Download Kerr et al 2016_04_08 - OPUS at UTS

Chlamydia, escaping a fate worse than death
Markus C. Kerr1, Guillermo A. Gomez1, Charles Ferguson1, Maria C. Tanzer2,3,
James M. Murphy2,3, Alpha S. Yap1, Robert G. Parton1, Wilhelmina M. Huston 4 and
Rohan D. Teasdale1*
AFFILIATIONS:
1. Institute for Molecular Bioscience, The University of Queensland, St Lucia,
Queensland, Australia.
2.
Australia.
kville, Victoria,
Australia.
4. i3 Institute, University of Technology, Sydney, New South Wales, Australia.
(*) CORRESPONDING AUTHOR:
Rohan Teasdale, PhD
Institute for Molecular Bioscience
The University of Queensland
St. Lucia, QLD 4072
AUSTRALIA
E-MAIL: [email protected]
PHONE: 61-7-3346-2056
RUNNING TITLE: Calpains mediate chlamydial egress
HIGHLIGHTS:

Chlamydial egress is primarily mediated by the host.

Chlamydia-induced cell death is independent of BAK, BAX, RIP1 and
caspase activity.

Calpains regulate chlamydial inclusion rupture required for chlamydia
egression but not host cell death.
1
5/05/17
Summary
Remarkably little is known about how intracellular pathogens exit the host cell in
order to infect new hosts. Pathogenic Chlamydia spp. egress by first rupturing their
replicative niche, the inclusion, before rapidly lysing the host cell. We developed a
unique laser ablation strategy to specifically disrupt the chlamydial inclusion thereby
uncoupling inclusion rupture from the subsequent cell lysis. Using this approach we
define a novel role for the host cell calpains in inclusion rupture, but not subsequent
cell lysis. Further, with genome-editing technologies we demonstrate that chlamydial
egress is mediated by a rapid non-apoptotic non-necroptotic cell death pathway
independent of BAK-, BAX-, RIP1- and caspase-activity. Both inclusion rupture and
rapid host cell death work in concert to efficiently liberate the pathogen from the host
cytoplasm, thereby minimising exposure to damaging reactive oxygen species,
promoting subsequent secondary infection and in doing so reconcile the pathogen's
established capacity to promote cell survival and induce cell death as required.
2
5/05/17
Introduction
Chlamydia trachomatis is the most prevalent bacterial sexually transmitted infection
amongst humans and is the leading cause of infectious blindness worldwide. As an
obligate intracellular pathogen, Chlamydia maintains exquisite control over an
assortment of host cellular processes during its dimorphic infectious cycle. Most
prominent amongst these is the formation of an intracellular replicative niche from the
host cell’s membrane trafficking pathways (Elwell and Engel, 2012) and the profound
pro-survival influence its presence elicits during the replicative phase of infection
(Fan et al., 1998; Sharma and Rudel, 2009).
Chlamydia invades host cells as a non-replicative Elementary Body (EB) through the
action of a Type 3 Secretion System (T3SS) that serves to deliver bacterial effector
molecules to modulate the host’s membrane trafficking and cytoskeletal elements.
Once intracellular, Chlamydia alters the encompassing vacuole to create its replicative
niche, called an inclusion, where it transitions into its metabolically active replicative
Reticulate Body (RB) form. During the later stages of the pathogen’s life-cycle,
Chlamydia asynchronously transforms back into its EB form before it egresses from
the cell in one of two mechanisms. Pioneering work by Hybiske and Stephens (2007)
reported that the chlamydial inclusion is either extruded intact from the cell or
ruptures immediately prior to cell lysis (Hybiske and Stephens, 2007). The extrusion
mechanism is an actin-dependent process (Hybiske and Stephens, 2007) recently
reported to be coordinated by the actions of myosin phosphatase, myosin light chain 2
(MLC2), myosin light chain kinase (MLCK), and myosin IIA and IIB (Lutter et al.,
2013) and septins (Volceanov et al., 2014).
3
5/05/17
Whilst extrusion is speculated to contribute to evasion of the host immune response
and long-distance dissemination, release of the EBs to infect new host cells ultimately
necessitates lysis of both the inclusion and limiting membrane of the cell and/or
extrusion. Hybiske and Stephens (2007) demonstrated the requirement for cysteine
protease activity during rupture of the inclusion using the pan-cysteine protease
inhibitor E-64 and intracellular calcium for the subsequent lysis of the limiting
membrane and release of the Chlamydia into the extracellular milieu (Hybiske and
Stephens, 2007). The asynchronous nature of chlamydial egress has, however,
impeded further dissection of the process and remarkably little is known about the
molecular events involved, particularly the identity of the cysteine proteases involved
in inclusion rupture. Here we have applied a novel laser-ablation approach to dissect
the molecular events regulating release of the pathogen following inclusion rupture.
Whilst maintaining its established anti-apoptotic influence upon the cell, chlamydial
inclusion rupture triggers a programmed necrotic cell death pathway, that rapidly
liberates the pathogen from the destructive cytoplasm. This process is triggered
independent of the stage of infection and in the presence of inhibitors of bacterial
protein synthesis suggesting that it is regulated by the host rather than orchestrated by
the pathogen. We reveal a novel role for host calpains in inclusion rupture but not cell
lysis highlighting the host’s pivotal role in regulating this process.
4
5/05/17
Results
Inclusion rupture is directly coupled to chlamydial egress
Hybiske and Stephens (2007) demonstrated that the chlamydial inclusion ruptures
immediately prior to cell lysis during the later stages of infection (Hybiske and
Stephens, 2007). We recapitulate this observation in a HeLa reporter cell line stably
expressing mCherry-tagged Rab25 to monitor the integrity of Chlamydia trachomatis
strain LGVII (CTL2) inclusions throughout the infection (Teo et al., 2016), CFPHistone 2-B to highlight the nuclei and soluble GFP to mark the cytoplasm. From ~36
hours post-infection (h p.i.) the inclusions of infected cells begin to rupture, denoted
by the loss of inclusion integrity and influx of cytoplasmic GFP into the inclusion
lumen (asterisk) leading to an overall dimming of the GFP-fluorescence, in an
asynchronous manner before loss of cellular plasma membrane integrity from 1530min post-inclusion rupture (Fig. 1A). Notably the nuclei of cells following
inclusion rupture general maintain their overall structure, condensing moderately
prior to cell lysis (arrows). Although the kinetics of the lytic process post-rupture
were extremely consistent, inclusion rupture was observed in a stochastic manner
anywhere from 36-72h p.i. Whilst it is recognised that cysteine protease activity is
required for inclusion rupture and intracellular calcium signalling is intrinsic to
subsequent cell lysis (Hybiske and Stephens, 2007) the manifest asynchronous nature
of inclusion rupture has proven refractory to more detailed investigation of the
molecular events involved in chlamydial egress. Here we have applied a unique 2photon ablation system (Gomez et al., 2015) to specifically rupture the chlamydial
inclusion (reticle) without damaging the plasma membrane of the cell thereby
5
5/05/17
allowing us to reliably interrogate the process in high resolution and uncouple
inclusion rupture from subsequent cell lysis (Fig. 1B).
HeLa cells stably expressing mCherry-Rab25 were seeded onto imaging plates,
transfected with soluble GFP and infected with CTL2 for 48h p.i. The cells were
imaged live on a line scanning confocal microscope for 3 frames before a 0.6μm3
region of the inclusion was ablated (reticule) and the samples imaged further (Fig.
1B). Consistent with native egress, immediately following ablation the inclusion is
observed to fill with soluble GFP before it is observed to collapse in a manner similar
to that observed previously using mechanical disruption (Heinzen and Hackstadt,
1997). Maintenance of the plasma membrane’s integrity during the ablation was
affirmed as the soluble GFP was observed to fill the inclusion (leading to an overall
dimming) but remain within the cell. From 15-30 minutes following inclusion rupture,
ablated cells are observed to bleb extensively, before contracting and releasing the
contents of their cytoplasm into the extracellular milieu. Notably, throughout this
process the overall structure of the nucleus is maintained with some degree of
condensation similar to that observed during native lysis observed (Fig. 2B, arrows).
Surprisingly, ablation of inclusions in HeLa cells infected for 24h p.i. with GFPexpressing CTL2 also triggered cell death and lysis (Fig. 1C). Whilst the initiation of
cell death was modestly delayed, once initiated, the cells appeared to die with similar
kinetics to those ablated at 48h p.i. suggesting that the cell death pathway involved is
not dependent upon stage of infection. The consequences of inclusion ablation upon
cell survival were quantified for 10 cells in the presence of cellular and bacterial
inhibitors and at different stages of infection (Fig 1D). As in native egress, post-
6
5/05/17
inclusion ablation-triggered lysis of the cell was sensitive to intracellular calcium
signalling (Hybiske and Stephens, 2007) as ablation of inclusions in 24h p.i. cells precultured for 1h in calcium-free Ringer's solution supplemented with 1,2-bis(2aminophenoxy)ethane-N,N,N′,N′-tetraacetate (BAPTA)-acetoxymethyl (-AM) ester
resulted in sustained viability of cells (Fig 1D & E). Bacterial protein synthesis was
not required to trigger cell death as treatment of cells with 100μg/ml chloramphenicol
from 24h p.i. did not impact upon ablation-triggered cell death response, nor did the
stage of infection, suggesting that it is the host that drives the lytic process rather than
the pathogen (Fig. 1D). Notably it was recently suggested that the secreted chlamydial
protease-like activity factor (CPAF) accumulates within the chlamydial inclusion and
is released upon rupture so that it may target vimentin intermediary filaments and
components of the nuclear envelope for degradation (Snavely et al., 2014). Live
imaging of 2xGFP-tagged vimentin following laser-mediated inclusion rupture
recapitulated this observation with a rapid dissolution of filamentous structures and a
rapid translocation of 2xGFP-tagged vimentin into the nucleus. 2xGFP-vimentin
dissolution was blocked in the presence of a CPAF inhibitor (PMID: 21767809)
following inclusion rupture (Supplementary Fig. 1). Consistent with observations
made using a CPAF-null chlamydial strain (Snavely et al., 2014) inhibition of CPAF
activity did not block cell lysis following inclusion rupture.
Thus the lytic cell death observed subsequent to inclusion ablation mirrors the
kinetics and has the molecular features observed during native inclusion rupture.
Surprisingly, however, cell lysis occurs regardless of the stage of infection at which
the inclusion is disrupted and in the presence of bacterial protein synthesis and
7
5/05/17
protease inhibitors suggesting that the mechanism by which the cell death occurs and
therefore subsequent chlamydial egress is primarily coordinated by the host (Fig 1D).
Importantly, the specificity of the induced cell death response to rupture of the
inclusion is evinced by the observation that ablation of mCherry-Rab25-labelled
endosomal membranes swollen in the presence of the endosomal trafficking inhibitor
YM201636 (Jefferies et al., 2008), in both infected and uninfected cells, does not
trigger the cell death response (Fig. 1F). Laser-ablation of chlamydial inclusions
therefore represents a directed means to trigger chlamydial egress in a controlled
fashion uncoupled from the contribution of the pathogen itself. Furthermore, inclusion
ablation mid-way through the intracellular development of the pathogen allows one to
examine the subsequent molecular events involved in high resolution without the
confounding impact of the profound metabolic burden or morphological distortion the
pathogen places upon the cell at the later stages of infection.
Premature inclusion rupture is detrimental to chlamydial development
Our system provides unparalleled spatial and temporal resolution and the means to
examine the consequences of inclusion rupture at the individual infected cell and
subcellular level in isolation. Initially correlative light and electron microscopy was
employed to compare the intraluminal environment of intact and ablated inclusions
between and within infected cells thereby providing internal controls for the protocol.
Once again, time-lapse videomicroscopy revealed the rapid condensation and
immobilisation of ablated 24h p.i. inclusions when compared with intact inclusions
prior to fixation 10 minutes post-ablation and processing for transmission electron
microscopy (Fig. 2A). Electron micrographs of these particular inclusions
8
5/05/17
demonstrated that, whilst intact inclusions present characteristic spacious arrangement
of chlamydial RBs in an electron-lucent lumen (Fig. 2B cell 1), the RBs of ablated
inclusions are compacted against one another in a tight arrangement with cytosol
distributed between them (Fig. 2B cell 2). Intriguingly, there was also evidence of RB
swelling in the ablated inclusions suggestive of a destructive impact of inclusion
rupture upon the pathogen (Fig. 2B cell 2, arrows). Given that the lumen of the
chlamydial inclusion shares most biophysical properties in common with the
cytoplasm and there is a free exchange of cytoplasmic ions (Grieshaber et al., 2002),
we considered whether this bactericidal impact may reflect exposure to typically
excluded reaction oxygen species (ROSs) now freely accessing the bacteria from the
cytoplasm. Indeed, infection with C. trachomatis is recognised to induce the
production of ROSs early in infection with subsequent inaction of the host’s NADPH
oxidase suggesting that the pathogen actively suppresses ROS production to promote
infection (Boncompain et al., 2010). Paradoxically, inhibiting ROS production during
chlamydial infections also supresses the growth of the bacteria suggesting that the
pathogen requires host-derived ROS for optimal growth (Abdul-Sater et al., 2010). To
examine this more directly, CTL2-infected mCherry-Rab25 cells were imaged live
and the inclusion membranes ablated 24 h p.i. in the presence of CellROX® Green, a
fluorogenic probe that exhibits bright fluorescence upon oxidation by ROSs. It was
immediately apparent that the ROS probe did not detect and ROSs within the
chlamydial inclusion (Fig. 2C & 2D). Strikingly, ablation of the inclusion yielded a
dramatic accumulation of CellROX® Green fluorescence within the inclusion
indicating oxidation by ROSs. This was confirmed using the antioxidant, Nacetylcysteine to quench ROS-mediated oxidation in ablated cells (data not shown).
9
5/05/17
ROSs are generated as by-products of cellular metabolism, primarily in the
mitochondria (Starkov, 2008). We used our ablation system to monitor the
mitochondria of cells immediately following inclusion rupture (Fig. 2E). Strikingly,
we observed swelling and eventual dimming of Mitotracker® Red CMXRos-stained
mitochondria (arrows) following inclusion ablation suggesting a transition in
mitochondrial permeability. In addition, we observed accumulation of the
Mitotracker® fluorescence within the inclusion following inclusion rupture indicating
the now ready access of the thiol-reactive dye to the pathogen once the inclusion
membrane is compromised. Thus we now provide direct evidence that the chlamydial
inclusion provides a protective barrier to bactericidal concentrations of cytosolic
ROSs and that inclusion rupture triggers mitochondrial swelling, likely elevating
cytosolic ROSs concentrations still further. Exposure to ROSs clearly damages the
delicate RBs, and possibly also the more robust EBs, hence necessitating the rapid
release of the pathogen through a lytic cell death pathway to ensure viability of the
infectious progeny.
Inclusion rupture-induced Cell Death is not apoptotic
The calcium-dependent and highly coordinated nature of the rupture-induced cell
lysis is suggestive of a Programmed Cell Death (PCD) pathway (Fuchs and Steller,
2015; Scorrano et al., 2003). There are, however, discordant views on the contribution
of PCDs in chlamydial infection biology. Whilst Vats and colleagues suggest that
caspase-dependent PCD, or classical apoptosis, is prominent amongst Chlamydiainfected primary cervical epithelial cells (Vats et al., 2010), Schoier et al (2001)
report that apoptosis does not appear to be the primary mode of death for infected
10
5/05/17
cells within in vitro culture systems, rather it is prominent amongst the neighbouring
uninfected cells (Schoier et al., 2001). We demonstrate that the nuclear ultrastructure
of cells in which inclusions have ruptured appear to be, for the most part,
indistinguishable from those with intact inclusions (compare nuclei of cell 1 with cells
2 & 3 of Fig. 2B) lacking the characteristic condensation and peripheralisation of
chromatin (pyknosis) observed in classically apoptotic cells. They do, however,
present blebbing of the plasma membrane, cleavage of vimentin (Supplementary Fig.
1) and swelling of mitochondria (Fig. 2E), which are all prominent features of
apoptosis (Byun et al., 2001). This prompted us to investigate the mechanism by
which the cells were dying more thoroughly.
The caspases are a family of cysteine proteases integral to apoptosis and cysteine
protease activity has been demonstrated to be required for inclusion rupture and
consequently chlamydial egress (Hybiske and Stephens, 2007). Our laser-mediated
approach also allows us to uncouple the events both prior to and following inclusion
rupture with fidelity. Among the caspases, caspase 3 is a frequently activated death
protease catalysing the cleavage of many cellular proteins. To monitor caspase 3
activity in cells in which the inclusion had been ruptured we initially employed a
Förster Resonance Energy Transfer (FRET)-based reporter sensor that encodes a
caspase 3 cleavage linker sequence DEVD, Casper3-GR (Evrogen). Following
ablation of the chlamydial inclusion, cells presented sustained FRET signal
suggesting that that the caspase 3 cleavage linker was maintained (Fig. 3A). Under the
same imaging conditions, a striking loss in FRET signal was observed following
induction of apoptosis with 100ng/ml TNFα and 10μg/ml cycloheximide for 4h (data
11
5/05/17
not shown) demonstrating the efficacy of the commercial probe. Furthermore,
treatment of cells with the pan-caspase inhibitor carbobenzoxy-valyl-alanyl-aspartyl[O-methyl]- fluoromethylketone (Z-Vad-fmk, 50μM) did not inhibit ablationtriggered cell death (Fig 3B) or native egress of the pathogen (Fig. 3C). Similarly,
treatment with the caspase 1 selective inhibitor, VX-765, did not inhibit inclusion
rupture-triggered death (Supplementary Fig. 2A) or native egress of the pathogen
(Supplementary Fig. 2B).
The Bcl-2 family of proteins constitute critical control points in the intrinsic and
extrinsic apoptotic pathways (Danial and Korsmeyer, 2004). Ordinarily, pro-apoptotic
BAX resides in the cytosol or is loosely associated with membranes but, in response
to death signals, is inserted into the mitochondrial outer membrane as a homooligomerised multimer resulting in mitochondrial dysfunction. Similarly, in healthy
cells, an interaction between the voltage-dependent anion channel protein 2 (VDAC2)
with inactive pro-apoptotic BAK keeps this lethal molecule in check at the
mitochondrion. In response to stress signals, this interaction is displaced allowing
BAK to homo-oligomerise causing mitchondrial dysfunction. In both cases, formation
of the so-called Mitochondrial Outer Membrane Pore (MOMP) results in leakage of
mitochondrial content which in turn activates initiator and downstream effector
caspases. To definitively rule out apoptosis and to examine whether the observed
mitochondrial swelling was a consequence of BAK and/or BAX activity, we applied
CRISPr technology to block formation of the MOMP by selectively disrupting BAK
and/or BAX in HeLa cells (Figure 3D). Cells knocked out for BAK and BAX are
established to be intrinsically resistant to be intrinsic and extrinsic apoptotic stimuli as
12
5/05/17
well as selected necrotic stimuli (Karch et al., 2013). Consistent with these
observations our BAK/BAX double-knockout cells as well as those treated with ZVad-fmk showed complete insensitivity to extrinsic and intrinsic apoptotic stimuli
(Supplementary Fig. 3). Interestingly, however, ablation-triggered and native egress
were not inhibited in these cells even with the addition of 50μM Z-Vad-fmk. Taken
together the events subsequent to chlamydial inclusion rupture and ultimately egress
of the pathogen are not BAK/BAX- or caspase-dependent and is therefore not
classical apoptosis.
Chlamydial egress is not mediated through a necroptotic Programmed Cell Death
Given the apparently caspase-independent nature of chlamydial inclusion ruptureinduced PCD in what are accepted to be apoptosis-resistant infected cells (Sharma
and Rudel, 2009), we next investigated the likelihood that the mechanism may be
necrotic. The highly responsive and triggerable nature of the death as well as its
dependence upon intracellular calcium suggested that the pathway could be
programmed necrosis or “necroptosis” (Murphy and Silke, 2014). Necroptosis occurs
when cells, in which apoptosis signalling has been blocked, are exposed to deathinducing stimuli and is mediated through the action of kinase Receptor Interacting
Proteins (RIPs) 1 and 3. RIP1 and RIP3 form supramolecular complexes called the
necrosomes which in turn lead to the activation of the mixed lineage kinase domainlike protein (MLKL) by RIP3-mediated phosphorylation causing it to homooligomerise (Hildebrand et al., 2014; Wang et al., 2014). Oligomerised MLKL
translocates to the plasma membrane of the cell where it compromises its ability to
preserve intracellular ionic homeostasis. Necroptosis is inhibited by necrostatin-1, a
13
5/05/17
small molecule inhibitor of RIP1 kinase (Degterev et al., 2008). To determine if the
cell death pathway in question is necroptosis, ablation-triggered and native egress
were examined in the presence of this agent and the rate at which cells died
monitored. Interestingly, treatment with necrostatin-1 did not delay cell death in
either circumstance (Supplementary Fig. 2). To definitively rule out necroptosis,
CRISPr-mediated knockout of RIP1 in HeLa and BAK/BAX double-knockout HeLa
cells was performed (Figure 3D) and both ablation-triggered and native egress
examined (Fig. 3B and 3C). Similar to the observations made earlier, ablationtriggered and native egress progressed normally in these cells. The egress of the
pathogen is therefore distinct from the established apoptotic and necroptotic PCDs.
Calpains mediate inclusion rupture
Our laser ablation approach provides us with the unique opportunity to uncouple
inclusion rupture from cell death in a coordinated manner. Intriguingly treatment of
chlamydia infected cells with calpain inhibitors, 100μM calpeptin (Fig 4A) or
PD150606 (data not shown), led to significant persistence of intact chlamydial
inclusions leading to dramatic expansion when compared to control infections.
Eventual inclusion rupture still initiated cell lysis in spite of calpain inhibition (Fig.
4B) as well as ablation-mediated inclusion rupture-induced cell death (Fig. 4C)
indicating that calpain activity was required only for the first stage of chlamydial
egress. Liberation of EBs into the extracellular milieu was measured by conducting
infectious progeny assays using media sampled from cells in the presence and
absence of calpeptin at 72 h p.i. (Fig. 4D & 4E). A marked reduction in extracellular
EBs was observed in calpain-inhibited cells when compared with those treated with
14
5/05/17
the carrier solvent. Notably, cell lysates treated with calpain inhibitors presented
similar numbers of infectious EBs indicating that calpain inhibition did not adversely
impact the pathogen directly (Fig. 4D & 4E). Therefore, calpains are key regulators of
chlamydial inclusion rupture but not the consequent cell death or the pathogen’s
growth.
15
5/05/17
Discussion
In order to propagate an infection, the obligate intracellular pathogen, Chlamydia
trachomatis, must lyse the cell or encompassing extrusion in order to infect new cells.
The resultant cellular damage and inflammation is likely responsible for the localised
scarring and blockage of the fallopian tubes leading to infertility and for the acute
pelvic inflammatory disease frequently associated with infection. Yet, it has long been
recognised that Chlamydia-infected cells are insensitive to both extrinsic and intrinsic
apoptotic stimuli (Fan et al., 1998) and this resistance is requisite for the completion
of the pathogen’s unique dimorphic lifecycle. The resistance to apoptosis appears to
be acquired by a variety of mechanisms including degradation of a key regulator of
apoptosis P53 (Gonzalez et al., 2014; Siegl et al., 2014), but notably, Chlamydia
infected HeLa cells exhibit a marked reduction in caspase 8 enzyme activity (Bohme
et al., 2010). Activated caspase 8 propagates apoptotic signalling by either directly
cleaving and activating downstream effector caspases or by cleaving the BH3 Bcl2interacting protein (BID) which translocates to the mitochondria and induces leakage
of cytochrome c. We, however, find no evidence of effector caspase activation
infected cells during native chlamydial egress or following inclusion rupture and
treatment with pan-caspase inhibitors does little to preserve cell or inclusion integrity
of infected cells (Fig. 3A, B &C). We did, however, observe preservation of
neighbouring uninfected cell integrity during chlamydial egress when caspase activity
was inhibited (Fig. 3C and Supplementary Fig. 2B) consistent with in vivo
observations that suggest a role for caspase activity in Chlamydia-induced infertility
(Igietseme et al., 2013). Consistent with this, whilst caspase 1-deficient mice display
much reduced genital tract inflammatory damage following chlamydial infection, the
16
5/05/17
mice experienced similar courses of infection indicating that caspase 1 does not play a
direct role in establishment and progression of the infection (Cheng et al., 2008).
How then does Chlamydia kill host cells? In contrast with Perfettini et al (2002), who
observed that BAX translocates to mitochondria in Chlamydia psittaci-infected cells
and that BAX-inhibitor 1 or Bcl-2 expression perturbs C. psittaci-induced caspaseindependent “apoptosis” (Perfettini et al., 2002), here we find that HeLa cells
genome-edited to be profoundly resistant to apoptosis and/or necroptosis through the
selected and iterative deletion of BAK, BAX, and RIP1 as well as in the presence of
pan-caspase and necroptosis inhibitors still die with the same kinetics as control cells
(Fig. 3B & 3C). Whether this disparity with the work of Perfettini et al (2002) reflects
a biological variance unique to the different species of Chlamydia used in the
respective studies remains to be clarified but our data conclusively demonstrates that
the pathway in question is not apoptotic. Recently, RIP3-independent necroptotic
pathways have been described including one that is induced in response to alkylating
DNA-damage agents such as N-methyl-N′-nitro-N′-nitrosoguanidine (MNNG) and
involves the sequential activation of poly(ADP-ribose) polymerase 1 (PARP-1),
calpains, BAX and AIF (Moubarak et al., 2007). Intriguingly, Chlamydia trachomatis
was recently recognised as a DNA damaging agent (Chumduri et al., 2013) and DNA
strand breaks are associated with loss of plasma membrane integrity and organelle
dilation at the later stages of the infection with Chlamydia pneumoniae (Marino et al.,
2008). The chlamydial inclusion rupture-triggered cell death is, however, distinct
from this pathway as HeLa cells do not express RIP3 endogenously (He et al., 2009)
and undergo death independently of BAX (Fig. 3B & 3C).
17
5/05/17
We find that Chlamydia-induced cell death is calcium-dependent, occurs regardless of
when in the infection the chlamydial inclusion ruptures and in the presence of
bacterial protein synthesis inhibitors indicating that the lytic process is largely
directed by the host cell (Fig. 1D & 3C). Moreover, our laser-ablation approach
allows us to uncouple inclusion rupture from the subsequent cell death with
unparalleled spatio-temporal resolution and provides the means to examine the action
of specific proteases in the events leading to and following inclusion rupture and cell
lysis without disrupting the pathogen. Notably, application of a small molecule
inhibitor of the chlamydial protease-like activity factor (CPAF) had no impact on
inclusion rupture or cell death and lysis, but served to maintain the integrity of host
cell intermediary filaments as observed by monitoring vimentin-2xGFP in intact live
cells (Supplementary Fig. 1). There has been significant controversy surrounding the
action of this particular chlamydial protein of late owing to a widely published postcell lysis in vitro artefact (Chen et al., 2012). Although degradation of vimentin was
clearly refuted, a more recent publication in which CPAF was genetically deleted
from the pathogen provided evidence for a role in post-inclusion rupture disassembly
of vimentin-positive intermediary filaments (Snavely et al., 2014). Our observations
directly support this proposal.
What precisely is released from the inclusion following rupture and therefore triggers
the events that lead to cell death is unknown. Indeed the chlamydial inclusion is a
unique environment which contains an assortment of cellular and bacterial material.
Amongst these are likely a huge array of Pathogen-associated molecular patterns
18
5/05/17
(PAMPs) and danger signals, many of which could trigger a necrotic response like
that observed in this study. Necrosis is marked by an elevation in ROSs and
mitochondrial hyperpolarisation but is independent of both caspase activation and
RIP1 (Vanden Berghe et al., 2010): all features observed or consistent with our
observations following chlamydial inclusion rupture. Notably, C. trachomatis L2 does
encode the Chlamydia protein associating with death domains (CADD) (StennerLiewen et al., 2002). Whilst this protein is reported to bind and activate elements of
the host’s apoptotic pathway in vitro, its function has never been examined in vivo. It
would be interesting to monitor the rate of egress and inclusion rupture-triggered cell
death in CADD-null strains should they prove viable.
Finally, whilst inhibition of host caspases had no impact upon inclusion rupture or
cell lysis, inhibition of host cell calpains lead to a dramatic extension in inclusion
integrity without interfering with cell death indicating that calpain-activation is
selectively necessary for chlamydial inclusion lysis. Calpains are a large family of
ubiquitous calcium-sensitive non-lysosomal cysteine proteases responsible for a wide
variety of cellular processes. Our observation is therefore entirely consistent with and
extends upon Hybiske and Stephens’ (2007) original observation that application of a
pan-cysteine protease inhibitor cocktail inhibited inclusion rupture (Hybiske and
Stephens, 2007) and is the first reported role for calpains in chlamydial infection.
