Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2 Tools in Developmental Biology 1 Questions to be answered in Dev. Bio.: - axis determination (AP, DV, LR) *Q. how do you ‘break’ the symmetry of the egg? Sperm entry, localized determinants - cell differentiation, cell proliferation, cell growth - cell migration, polarization (symmetric vs asymmetric cell division), cell shape (giving cells different morphologies, e.g. neurons), cell death - morphogenesis (how cells come together to form tissues; and how these tissues migrate) - organogenesis - timing (biological clock) 2 Questions to be answered in Dev. Bio.: -aging - germ cell development, fertilization - stem cells (what are they (multipotency, ability to selfrenew), why did they become so ‘trendy’ (Dolly the sheep, 1997, showed that cloning was possible; development of human ES cells, 1998) - regeneration - How efficient is human development? (talk about implantation) 3 Developmental biology Model systems Worm (C. elegans) Fly (Drosophila melanogaster) Fish (zebrafish, medaka) Mouse Xenopus (laevis, tropicalis) Chick (Quail) Sea urchin (echinoderm) Many systems available: which one to use: most powerful one where you can study your questions of interest. (also, many of these model systems are used to study processes other than developmental biology). 4 Drosophila melanogaster Arbacia punculata Gallus domesticus MODEL SYSTEMS for the experimental analysis of development Mus musculis Xenopus laevis and tropicalis Caenorhabditis elegans 5 One of the answers to some of these questions: Differential Gene Expression - DNA is the same in all cells: genomic equivalence - Some genes are mutated, or silenced but not lost!!!!!!! 6 Central Dogma of Life Reverse Transcription 7 How to prove that some genes are expressed and some are not? -Test for TEMPORAL/SPATIAL expression of RNA •Blotting •In situ hybridization •PCR - Test for the function of a certain gene •Gain of function: microinjection Transfection Electroporation Transgenic animals • Loss of function 8 Staining to find -how the cells look (anatomy) TISSUE CELLS Histology Cell Biology Proteins Biochemistry Western Blotting -To detect proteins DNA ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Southern Blotting -To find copy number of genes RNA Northern Blotting Real-Time PCR -To study gene expression Genome Sequencing 9 Blotting Techniques • Northern Blotting ( mRNA expression) • Southern Blotting (copy number) • Western Blotting ( protein expression) 10 Western Blotting 11 Western Blotting 12 E Enzyme L Linked I S Immuno Sorbent A Assay Protein molecule that performs a chemical reaction Linking an enzyme to an assay/test Attachment of antibodies Test to find out something Technique based on antigen-antibody reaction 13 Well with antibodies Well with antibodies and BSA added antigen binding sites Well with antibodies, BSA, and test sample Well in a microtiter plate Antibody structure Well after washes with wash buffer Well after adding substrate Color developed due to the formation of a substrate Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody 14 Southern / Northern Blotting 15 In situ hybridization 16 PCR RT-PCR Real-Time PCR -To study gene expression 17 PCR : Polymerase Chain Reaction 18 Reverse TranscriptasePolymerase Chain Reaction End of 35 cycles 236 = millions of copies PCR products RT RNA Marker 22 4 copies 23 8 copies 24 16 copies 32 copies 19 Preparation of cDNA or first strand RT Reverse Transcription 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ Reverse transcriptase ……TTTTTTT 5’ A, T, G, C dNTPs Reverse Transcription 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1ST strand cDNA (complementary DNA) 20 Fate mapping 21 Gain-of-Function Transgenic animal Loss-of-Function RNAi 22 Gain-of-Function/Trangenics 23 Loss-of-Function/RNAi 24 Loss-of-Function/RNAi 25 THE END 26