.1 year
26/24
96%
4%
96%
4%
64%
36%
44%
56%
36%
64%
Mild persistent:
30 (60%)
Moderate persistent:
20(40%)
306.4 ± 268.8
390.4 ± 165.3
Eosinophil
count (mm3)
Total IgE (IU/ml) 194.1±284.3
Hematological Data
8.3 ± 1.2
Hb (gm/dl)
26.1 ± 3.4
Ht (%)
60.9 ± 6.8
MCV
*P-value is significant if ≤ 0.05
Genotype frequencies for the
TNF- alpha -308 polymorphism for
asthmatics and infant wheezers were
377.3 ± 105.2
10.5 ± 1.5
31.4 ± 4.6
70.4 ± 6.1
P-value
0.3
0.7
0.5
0.2
0.6
0.5
0.09
0.2
0.0001*
0.001*
0.0001*
significantly different from controls
(p<0.001; table2). GA polymorphism
in the wheezy infant occurred in 68%
230
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
of patients compared to the control
group which occurred in only 30% OR
0.2 95%CI (0.04 – 0.9), p<0.001,
meanwhile, the asthmatic group
showed a significant association with
the GA polymorphism occurring in 60
% of patients compared to the 30%
polymorphism of the control group OR
0.4 95%CI (0.1 – 1.9), p<0.001.
Wheezy infants also showed a
El-Damarany & Saleh
significantly lower homozygosity GG
in 28% of patients OR 6.3 95%CI (1.331.6), p<0.001 compared to the control
group where homozygous allele GG
occurred in 70 % of patients.
Asthmatic patients showed the
homozygous allele GG in 36% of
patients compared to the control group
70 % OR 3.1 95%CI (0.6 –15.5),
p<0.01.
Table 2: Comparison between TNF genotype frequency of wheezy infants and
children with asthma in relation to controls
WHEEZY INFANT
CHILD ASTHMA
CONTROL
N = 50
N = 50
N = 50
VARIABLES
N (%)
OR (95%CI)
N (%) OR (95%CI)
N (%)
2(4)
NS
2(4 )
NS
0(0)
AA
34(68)*
0.2(0.04 – 0.9) 30( 60)* 0.4(0.1 – 1.9)
15(30)
GA
14(28)*
6.3(1.3- 31.6) 18( 36)* 3.1 (0.6 –15.5)
35(70)
GG
* P<0.001 Indicate a significant difference with controls, p –values reflect the whole ratio
compared to control.
In a logistic regression analysis
we tested the association of the
polymorphism GA with different
epidemiological and laboratory data
in wheezy infant (table 3). Neither the
onset of wheeze nor the parental or
the family history of asthma and the
exposure to passive smoking was a risk
factor for the polymorphism (P-value:
0.2, 0.8, 0.5, and 0.9 respectively). The
polymorphism had also no effect on
the total eosinophil count and the total
serum IgE (P-value: 0.9 and 0.9
respectively).
Table 3: Logistic regression for detection of risk factor of GA genotype in wheezy
infant in relation to epidemiological and laboratory data.
VARIABLES
B
95% CI
Odds ratio
P-value
2.6764
0.1528 – 1382.6252
14.5333
0.2
Onset of wheeze (months)
-3.1023
0.0 – 483
0.0449
0.9
Eosinophil
0.1 –3.1273
0.0 – 9673
0.0438
0.9
Total IgE
1.4151
0.1340 – 126.5336
4.1170
0.4
Parental atopic dermatitis
-0.3160
0.0993 – 5.3519
0.7291
0.8
Parental asthma
0.0753
0.1507 – 7.7126
1.0782
0.9
Passive smoking
-2.3807
0.0081 – 1.0592
0.0925
0.5
Family history
o P-value is significant if ≤ 0.05.
o B: is the estimated logit coefficient
o Odds ratio = P/ (1-P). P is the probability that the event y occurs.
o C.I: Confidence interval (it is an interval in which a true population parameters fall).
o Dependant variables: GA genotype.
231
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
El-Damarany & Saleh
respectively. Family smoking wasn’t a
risk factor for the polymorphism (Pvalue: 0.8), nor was the polymorphism
associated to the severity of asthma (Pvalue: 0.3) or the total eosinophil count
and the total serum IgE (P-value: 0.9
and 0.9) respectively.
We also tested the association
of GA polymorphism with different
epidemiological and laboratory data in
children with asthma (table 4); the
polymorphism was not associated with
an early onset of wheeze (P-value:
0.9), or the parental and family history
of asthma (P-value: 0.6 and 0.4)
Table 4: Logistic regression for detection of risk factor of GA genotype in child
asthma to epidemiological and laboratory data
VARIABLES
B
95% C-I
Odds ratio
P-value
-50.0849
0.0 – 0.0
0.0
0.9
Onset of asthma (months)
0.1738
0.0 – 2686
1.1898
0.9
Eosinophil
0.2 0.1242
0.0162 – 79.0281
1.1322
0.9
Total IgE
-0.05377
0.0634 – 5.3819
0.5841
0.6
Parental asthma
0.3061
0.1487 – 12.4055
1.3582
0.8
Passive smoking
0.8957
0.2921 – 20.5326
2.4492
0.4
Family history
-1.1497
0.0367 – 2.7320
0.3167
0.3
Type of asthma
o P-value is significant if < 0.05.
o B: is the estimated logit coefficient
o Odds ratio = P/ (1-P). P is the probability that the event y occurs.
o C.I: Confidence interval (it is an interval in which a true population parameters fall).
o Dependant variables: GA genotype
polymorphisms in the TNF-α gene and
childhood asthma and infant wheezing
keeping us with some15-17 but not all
studies18.
DISCUSSION:
Although environmental factors
are clearly important determinants of
asthma, numerous studies have revealed
that asthma has a strong genetic
component but does not follow
monogenic patterns of inheritance11. For
a long time, asthma has been known to
cluster in families, and family studies
were the first to suggest that the disease
was genetically inherited. Many studies
of respiratory conditions have focused on
the G–308A polymorphism in the TNF
gene because of its associations with
inflammation and diseases, including
asthma12-14. To further investigate the
role of TNF in asthma occurrence, we
examined the associations of TNF G–
308A polymorphism with asthma and
infant wheezing. A definite relationship
was found in our study between the gene
Three explanations are possible
for an association between a candidate
gene and disease: 1) the candidate allele
is the relevant mutation in the disease
gene; 2) the allele is positioned very
close to the disease gene (linkage
disequilibrium); or 3) the association is
due to confounding by the allele frequency being higher in population
subgroups in which disease frequency is
also higher (population admixture)19.
The TNF-308A allele is a much stronger
transcriptional activator than the more
common G allele and is associated with
higher TNF production .The TNF-308A
allele leads to high binding affinity of
232
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
nuclear factors to the TNF promoter and
gives a high level of gene transcription.
Thus, observations from functional
studies suggest that the TNF-308A allele
is of biological significance20.
El-Damarany & Saleh
There is extensive linkage
disequilibrium on chromosome 622. The
TNF- α gene is located within the class
III region of the MHC close to the HLAB locus. The MHC is the most
polymorphic region of the genome and
there is strong linkage disequilibrium
within the MHC itself. Di-Somma et
al.,12 suggested that the association of
TNF- α 308A with asthma reflected
linkage disequilibrium with genes influencing a specific immune response.
Whilst studying haplotype and genotype
combinations may give more useful
results, if too many polymorphisms are
included, the subgroups become so
numerous that huge patient numbers are
required, otherwise statistical evaluation
becomes difficult. Diseases with a
complex genetic origin, such as asthma,
also may be characterized by pleiotropy
(the same genotype has different
phenotypes), genetic heterogeneity (the
same phenotype results from different
polymorphisms), and incomplete penetrance (the same polymorphism does not
always produce the same phenotype) 19.
For a candidate gene to
potentially be important in the disease, a
number of criteria must be met. First, the
gene protein product must be relevant to
the pathophysiology of the disease.
Second, the gene must contain mutations
within either the coding region or the
regulatory regions controlling gene
expression; these mutations need to be
functionally relevant. Third, functionally
relevant mutations should demonstrate
association and/or linkage with an
appropriate phenotype19.
The contrasting findings reported
in some of the published asthma studies,
may be related to number of potential
reasons for the discrepancies. First Many
of the published asthma studies are from
quite different population groups, which
could account for some of their different
findings, as the prevalence of polymerphisms within different racial groups is
often markedly different21 .Comparisons
of findings between different ethnic
groups may be irrelevant due to
population-specific masking of gene
variant effects, or gene-environment
interactions specific to one population22.
Another problem with genotype patient
studies is that of assessing whether any
association found with a disease state is
genuine or whether it is due to linkage
disequilibrium. This is the phenomenon
whereby combinations of alleles occur
together more or less often than expected
by chance alone, due to their positions
relative to each other on the gene. Any
association found with a particular
polymorphism may then be due to a
nearby polymorphism, which is in
linkage disequilibrium with the one
under scrutiny.
In our study polymorphism was
also found to be associated with infant
wheezing. We found a marked increase
in the proportion of TNF- α 308GA in
the wheezy infants (with a corresponding deficit of GG). Although the
current authors have no explanation for
this finding, it is believed to be a genuine
(biological) rather than genotyping error.
Azevedo et al.,23 demonstrated that
alveolar macrophages from infants with
recurrent episodes of wheezing, spontaneously generate increased amounts of
TNF- α when compared to controls
suggesting the presence of an ongoing
activation of alveolar macrophages in the
airways of wheezy infants, even during
asymptomatic periods. Our results are
the same like Biolikar et al.,6 another
study by Zhu et al.,24 looked at this
young age group, found, in contrast, that
TNF- α 308A was not a risk factor for
233
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
the development of asthma by 12 months
of age in 373 Canadian infants from
atopic families .The reason for this
variance may relate to the fact that only
12 out of 281 (4%) of their infants were
labeled as having "probable asthma".
Therefore, the numbers are rather small
for significant differences to be found.
El-Damarany & Saleh
Other inflammatory exposures
and conditions have the potential to
confound the relationship between the
TNF–308 polymorphisms and asthma.
Some that have been well described in
the literature include active personal
smoking, exposure to second-hand
smoke, indoors allergens, allergic
diseases, and family history of asthma.
Because of the consistent association
between parental smoking and childhood
asthma and the involvement of TNF in
cigarette smoke–induced inflammation
responses28, we examined the association
of TNF-α single nucleotide polymerphism with asthma stratified by exposure
to a smoking parent in the home.
Exposure to tobacco smoke was assessed
using questionnaire responses about
household sources and was not validated
by objective measurements such as
nicotine levels. However, the validity of
exposure estimates based on questionnaire responses has been investigated
and found to provide reasonably valid
estimates of exposure for adjustment for
confounding29. We encountered that
cigarette smoking wasn’t a risk factor for
the polymorphism, a study by Hao Wu et
al.,30 where the association was greater
among children without smoking parents
in the home. A recent study showed that
the TNF-308 polymorphism modified
the effect of home exposure to smokers
on respiratory illness-related school
absence among children mostly without
asthma31. A possible explanation for the
association of TNF polymorphisms with
asthma predominantly for children
without smoking parents is that the
exposure to secondhand smoke, which
increases TNF production, overwhelms
the smaller impact of TNF polymerphisms on TNF expression. Indeed,
expression levels of TNF are signifycantly increased in mice and humans
exposed to tobacco smoke28. These
environmental triggers may have
synergistic effects and overcome the
smaller effects of TNF polymorphisms.
We also tested the effect of the
GA polymorphism on the severity of the
disease; the possibility of a particular
association was examined for at least
two reasons. The first is that such an
association has been recently described
for a subgroup of severe inflammatory
bowel disease, the pathogenesis of which
may somehow resemble that of asthma25.
Secondly the inflammatory picture
within the airways of asthmatics, involving both eosinophil and neutrophil (as
opposed to the eosinophils alone in the
mild to moderate forms of the disease)
fits with a role for TNF- α that favors the
tissue recruitment of both type of
granulocytes partly through endothelial
expression of intercellular adhesion
molecule (ICAM)26. We studied the mild
versus the moderate asthmatic children
and our results fail to show any
preferential association between TNF2
and the severity of asthma, however our
study didn’t include patients with severe
asthma like other reports14 which studied
two grades of asthma severity (mild/
moderate versus severe) and failed to
elicit any association.
Chagani et al.,27 found that the
TNF-α 308A polymorphism was not
significantly more prevalent in 159
adults with fatal or near fatal asthma
compared with 92 with mild or moderate
asthma. It is perhaps not surprising that
the severity of asthma is not associated
with these TNF gene polymorphisms
given the multiple complex factors that
determine the severity of disease in any
individual.
234
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
Conversely, in the absence of secondhand smoke exposure, the influence of
TNF functional polymorphisms on TNF
expression may be greater, which could
explain our finding of stronger associations at lower levels of exposure. These
results suggest that the effects of genetic
variation in TNF may be more apparent
at lower levels of exposure to substances
such as secondhand smoke, which
strongly influence TNF expression.