Further investigation should reveal whether they represent a viable target for
therapeutic intervention during chlamydial infection.
19
5/05/17
In summary, we have developed a unique laser-ablation method that enables us to
trigger the ordinarily stochastic rupture of the chlamydial inclusion in a controlled and
predictable manner. This has enabled us to segregate the molecular events and
contributions of both the pathogen and the host during chlamydial egress in a
spatiotemporal manner. Specifically, we demonstrate that the subsequent lytic cell
death pathway observed in Chlamydia infected cells occurs independent of stage of
infection, BAK-, BAX-, RIP1- and caspase-activity and provide further evidence for a
role for the chlamydial effector CPAF in the disassembly of intermediate filaments
following inclusion rupture. Our method highlights the barrier function played by the
inclusion membrane, protecting the encompassed bacteria from cytosolic ROSs, and
thereby highlights the necessity for the pathogen to rapidly escape from the cytoplasm
following inclusion rupture via a non-apoptotic/necroptotic mechanism. Finally we
reveal a novel role for host calpains in the rupture of the chlamydial inclusion but not
the subsequent lytic cell death pathway opening new avenues for investigation.
20
5/05/17
Experimental Procedures
Constructs and reagents
CellROX® Green and MitoTracker® Red were supplied by Life Technologies.
Calpeptin, PD150606, Necrostatin-1, carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]fluoromethylketone (Z-Vad-fmk) and VX-765 were supplied by Merck Millipore.
4',6-diamidino-2-phenylindole (DAPI), paraformaldehyde and N-acetyl-L-cysteine
were supplied by Sigma Aldrich. H2B-CFP used was as described previously
(Beronja et al., 2010), Addgene plasmids: 25998). Casper3-GR was supplied by
Evrogen. BAK, BAX and RIP1 polyclonal antibodies were supplied by Cell
Signalling Technology. β-tubulin antibodies were supplied by Li-Cor.
Cell culture, transfection and generation of stable genome-edited and knockout
lines
HeLa cells were maintained in DMEM supplemented with 10% (v/v) FCS and 2mM
L-glutamine (Invitrogen) in a humidified air/atmosphere (5% CO2) at 37oC. Genomeediting was performed through the sequential generation of stably expressing
mCherry-Cas9 cells followed by the delivery of target specific gRNAs (Aubrey et al.,
2015)
in
the
FH1tUTG
lentiviral
vector
system.
BAK
gRNA:
GGCCATGCTGGTAGACGTGT. BAX gRNA: TCTGACGGCAACTTCAACTG
(Gong, Huang et al submitted). RIP1 gRNA: AGTGCAGAACTGGACAGCGG.
Clonal populations of cells were isolated by Fluorescence Assisted Cell Sorting.
Chlamydial infection and infectious progeny assay
21
5/05/17
Chlamydia trachomatis L2 (ATCC VR-902B) and GFP-expressing Chlamydia
trachomatis L2 were generated as described previously (Wang et al., 2011).
Chlamydia was used to infect cells at the indicated multiplicity of infection (MOI).
Cells were infected for 2 h in normal DMEM growth media supplemented with 10%
FCS (v/v) and 2mM L-glutamine at 37oC humidified with 5% CO2. After which the
media was replaced with fresh growth media and grown to the stipulated time points.
Infectious progeny assays were performed as previously described (Gonzalez et al.,
2014).
Time-lapse videomicroscopy
For long-term live cell imaging, monolayers were cultured in 35 mm glass‐bottom
dishes (MatTek) or 96 well glass-bottom microplates. Time‐lapse videomicroscopy
was carried out on individual live cells using a Nikon Ti-E inverted deconvolution
microscope using a ×40, 0.9 Plan Apo DIC objective, a Hamamatsu Flash 4.0 4Mp
sCMOS monochrome camera and 37°C incubated chamber with 5% CO2. CFP was
excited with a 438/24nm LED and captured using a 579/40nm emission filter, GFP
was excited with a 485/20nm LED and captured using a 525/30nm emission filter,
mCherry was captured using a 560/25nm LED and captured using a 607/36nm
emission filter.
Laser ablation and confocal time-lapse videomicroscopy
Ablation experiments were performed on an LSM 510 meta Zeiss confocal
microscope at 37°C. Images were acquired using a ×63 objective, 1.4 NA oil Plan
Apochromat immersion lens at ×1.5 digital magnification, with the pinhole adjusted
22
5/05/17
to 3 Airy units to obtain optical sections 2μm thick. Time-lapse images were acquired
before (3-5 frames) and after ablation with an interval and duration as indicated. A
Ti:sapphire laser (Chameleon Ultra, Coherent Scientific) tuned to 790nm was used to
ablate subcellular regions using a constant 12x12 pixel ROI (~0.5-1μm3) was marked
for each experiment and ablated with 1 iteration of a 790nm laser with 65%
transmission. GFP and mCherry fluorescence intensities were monitored before and
after the ablation using a 488nm or 543nm laser for excitation and a 500–550nm or
>560nm emission filters respectively. Donor and Acceptor FRET channels were
acquired using a 488nm laser and emission was collected in the donor emission range
(BP 500-530nm) and acceptor emission range (LP >560nm), respectively.
Correlative Light and Electron Microscopy (CLEM)
For CLEM, cells were seeded and imaged on gridded glass bottom-dishes (MatTek).
Prior to high resolution time-lapse videomicrosopy, low magnification images of the
cells to be examined were captured to obtain their coordinates so that they could be
identified during EM processing. Immediately post-acquisition, cells were fixed in
2.5% glutaraldehyde in PBS and processed for flat embedding in resin (Parton et al.,
1992). After curing, the resin containing the cells was broken away from the plastic
dish. Cells of interest were located by reference to the grid coordinates transferred
onto the resin. 60nm sections were cut parallel to the substratum and imaged after ongrid staining in a Jeol (Tokyo, Japan) 1011 transmission electron microscope.
Western Immunoblotting
23
5/05/17
Infected and uninfected cell monolayers were lysed directly with SDS lysis buffer
(100 mM Tris/HCL, pH 6.8, 4% SDS, 20% glycerol, 0.02% bromophenol blue, 200
nM dithhiothreitol) and immediately boiled at 95oC for 10 min. Equal amounts of
protein were loaded, resolved on 10% SDS-polyacrylamide gels and transferred onto
Immobilon-FL PVDF membranes (Millipore, USA) according to the manufacturer’s
instructions. Western immunoblotting using ECL was performed as described
previously (Yang et al., 2015).
Apoptosis and Cell Survival Assays
Extrinsic and intrinsic apoptosis was induced through the application of 50ng/ml
recombinant human TNFα (ORF Genetics) and 10 µg/ml cycloheximide (Sigma
Aldrich) or 2 µg/ml staurosporine (Sigma Aldrich). Cells were incubated for 24 h
until fixation with 4% paraformaldehyde in phosphate buffered saline (PBS). Cell
viability was determined by monitoring the presence of soluble mCherry-Cas9 using a
Nikon Ti-E inverted deconvolution microscope using a ×40, 0.9 Plan Apo DIC
objective, a Hamamatsu Flash 4.0 4Mp sCMOS monochrome camera. Single cell live
imaging of caspase 3 activity was conducted using the caspase 3 apoptosis sensor
Casper3-GR as per manufacturer’s instructions (Evrogen).
