* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download ppt
Non-coding DNA wikipedia , lookup
Primary transcript wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Population genetics wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Neocentromere wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Genome (book) wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
X-inactivation wikipedia , lookup
BRCA mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Koinophilia wikipedia , lookup
Genetic code wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Microevolution wikipedia , lookup
Oncogenomics wikipedia , lookup
To demonstrate understanding, after this lesson, you should be able to define mutations explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals recognize point (N-base) mutations (insertions, deletions and substitutions) recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation) I. Mutations …are any change in the DNA of an organism. May not have any affect or may cause a major deformation, illness. I. Mutations …are any change in the DNA of an organism. May not have any affect or may cause a major deformation, illness. I. Mutations Any change in DNA is a mutation. caused by mistakes during… DNA replication of mitosis Transcription meiosis Also can be caused by environmental factors like… Radiation Carcinogens Mutations in Reproductive (Sex) Cells VS. Body cells -Mutations in sex cells a.k.a. gametes (sperm and egg cells) can be passed down to a person’s children, but might not affect the parent -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems II. Cancer as a result of mutations in body cells: II. Cancer as a result of mutations in body cells: Carcinogensenvironmental/chemical factors that cause cancer Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!! III. Gene Mutations Point Mutation only 1 codon is affected example: “substitution mutation” AUC GGA UCC AUC CGA UCC THE FAT CAT WAS MAD THE FUT CAT WAS MAD III. Point mutation mRNA Normal Protein Stop Replace G with A mRNA Point mutation Protein Stop Point mutations in our lives! -Sickle cell anemia is a blood disease caused by a SUBSTITUTION point mutation. -A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu Point mutations in our lives! -People with sickle cell anemia often experience a lot of pain and swelling and have trouble exercising. IV. More Gene Mutations Frameshift Mutations – will affect several if not all of the following codons! (MAJOR PROBLEM!) Example: “Deletion” – one base was left out. AAU CGA GGA … AAC GAG GA… (What is missing?) AAU CGA GGA … AAC GAG GA… IV. Frameshift mutation -A frameshift mutation is when one nucleotide is inserted or deleted from the DNA or mRNA strand. -A frameshift mutation is worse…. WHY??? Ex: DNA TACTTCAAACCGCGTAACATT mRNA Protein Difference between a substitution mutation and a frameshift mutation. substitution THE FAT CAT WAS MAD… THE FAC ATW ASM AD… Deletions cause a shift in the codons…just like leaving a letter out, it makes no sense! Other Frameshift Mutations: “Insertion” – an extra base is added. ACC GAU GUC… ACU CGA UGU C… (What was added?) ACC GAU GUC… ACU CGA UGU C… THE FAT CAT WAS MAD THE FAD TCA TWA SMA D… Once again, this makes no sense! Questions: Is this a substitution mutation or a frameshift mutation? -It’s a substitution mutation because G was replaced with a T! Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Substitution or frameshift? Substitution! Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Substitution or frameshift? Frameshift! The mutated sentence makes no sense (non-sense) and thus the protein will not be made Chromosome Mutations …are usually damaging. An entire piece of a chromosome may be deleted, moved or damaged. ALL INFORMATION ON THE AFFECTED SECTION MAY BE LOST OR FOREVER CHANGED (and is useless). Types of Chromosome Mutations Deletion – the whole chromosome is gone! Duplication – now you have 2 sets of the same stuff. Inversion – one part of a chromosome gets moved to another area on the SAME chromosome. Translocation – a section of a chromosome is stuck on a DIFFERENT chromosome Chromosome Mutations Summarizing define Can you… mutations explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals recognize point (N-base) mutations (insertions, deletions and substitutions) recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation)