* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download File
Western blot wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Fatty acid metabolism wikipedia , lookup
Fatty acid synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Peptide synthesis wikipedia , lookup
Metalloprotein wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Proteolysis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transfer RNA wikipedia , lookup
Biochemistry wikipedia , lookup
» DNA has been transcribed and a strand of messenger RNA has been created. It has been modified (5’cap, polyA tail, introns removed) and leaves the nucleus to enter the cytoplasm » DNA has two strands but only one of them gets transcribed. That strand is called the template strand or the antisense strand » The other strand is called the sense strand . It is not transcribed but it will have the same sequence of bases that the mRNA molecule has » The only difference is that Uracil will replace Thymine on the mRNA strand » When you look at a sequence of bases on a strand of DNA or RNA it just looks like a big mess. » AGTCCCGATACAGGTCATGGCAAT…….. » So what do all these letters mean?? » It took a while, but biologists were able to crack the DNA code and figure out what it all meant » Key findings 1. 2. 3. The sequence of bases determines the sequence of amino acids in a protein The code is setup so that a groups of three bases codes for an amino acid There are also codes to communicate wheren protein synthesis should begin and when it should end » The three letter sequences that code for an amino acid are called codons » Since there are 4 bases (AUC and G) and each codon has three bases, there are 4e3 or 64 possible codons. » There are only 20 amino acids so each amino acid had more than one codon » Also, there are specific start and stop codons » What sequence of amino acids is represented by the sense strand with the following DNA sequence? » ATGCTTACCGGGCTGAACGACGAGTTCTAA » Here is the DNA sequence from the previous slide » ATGCTTACCGGGCTGAACGACGAGTTCTAA First, separate the bases into three base codons: ATG CTT ACC GGG CTG AAC GAC GAG TTC TAA Next, look at the chart from a previous slide and see what each codon represents. Note: The chart shows RNA codons so you will have to change Us to Ts ATG CTT ACC GGG CTG AAC GAC GAG TTC TAA Met Leu Thr Gly Leu Asn Asp Glu Phe STOP! » So now that we know the code, how does the protein get made? » Answer: » Let’s start with the things we need: ˃ ˃ ˃ ˃ ˃ Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomes (also made of RNA) Enzymes (aminoacyltRNA synthetase) Amino acids » mRNA leaves the nucleus and stretches out in the cytoplasm » A ribosome, which is a two sectioned structure finds the promoter codon AUG on the mRNA strand » Meanwhile, a different type of RNA called Transfer RNA (tRNA) looks to attach to the ribosome and the mRNA tRNA looks like this: » It has several folds » It has a site where an amino acid can attach. The one that attaches depends on its anticodon » It has a three base sequence that is complimentary to that of the mRNA codon (called an anticodon). » An enzyme (aminoacyl tRNA synthetase) attaches the proper amino acid to the tRNA molecule. » Example; CUU on mRNA codes for leucine. Therefore a tRNA molecule with the anticodon GAA (complimentary to CUU) will attach to a leucine amino acid » The tRNA-amino acid complex attaches to the P site of the ribosome. » The tRNA molecule at the front of the mRNA strand will be Methionine since AUG codes for Methionine and that is also the start code. So every protein starts with methionine when it is translated » Now, the ribosome moves over one codon a new tRNA will attach to the A site. » Note that the first amino acid left the tRNA and attached to the next one » The ribosome continues to move down the mRNA strand. Each time it does, the amino acids on the tRNA in the P site will detach and join the amino acid on the A site. Soon a long chain of amino acids form. » The tRNA that has lost its amino acid will enter the E site of the ribosome and leave the mRNA to search for another amino acid » When the ribosome reaches a termination codon on the mRNA (UAA, UAG or UGA) it will stop the translation process » The chain of amino acids, called a polypeptide, will be released. It then undergoes some posttranslational processing in the golgi bodies and is transported via the endoplasmic reticulum (ER) » Ribosomes that are free, usually make proteins that are needed in the cell, while ribosomes that are bound to the ER usually make proteins that are secreted out of the cell(e.g. hormones) » Now watch this » https://www.youtube.com/watch?v=5bLEDdPSTQ » The process of translation determines the sequence of amino acids in a protein. However, a protein is much more than just a string of amino acids. A protein has a unique 3 dimensional shape that determines it’s function » The sequence of amino acids in a protein is only one way to describe its structure. It is called the Primary Structure of a protein. » After the primary structure is formed, the polypeptide can form an alpha helix » Or it can combine with another polypeptide to form a beta pleated sheet » These structures are stabilized by hydrogen bonds » These bonds occur between a hydrogen atom on the amino group of one amino acid and the oxygen on the carboxyl group that has a double bond to carbon » After the polypeptide has formed its secondary structure, it will fold itself up in a unique way » Distant amino acids on the same chain will form hydrogen bonds, ionic bonds and even covalent bonds (in the case of cysteine) » In this representation of a globular protein, both the secondary structure (alphahelix) and the tertiary structure can be seen. » Finally, most proteins consist of several polypeptides that combine together in a highly specific way to form the final structure. The interaction between amino acids on different polypeptides makes up the quaternary structuer