24
5/05/17
Author Contributions
MCK designed and conducted all of the experiments, wrote the manuscript and
constructed the figures. GG and ASY assisted in the development and optimisation of
the laser-ablation protocol employed throughout the manuscript and provided useful
input into the manuscript. CF and RP conducted the correlative light and electron
microscopy presented in Figure 2. DS, MCT and JMM developed, optimised and
supplied the CRISPr and gRNA technology presented in Figure 3. WM provided
chlamydia strains and useful input into the manuscript. RDT designed experiments
and wrote the manuscript.
25
5/05/17
Acknowledgments
This work was supported by funding from the National Health and Medical Research
Council (NHMRC) of Australia (606788) and the Australian Research Council
(DP150100364). MCK was supported by an Australian Research Council Discovering
Early Career Researcher Award (DE120102321). MCT was supported by a Victorian
International Research Scholarship. The NHMRC provided fellowship support to
JMM (APP1105754), ASY (APP1044041), RGP (APP569542), and RDT
(APP1041929). RGP and ASY also acknowledge support from NHMRC Program
Grant (APP1037320). DS, MCT and JMM acknowledge support from NHMRC
IRIISS (grant 9000220) and Victorian Government Operational Infrastructure Support
schemes. The authors acknowledge the facilities, and the scientific and technical
assistance, of the Australian Microscopy & Microanalysis Research Facility at the
Centre for Microscopy and Microanalysis, The University of Queensland, and the
Australian Cancer Research Foundation (ACRF)/Institute for Molecular Bioscience
(IMB) Dynamic Imaging Facility for Cancer Biology. Finally, we thank David Segal,
David Huang, John Silke and Marco Herold (
Medical Research, Australia) for reagents and helpful discussions in the preparation
of this manuscript.
26
5/05/17
References
Abdul-Sater, A.A., Said-Sadier, N., Lam, V.M., Singh, B., Pettengill, M.A., Soares,
F., Tattoli, I., Lipinski, S., Girardin, S.E., Rosenstiel, P., et al. (2010). Enhancement
of reactive oxygen species production and chlamydial infection by the mitochondrial
Nod-like family member NLRX1. J Biol Chem 285, 41637-41645.
Aubrey, B.J., Kelly, G.L., Kueh, A.J., Brennan, M.S., O'Connor, L., Milla, L.,
Wilcox, S., Tai, L., Strasser, A., and Herold, M.J. (2015). An inducible lentiviral
guide RNA platform enables the identification of tumor-essential genes and tumorpromoting mutations in vivo. Cell Rep 10, 1422-1432.
Beronja, S., Livshits, G., Williams, S., and Fuchs, E. (2010). Rapid functional
dissection of genetic networks via tissue-specific transduction and RNAi in mouse
embryos. Nat Med 16, 821-827.
Bohme, L., Albrecht, M., Riede, O., and Rudel, T. (2010). Chlamydia trachomatisinfected host cells resist dsRNA-induced apoptosis. Cell Microbiol 12, 1340-1351.
Boncompain, G., Schneider, B., Delevoye, C., Kellermann, O., Dautry-Varsat, A., and
Subtil, A. (2010). Production of reactive oxygen species is turned on and rapidly shut
down in epithelial cells infected with Chlamydia trachomatis. Infect Immun 78, 8087.
Byun, Y., Chen, F., Chang, R., Trivedi, M., Green, K.J., and Cryns, V.L. (2001).
Caspase cleavage of vimentin disrupts intermediate filaments and promotes apoptosis.
Cell Death Differ 8, 443-450.
Chen, A.L., Johnson, K.A., Lee, J.K., Sutterlin, C., and Tan, M. (2012). CPAF: a
Chlamydial protease in search of an authentic substrate. PLoS Pathog 8, e1002842.
27
5/05/17
Cheng, W., Shivshankar, P., Li, Z., Chen, L., Yeh, I.T., and Zhong, G. (2008).
Caspase-1 contributes to Chlamydia trachomatis-induced upper urogenital tract
inflammatory pathologies without affecting the course of infection. Infect Immun 76,
515-522.
Chumduri, C., Gurumurthy, R.K., Zadora, P.K., Mi, Y., and Meyer, T.F. (2013).
Chlamydia infection promotes host DNA damage and proliferation but impairs the
DNA damage response. Cell Host Microbe 13, 746-758.
Danial, N.N., and Korsmeyer, S.J. (2004). Cell death: critical control points. Cell 116,
205-219.
Degterev, A., Hitomi, J., Germscheid, M., Ch'en, I.L., Korkina, O., Teng, X., Abbott,
D., Cuny, G.D., Yuan, C., Wagner, G., et al. (2008). Identification of RIP1 kinase as a
specific cellular target of necrostatins. Nat Chem Biol 4, 313-321.
Elwell, C.A., and Engel, J.N. (2012). Lipid acquisition by intracellular Chlamydiae.
Cell Microbiol 14, 1010-1018.
Fan, T., Lu, H., Hu, H., Shi, L., McClarty, G.A., Nance, D.M., Greenberg, A.H., and
Zhong, G. (1998). Inhibition of apoptosis in chlamydia-infected cells: blockade of
mitochondrial cytochrome c release and caspase activation. J Exp Med 187, 487-496.
Fuchs, Y., and Steller, H. (2015). Live to die another way: modes of programmed cell
death and the signals emanating from dying cells. Nat Rev Mol Cell Biol 16, 329-344.
Gomez, G.A., McLachlan, R.W., Wu, S.K., Caldwell, B.J., Moussa, E., Verma, S.,
Bastiani, M., Priya, R., Parton, R.G., Gaus, K., et al. (2015). An RPTPalpha/Src
family kinase/Rap1 signaling module recruits myosin IIB to support contractile
tension at apical E-cadherin junctions. Mol Biol Cell 26, 1249-1262.
28
5/05/17
Gonzalez, E., Rother, M., Kerr, M.C., Al-Zeer, M.A., Abu-Lubad, M., Kessler, M.,
Brinkmann, V., Loewer, A., and Meyer, T.F. (2014). Chlamydia infection depends on
a functional MDM2-p53 axis. Nat Commun 5, 5201.
Grieshaber, S., Swanson, J.A., and Hackstadt, T. (2002). Determination of the
physical environment within the Chlamydia trachomatis inclusion using ion-selective
ratiometric probes. Cell Microbiol 4, 273-283.
He, S., Wang, L., Miao, L., Wang, T., Du, F., Zhao, L., and Wang, X. (2009).
Receptor interacting protein kinase-3 determines cellular necrotic response to TNFalpha. Cell 137, 1100-1111.
Heinzen, R.A., and Hackstadt, T. (1997). The Chlamydia trachomatis parasitophorous
vacuolar membrane is not passively permeable to low-molecular-weight compounds.
Infect Immun 65, 1088-1094.
Hildebrand, J.M., Tanzer, M.C., Lucet, I.S., Young, S.N., Spall, S.K., Sharma, P.,
Pierotti, C., Garnier, J.M., Dobson, R.C., Webb, A.I., et al. (2014). Activation of the
pseudokinase MLKL unleashes the four-helix bundle domain to induce membrane
localization and necroptotic cell death. Proc Natl Acad Sci U S A 111, 15072-15077.
Hybiske, K., and Stephens, R.S. (2007). Mechanisms of host cell exit by the
intracellular bacterium Chlamydia. Proc Natl Acad Sci U S A 104, 11430-11435.