El-Damarany & Saleh
risk may be important for future early
intervention studies.
Studying gene polymorphisms
may aid understanding of the pathophysiology of childhood wheezing, but
an overriding question is whether there
will be any practical or clinical use for it,
and particularly whether it will be useful
for an individual child. Most infant
wheezers grow out of their condition in
early childhood but some will end up
diagnosed with genuine asthma. It has
been suggested that early intervention
with inhaled corticosteroids may prevent
the development of asthma33 but clearly
it would be pointless to treat all wheezy
infants as in most cases the condition
will resolve spontaneously34. Therefore,
an identifiable marker that would
indicate whether an infant is likely to
develop genuine asthma would be most
useful. Perhaps this is where the study of
TNF alpha and other gene polymerphisms might have a role. Time and
further studies might shed light on this
area. The strategy for identifying
candidate genes offers opportunities to
further specify persons at increased risk
for susceptibility to allergic sensitization
(atopy), inflammation, bronchial hyper
reactivity, and severity of asthma
symptoms. Confirming the importance
of candidate asthma genes will enable
development of new diagnostic and
therapeutic tools and of prevention and
allergen avoidance strategies. Identification of candidate genes for asthma
will also permit more precise elucidation
of environmental risk factors operating at
different stages of asthma development.
The TNF-308 polymorphism has
been frequently studied in asthma and
atopy association studies because it has
direct functional effects on TNF gene
regulation. Our present data didn’t
demonstrate the polymorphism to be
associated with abnormally high eosinophil count or elevated total serum IgE,
a phenotype previously shown to be
linked to a mutation in the gene of FcR-l.
Our results are similar to those by Louis
et al.,1 Shin et al., 32 found no significant
associations were detected between the
polymorphism and peripheral blood
eosinophil percentage (%). In his
analyses of the association of TNF- α
polymorphisms with total serum IgE
levels, no significant associations were
detected, however homozygous minor
allele for TNFB+252A>G has been
associated with increased IgE. The TNFα polymorphism probably acts by
enhancing the inflammatory process
rather than modifying the IgE-mediated
allergic response.
CONCLUSION:
In conclusion, it was found that
genotype frequencies (%) of GA
polymorphisms that affected TNF-α
gene in wheezy infant and adult asthma
were significantly higher com-pared to
the control group, however it did not
seem to be related to the severity of
asthma or the exposure to parental
smoking or with the atopic state of the
patients. Identification of certain high-
REFERENCES:
1. Louis R, Leyder E, Malaise M,
Louis L, et al., Lack of association
between adult asthma and the tumour
necrosis factor alpha-308 polymor-phism
gene. Eur Respir J. 2000; 16(4):604-608.
2. Hyoung DS, Byung LP, Lyoung
HK, Hoe JW, Young JK, et al., Tumor
235
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
necrosis factor polymorphisms and
serum total IgE. Hum Molec Genet,
2005; 23(2): 39-40.
3. Srirupa M, John R H and Tapan
K M. Role of TNF-α in pulmonary
pathophysiology.
Respir Res. 2006;
7(1): 125-129.
4. Tillie-Leblond I, Guery BP, Janin
A, Leberre R, et al., Chronic bronchial
allergic inflammation incr-eases alveolar
liquid clearance by TNF-alpha-dependent mechanism. Am J Physiol Lung
Cell Mol Physiol. 2002; 283:L1303–
L1309.
5. Kroeger KM, Carville KS, and
Abraham LJ. The –308 tumor necrosis
factor-alpha promoter polymorphism
effects transcription. Mol Immunol
1997; 34: 391–399.
6. Bilolikar H, Nam AR, Rosenthal
M, Davies JC, et al., Tumor necrosis
factor genepolymorphisms and childhood wheezing. Eur Respir J 2005; 26:
637–646
7. Messer G, Spengler U, Jung MC,
Honold G, et .al. Polymorphic structure
of the tumor necrosis factor (TNF) locus:
an NcoI polymorphism in the first intron
of the human TNF-ß gene correlates
with a variant amino acid in position 26
and a reduced level of TNF-ß
production. J Exp Med 1991, 12:79-105.
8. Wilson AG, Symons JA,
McDowell TL, McDevitt HO, and Duff
GW. Effects of a polymorphism in the
human tumor necrosis factor-α promoter
on transcriptional activation. Proc Natl
Acad Sci USA 1997; 94:3195–3199
9. National Institutes of Health.
Expert panel report on guidelines for
diagnosis and management of asthma.
Bethesda, Md: National Heart, Lung,
and Blood Institute Information Center;
1997.
10. Perrey C, Turner SJ, Pravica V,
Howell WM, and Hutchinson IV.
ARMS-PCR methodologies to determine
IL-10, TNF-a, TNF-b and TGF-b1 gene
polymorphisms.Transpl Immunol 1999;
7: 127–128.
El-Damarany & Saleh
11. Bleecker ER, Postma DS,
Meyers DA. Evidence for multiple
genetic susceptibility loci for asthma.
Am J Respir Crit Care Med 1997;
156:S113–S116.
12. Di Somma C, Charron D,
Deichmann K, Buono C, et al., Atopic
asthma and TNF-308 alleles: linkage
disequilibrium and association ana-lyses.
Hum Immunol 2003;64:359–365
13. Mitsuta
K,
Matsuse
H,
Fukushima C, Kawano T, et al.,
Production of TNF-alpha by peripheral
blood mononuclear cells through
activation of nuclear factor kappa B by
specific allergen stimulation in patients
with atopic asthma. Allergy Asthma
Proc 2003; 24:19–26.
14. Noguchi E, Yokouchi Y,
Shibasaki M, Inudou M, et al.,
Association between TNFA polymerphism and the development of asthma in
the Japanese population. Am J Respir
Crit Care Med 2002;166:43–46.
15. Winchester EC, Millwood IY,
Rand L, Penny MA, et al.,. Association
of the TNF-α 308 (G-->A) polymorphism with self-reported history of
childhood asthma. Hum Genet 2000;
107:591–596.
16. Wang TN, Chen WY, Wang TH,
Chen CJ, et al., Gene-gene synergistic
effect on atopic asthma: tumour necrosis
factor-alpha-308
and
lymphotoxinalpha-NcoI in Taiwan's children. Clin
Exp Allergy 2004; 34:184–188.
17. Witte JS, Palmer LJ, O'Connor
RD, Hopkins PJ, Hall JM. Relation
between
tumour
necrosis
factor
polymorphism TNFalpha-308 and risk of
asthma. Eur J Hum Genet 2002; 10:82–
85.
18. Buckova D, Holla LI, Vasku A,
Znojil V, et al.,. Lack of association
between atopic asthma and the tumor
necrosis factor alpha-308 gene polymorphism in a Czech population. J
Investig Allergol Clin Immunol 2002;
12:192–197
236
EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009
El-Damarany & Saleh
α and angiotensin converting enzyme
polymorphisms in mild/moderate and
fatal/near-fatal asthma. Am J Respir Crit
Care Med 1999;160:278–282
28. Churg A, Wang RD, Tai H,
Wang
X,
et
al.,
Macrophage
metalloelastase mediates acute ciga-rette
smoke-induced inflammation via tumor
necrosis factor-alpha release. Am J
Respir Crit Care Med. 2003; 167:1083–
1089
29. Committee on the Assessment of
Asthma and Indoor Air. Clearing the air:
asthma
and
indoor
exposures.
Washington, DC: National Academy of
Sciences; 2000.
30. Hao W, Isabelle R, Juan-Jose S,
Blanca E. Parental Smoking Modi-fies
the Relation between Genetic Variation
in Tumor Necrosis Factor-α (TNF-α) and
Childhood Asthma. Envi-ron Health
Perspect.2007;115(4):616–622.
31. Wenten
M,
Berhane
K,
Rappaport EB, et al., TNF-308 modi-fies
the effect of second-hand smoke on
respiratory
illness-related
school
absences. Am J Respir Crit Care Med.
2005;172:1563–1568
32. Shin HD, Park BL, Kim LH, Jung
JH. Association of tumor necrosis factor
polymorphisms with asthma and serum
total IgE Human Molecular Genetics,
2004, 13 ( 4): 397-403
33. Pedersen S. Early use of inhaled
steroids in children with asth-ma. Clin
Exp Allergy 1997;27:995–999
34. Warner JO. The down-side of
early intervention with inhaled corticosteroids. Clin Exp Allergy 1997;27:999–
1001
19. Michael BB, Kathleen B,
Elizabeth T, David CC, et al.,. Genetic
and Perinatal Risk Factors for Asthma
Onset and Severity: A Review and
Theoretical Analysis Epidemiologic
Reviews 24:176-189 (2002).