Igietseme, J.U., Omosun, Y., Partin, J., Goldstein, J., He, Q., Joseph, K., Ellerson, D.,
Ansari, U., Eko, F.O., Bandea, C., et al. (2013). Prevention of Chlamydia-induced
infertility by inhibition of local caspase activity. J Infect Dis 207, 1095-1104.
Jefferies, H.B., Cooke, F.T., Jat, P., Boucheron, C., Koizumi, T., Hayakawa, M.,
Kaizawa, H., Ohishi, T., Workman, P., Waterfield, M.D., et al. (2008). A selective
29
5/05/17
PIKfyve inhibitor blocks PtdIns(3,5)P(2) production and disrupts endomembrane
transport and retroviral budding. EMBO Rep 9, 164-170.
Karch, J., Kwong, J.Q., Burr, A.R., Sargent, M.A., Elrod, J.W., Peixoto, P.M.,
Martinez-Caballero, S., Osinska, H., Cheng, E.H., Robbins, J., et al. (2013). Bax and
Bak function as the outer membrane component of the mitochondrial permeability
pore in regulating necrotic cell death in mice. Elife 2, e00772.
Lutter, E.I., Barger, A.C., Nair, V., and Hackstadt, T. (2013). Chlamydia trachomatis
inclusion membrane protein CT228 recruits elements of the myosin phosphatase
pathway to regulate release mechanisms. Cell Rep 3, 1921-1931.
Marino, J., Stoeckli, I., Walch, M., Latinovic-Golic, S., Sundstroem, H., Groscurth,
P., Ziegler, U., and Dumrese, C. (2008). Chlamydophila pneumoniae derived from
inclusions late in the infectious cycle induce aponecrosis in human aortic endothelial
cells. BMC Microbiol 8, 32.
Moubarak, R.S., Yuste, V.J., Artus, C., Bouharrour, A., Greer, P.A., Menissier-de
Murcia, J., and Susin, S.A. (2007). Sequential activation of poly(ADP-ribose)
polymerase 1, calpains, and Bax is essential in apoptosis-inducing factor-mediated
programmed necrosis. Mol Cell Biol 27, 4844-4862.
Murphy, J.M., and Silke, J. (2014). Ars Moriendi; the art of dying well - new insights
into the molecular pathways of necroptotic cell death. EMBO Rep 15, 155-164.
Parton, R.G., Schrotz, P., Bucci, C., and Gruenberg, J. (1992). Plasticity of early
endosomes. J Cell Sci 103 ( Pt 2), 335-348.
Perfettini, J.L., Reed, J.C., Israel, N., Martinou, J.C., Dautry-Varsat, A., and Ojcius,
D.M. (2002). Role of Bcl-2 family members in caspase-independent apoptosis during
Chlamydia infection. Infect Immun 70, 55-61.
30
5/05/17
Schoier, J., Ollinger, K., Kvarnstrom, M., Soderlund, G., and Kihlstrom, E. (2001).
Chlamydia trachomatis-induced apoptosis occurs in uninfected McCoy cells late in
the developmental cycle and is regulated by the intracellular redox state. Microb
Pathog 31, 173-184.
Scorrano, L., Oakes, S.A., Opferman, J.T., Cheng, E.H., Sorcinelli, M.D., Pozzan, T.,
and Korsmeyer, S.J. (2003). BAX and BAK regulation of endoplasmic reticulum
Ca2+: a control point for apoptosis. Science 300, 135-139.
Sharma, M., and Rudel, T. (2009). Apoptosis resistance in Chlamydia-infected cells: a
fate worse than death? FEMS Immunol Med Microbiol 55, 154-161.
Siegl, C., Prusty, B.K., Karunakaran, K., Wischhusen, J., and Rudel, T. (2014).
Tumor suppressor p53 alters host cell metabolism to limit Chlamydia trachomatis
infection. Cell Rep 9, 918-929.
Snavely, E.A., Kokes, M., Dunn, J.D., Saka, H.A., Nguyen, B.D., Bastidas, R.J.,
McCafferty, D.G., and Valdivia, R.H. (2014). Reassessing the role of the secreted
protease CPAF in Chlamydia trachomatis infection through genetic approaches.
Pathog Dis 71, 336-351.
Starkov, A.A. (2008). The role of mitochondria in reactive oxygen species
metabolism and signaling. Ann N Y Acad Sci 1147, 37-52.
Stenner-Liewen, F., Liewen, H., Zapata, J.M., Pawlowski, K., Godzik, A., and Reed,
J.C. (2002). CADD, a Chlamydia protein that interacts with death receptors. J Biol
Chem 277, 9633-9636.
Teo, W.X., Kerr, M.C., Huston, W.M., and Teasdale, R.D. (2016). Sortilin is
associated with the chlamydial inclusion and is modulated during infection. Biol
Open.
31
5/05/17
Vanden Berghe, T., Vanlangenakker, N., Parthoens, E., Deckers, W., Devos, M.,
Festjens, N., Guerin, C.J., Brunk, U.T., Declercq, W., and Vandenabeele, P. (2010).
Necroptosis, necrosis and secondary necrosis converge on similar cellular
disintegration features. Cell Death Differ 17, 922-930.
Vats, V., Agrawal, T., Salhan, S., and Mittal, A. (2010). Characterization of apoptotic
activities during chlamydia trachomatis infection in primary cervical epithelial cells.
Immunol Invest 39, 674-687.
Volceanov, L., Herbst, K., Biniossek, M., Schilling, O., Haller, D., Nolke, T.,
Subbarayal, P., Rudel, T., Zieger, B., and Hacker, G. (2014). Septins arrange F-actincontaining fibers on the Chlamydia trachomatis inclusion and are required for normal
release of the inclusion by extrusion. MBio 5, e01802-01814.
Wang, H., Sun, L., Su, L., Rizo, J., Liu, L., Wang, L.F., Wang, F.S., and Wang, X.
(2014). Mixed lineage kinase domain-like protein MLKL causes necrotic membrane
disruption upon phosphorylation by RIP3. Mol Cell 54, 133-146.
Wang, Y.B., Kahane, S., Cutcliffe, L.T., Skilton, R.J., Lambden, P.R., and Clarke,
I.N. (2011). Development of a transformation system for Chlamydia trachomatis:
restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector. PLoS
pathogens 7.
Yang, Z., Soderholm, A., Lung, T.W., Giogha, C., Hill, M.M., Brown, N.F., Hartland,
E., and Teasdale, R.D. (2015). SseK3 Is a Salmonella Effector That Binds TRIM32
and Modulates the Host's NF-kappaB Signalling Activity. Plos One 10, e0138529.
32
5/05/17
Figure Legends:
Figure 1: Laser-mediated inclusion rupture triggers chlamydial egress. A) Timelapse videomicroscopy of GFP-expressing mCherry-Rab25 and CFP-H2B stable
HeLa cells imaged from 36h p.i. with CTL2 (MOI~0.5). Presented is a single egress
even captured from 49 h p.i. Arrows highlight the nuclei and asterisks the inclusion.
Interval of capture was 5 min. B) Diagram of inclusion ablation system and timelapse videomicroscopy of the system applied on mCherry-Rab25 stable HeLa cells 48
h p.i. with GFPCTL2 (MOI~0.5). Arrows highlight the nuclei, asterisks the inclusion
and arrow heads blebbing of the plasma membrane. Interval of capture is as indicated.