20. Babu KS, Davies DE, Holgate
ST. Role of tumor necrosis factor alpha
in asthma. Immunol Allergy Clin North
Am. 2004; 24:583–597.
21. Hall I. Candidate gene studies in
respiratory disease: avoiding the pitfalls.
Thorax 2002; 57:377–378.
22. Bayley JP, Ottenhoff TH,
Verweij CL. Is there a future for TNF
promoter polymorphisms? Genes Immun
2004; 5:315–329.
23. Azevedo L, de Blic J, Dumarey
CH, Scheinmann P. Increased spontaneous release of tumour necrosis
factor-αby alveolar macrophages from
wheezy infants Eur Respir J 1997; 10:
1767–1773
24. Zhu S, Chan-Yeung M, Becker
AB, et al., Polymorphisms of the IL-4,
TNF-α, and Fc RIß genes and the risk of
allergic disorders in at-risk infants. Am J
Respir Crit Care Med 2000; 161:1655–
1659
25. Louis E, Peeters M, Franchimont
D, et al., Tumor necrosis factor gene
polymorphism in Crohn's disease:
influence on disease beha-viour? Clin
Exp Immunol 2000;119: 64-68.
26. Lukacs NW, Strieter RM,
Chensue SW, Widmer M, et al., TNFalpha mediates recruitment of neutronphilsand eosinophils during airway
inflammation. J Immunol 1995; 154:
5411-54517.
27. Chagani T, Pare PD, Zhu S, et
al., Prevalence of tumor necrosis factor-
237
‫‪El-Damarany & Saleh‬‬
‫‪EL-MINIA MED., BULL., VOL. 20, NO. 1, JAN., 2009‬‬
‫تعدد األشكال الجينية لعامل النخر الورمي‪-‬ألفا‬
‫في األطفال المصابين بالربو الشعبي‬
‫إيمان المصري الدمراني* – عبلة صالح**‬
‫أقسام *الكيمياء الحيوية الطبية‪ -‬كلية طب المنيا ‪-‬‬
‫و**األطفال‪ -‬كلية طب القاهرة‬
‫يعتبر الربو الشعبي من األمراض الشائعة ذات العوامل المتعددة والتيي تشيمل اتاليتال اليينيي‬
‫‪,‬التعرض للعوامل البيئية وتداالل عوامل البيئة والوراثية ويلعيب عاميل النالير اليورمي دورا يي‬
‫اإلحداث المرضي للربو الشعبي‪.‬‬
‫َحري عما إذا كان اتالتال الييني الوراثي ِ ي عامل النالر‬
‫والغرض من هذه الدراسة هو الت ّ‬
‫الييورمي يتييرت َب ت‬
‫ط بييالربو و أزيييز التيينفع و عمييا إذا كييان هييذا اترتبيياط يتعل ي بحييدة المييرض‬
‫والعوام ِل الوبائية األالرى‪.‬‬
‫وقد قورنيت تيرددات الشيكل المتعيدد لعاميل النالير يي المسيين طفيا مريابين بيالربو الشيعبي و‬
‫المسين رضيعا مرابين بأزيز التنفع باإلضا ة إلي المسيين تلمييذ مدرسية كميموعية ضيابطة‪.‬‬
‫هذا وقيد وييد أن تيرددات البنيية اليينيية لعاميل النالير اليورمي كانيت أكثير يي مرضيي الربيو‬
‫الشعبي عنها يي الميموعية الضيابطة وكيذل يي ميموعية أزييز التينفع عنهيا يي الميموعية‬
‫الضابطة ولم يويد ارتباط بين تعدد الشكل الييني و حيدة الميرض والعيدد الكليي للالاييا المحبية‬
‫لارطباغ باأليوسين والبروتين المناعي(‪)IgE‬‬
‫ومن هذه الدراسة َيستنت تج أ َ ْن اتالتال الييني الوراثي ِ قي عامل النالر الورمي قَي ْد يتسياه تم يي‬
‫ت التييد ّال ِل المب ّكيير ِة‬
‫ربييو الطفوليي ِة و أزيييز التيينفع ل وهييذه النتييائجِ لَ تربومييا لَهييا مضييمون لدِراسييا ِ‬
‫الالطير المتزايي ِد لربيو الطفوليةَ و أزييز‬
‫عدَة لت َميييز الرضيا واألطفيا ِل مين ذوي‬
‫سيا َ‬
‫المستقبلي ِة بال تم َ‬
‫ِ‬
‫التنفع‪.‬‬
‫‪238‬‬