C) Time-lapse videomicroscopy of mCherry-Rab25 stable HeLa cells ablated 24h p.i.
with GFPCTL2 (MOI~0.5). Arrows highlight the nuclei and arrow heads blebbing of
the plasma membrane. Interval of capture is as indicated. D) Quantification of cell
survival of ablated and unablated cells under the conditions as indicated. >10 cells
were quantified for each condition. E) Time-lapse videomicroscopy of mCherryRab25 stable HeLa cells ablated either 24h p.i. with GFPCTL2 (MOI~0.5) in
calcium-free Ringer’s solution and 50μM BAPTA-AM. Interval of capture is as
indicated. F) Time-lapse videomicroscopy of mCherry-Rab25 stable HeLa cells
ablated 24h p.i. with GFPCTL2 in the presence of 800nM YM201636 to swell
endosomal compartments. Insets highlight a ruptured Rab25-positive chlamydial
inclusion denoted by the prominent GFP-expressing bacterial fluorescence within and
a ruptured Rab25-positive endosome. Arrows highlight the nuclei, asterisks the
inclusion and arrow heads blebbing of the plasma membrane.
33
5/05/17
Figure 2: Correlative light and electron microscopy reveals the barrier function of
the chlamydial inclusion. A) Time-lapse videomicroscopy of GFP-Rab25 stable HeLa
cells ablated 24h p.i. with CTL2 (MOI~0.5). B) Transmission electron micrographs of
these same cells. Arrows highlight swollen chlamydial RBs. C) Time-lapse
videomicroscopy of mCherry-Rab25 stable HeLa cells ablated 24h p.i. with CTL2
(MOI~0.5) in the presence of CellROX® Green. D) Quantification of intrainclusional CellROX® Green fluorescence. N= 5, Error bars present the Standard
Deviation from the Mean. E) Time-lapse videomicroscopy of GFP-Rab25 expressing
stable HeLa cells ablated 24h p.i. with CTL2 (MOI~0.5) in the presence of
Mitotracker® Red CMXRos. Arrows highlight swelling mitochondria and asterisks
the inclusion.
Figure 3: Chlamydia-induced cell death is not apoptotic or necroptotic A) Time-lapse
videomicroscopy of Casper3-GR expressing HeLa cells ablated 24h p.i. with CTL2
(MOI~0.5). B) Quantification of inclusion-rupture induced cell death under the
indicated conditions. C) Quantification of native egress-induced cell death under the
indicated conditions. Presented in pie-charts are the proportions of primary infected,
≥secondary infected and uninfected cells surviving cells at the indicated time-point as
monitored by GFP-CTL2 fluorescence. N=3, Error bars present the Standard
Deviation from the Mean.
For clarity, only error bars for DMSO and
chloramphenicol are presented. D) Western immunoblotting of HeLa cells genomeedited for the indicated targets.
34
5/05/17
Figure 4: Calpains mediate inclusion rupture. A) Time-lapse videomicroscopy of
mCherry-Rab25 stable HeLa cells infected from 8-72 h p.i. with GFP-CTL2
(MOI~0.5) in the presence or absence of 100M calpeptin. B) Quantification of
native egress-induced cell death under the indicated conditions. Presented in piecharts are the proportions of primary infected, ≥secondary infected and uninfected
cells surviving cells at the indicated time-point as monitored by GFP-CTL2
fluorescence. N= 3, Error bars present the Standard Deviation from the Mean. C)
Quantification of inclusion-rupture induced cell death under the indicated conditions.
D) mCherry-Rab25 and CFP-H2B stable HeLa cells infected with the indicated
diluents from HeLa cells infected for 72 h p.i. with GFP-CTL2 (MOI~0.5). Presented
images were captured 24 h p.i.. E) Infectious progeny forming units in media and
whole cell lysates from infected cells cultured in the presence or absence of calpeptin
were quantified. . N= 3, Error bars present the Standard Deviation from the Mean.
Supplementary Figure 1:
Time-lapse videomicroscopy of 2xGFP-vimentin-expressing mCherry-Rab25 stable
HeLa cells infected for 24 h p.i. with CTL2 (MOI~0.5) and ablated in the presence
and absence of a CPAF-inhibitory peptide. Arrows highlight the nuclei and asterisks
the inclusion.
Supplementary Figure 2:
A) Quantification of inclusion-rupture induced cell death under the indicated
conditions. B) Quantification of native egress-induced cell death under the indicated
conditions. Presented in pie-charts are the proportions of primary infected,
35
5/05/17
≥secondary infected and uninfected cells surviving cells at the indicated time-point as
monitored by GFP-CTL2 fluorescence. N=3, Error bars present the Standard
Deviation from the Mean. For clarity, only error bars for DMSO and VX765 are
presented.
Supplementary Figure 3:
Live images of genome-edited HeLa cells following extrinsic and intrinsic apoptotic
stimuli at the indicated time-points.
36
5/05/17
Movie Legends:
Supplementary Movie 1:
Time-lapse videomicroscopy mCherry-Rab25 and CFP-H2β stable HeLa cells
infected for 48 h p.i. with CTL2 (MOI~0.5) as presented in Figure 1A. Interval is as
indicated.
Supplementary Movie 2:
Time-lapse videomicroscopy mCherry-Rab25 and GFP stable HeLa cells infected for
48 h p.i. with CTL2 (MOI~0.5) ) as presented in Figure 1B. Inclusion was ablated as
indicated (reticule). Interval is as indicated.
Supplementary Movie 3:
Time-lapse videomicroscopy mCherry-Rab25 stable HeLa cells infected for 24 h p.i.
with GFPCTL2 (MOI~0.5) ) as presented in Figure 1C. Inclusion was ablated as
indicated (reticule). Interval is as indicated.
Supplementary Movie 4
Time-lapse videomicroscopy GFP-Rab25 stable HeLa cells infected for 24 h p.i. with
CTL2 (MOI~0.5) and transferred to Calcium-free Ringer’s solution containing 50M
BAPTA-AM immediately prior to imaging as presented in Figure 1E. Inclusions were
ablated as indicated (reticule). Interval is as indicated.
Supplementary Movie 5
37
5/05/17
Time-lapse videomicroscopy GFP-Rab25 stable HeLa cells infected for 24 h p.i. with
CTL2 (MOI~0.5) and transferred to media containing 800nM YM801636
immediately prior to imaging as presented in Figure 1F. Inclusions were ablated as
indicated (reticule). Interval is as indicated.
Supplementary Movie 6
Time-lapse videomicroscopy mCherry-Rab25 stable HeLa cells infected for 24 h p.i.
with CTL2 (MOI~0.5) in the presence of CellROX® Green. Inclusions were ablated
as indicated (reticule). Interval is as indicated.
Supplementary Movie 7
Time-lapse videomicroscopy GFP-Rab25 stable HeLa cells infected for 24 h p.i. with
CTL2 (MOI~0.5) in the presence of Mitotracker® Red CMXRos. Inclusions were
ablated as indicated (reticule). Interval is as indicated.
Supplementary Movie 8
Time-lapse videomicroscopy mCherry-Cas9 stable HeLa cells treated with DMSO
imaged from 35 h p.i. with CTL2 (MOI~0.5) as presented in Figure 4A. Interval is as
indicated.
Supplementary Movie 9
Time-lapse videomicroscopy mCherry-Cas9 stable HeLa cells treated with calpeptin
imaged from 35 h p.i. with CTL2 (MOI~0.5) as presented in Figure 4A. Interval is as
indicated.
38
5/05/17