Download In vivo characterization of the properties of SUMO1

Biochem. J. (2013) 456, 385–395 (Printed in Great Britain)
385
doi:10.1042/BJ20130241
In vivo characterization of the properties of SUMO1-specific monobodies
Anja BERNDT*1 , Kevin A. WILKINSON*1 , Michaela J. HEIMANN*, Paul BISHOP* and Jeremy M. HENLEY*2
*School of Biochemistry, Medical Sciences Building, University of Bristol, University Walk, Bristol BS8 1TD, U.K.
Monobodies are small recombinant proteins designed to bind
with high affinity to target proteins. Monobodies have been
generated to mimic the SIM [SUMO (small ubiquitin-like
modifier)-interacting motif] present in many SUMO target
proteins, but their properties have not been determined in cells.
In the present study we characterize the properties of two
SUMO1-specific monobodies (hS1MB4 and hS1MB5) in HEK
(human embyronic kidney)-293 and HeLa cells and examine
their ability to purify SUMO substrates from cell lines and rat
brain. Both hS1MB4 and hS1MB5 compared favourably with
commercially available antibodies and were highly selective
for binding to SUMO1 over SUMO2/3 in pull-down assays
against endogenous and overexpressed SUMO and SUMOylated
proteins. Monobodies expressed in HeLa cells displayed a nuclear
and cytosolic distribution that overlaps with SUMO1. Expression
of the monobodies effectively inhibited protein SUMOylation by
SUMO1 and, surprisingly, by SUMO2/3, but were not cytotoxic
for at least 36 h. We attribute the effects on SUMO2/3 to the role of
SUMO1 in chain termination and/or monobody inhibition of the
SUMO-conjugating E1 enzyme complex. Taken together, these
data provide the first demonstration that monobodies represent
useful new tools both to isolate SUMO conjugates and to probe
cell SUMOylation pathways in vivo.
INTRODUCTION
SUMOylation and ubiquitin-dependent protein degradation [14–
16], play important roles in the formation of PML (promyelocytic
leukaemia) bodies, and are involved in DNA-damage responses
[17].
Blocking SUMO–SIM-mediated protein–protein interactions
is therefore an attractive approach to specifically perturb
SUMOylation in vivo. For example, expression of an artificial SIM
peptide has been shown to decrease protein–protein interactions
necessary for DNA damage repair [17]. However, most SIM
peptides do not discriminate between different SUMO isoforms
and bind with low affinity [17,18]. A significant advance was
the recent development of small proteins, termed monobodies,
which are isoform-specific for human SUMO1 and bind with
high affinity to the SIM-binding groove [19].
Monobodies are small 94-amino-acid monomeric proteins that
do not form any disulfide bonds, so they can be easily purified
from Escherichia coli and screened for specificity [20]. They
provide the potential for specific, cost-effective and high-affinity
alternatives to conventional antibodies, which for SUMO are
relatively inefficient. Potentially, monobodies represent a very
useful new tool to identify SUMO substrates and interacting
proteins and help define SUMOylation-dependent pathways.
So far, the most striking example of a monobody is directed
against the Abl (Abelson) kinase SH2 (Src homology 2) domain.
In this case, a highly specific monobody, termed HA4, was
generated which prevents autoinhibition of the Abl kinase roughly
1000 times more effectively than phosphopeptides used in earlier
studies [21]. SUMO monobodies were designed using the FN3
(fibronectin type III domain) as a scaffold. The FN3 possesses
three loops comprising seven β-strands, which can be used
to mimic the CDR (complementarity-determination region) of
conventional antibodies. By expressing different combinations of
15–20 amino acids within the three respective loops, extensive
monobody libraries can be generated.
SUMOylation is a post-translational modification analogous to
ubiquitination whereby members of the SUMO (small ubiquitinlike modifier) family of proteins are covalently attached to one
or more lysine residues in a target protein [1,2]. Since the first
report of SUMOylation as a modification of the nuclear pore
component RanGAP [3,4], many other nuclear and extranuclear
SUMO substrates have been characterized and numerous putative
targets have been suggested by proteomic studies [5,6]. Most
SUMOylated proteins identified so far play key roles in genome
integrity, nuclear structure and transcription [7,8]. However, it is
now also clear that SUMOylation is important for extranuclear
signal transduction, trafficking and modification of cytosolic and
integral membrane proteins [9].
There are three main SUMO isoforms in mammals, SUMO1,
SUMO2 and SUMO3. SUMO2 and SUMO3 only differ by three
N-terminal amino acids and are generally regarded as homologous
[1]. Unlike ubiquitination, which can be mediated by multiple E1
and E2 enzymes, SUMOylation uses only one heterodimeric
E1 (Sae1/Sae2) and one E2 (Ubc9) enzyme [10,11]. Several E3
enzymes, e.g. members of the PIAS [protein inhibitor of activated
STAT (signal transducer and activator of transcription)] and
Pc (polycomb group) protein family and RanBP2, have been
identified, but in contrast with the ubiquitin pathway, they appear
not to be essential for target protein recognition [1].
Many SUMO substrates also possess a hydrophobic
SIM (SUMO-interaction motif) that mediates non-covalent
interactions between SUMO and the target protein [12]. In
general, SIMs comprise four amino acids (V/I-X-V/I-V/I,
where X is any amino acid) and the SIM-binding groove
within the SUMO protein is conserved between SUMO1 and
SUMO2/3 [13]. Non-covalent SUMO interactions can regulate
the extent of covalent SUMOylation, appear to be a link between
Key words: monobody, small-peptide inhibition,
ubiquitin-like modifier (SUMO), SUMOylation.
small
Abbreviations used: Abl, Abelson; Cy3, indocarbocyanine; FN3, fibronectin type III domain; HEK, human embyronic kidney; HRP, horseradish
peroxidase; IP, immunoprecipitation; NEM, N -ethylmaleimide; Ni-NTA, Ni2 + -nitrilotriacetate; PML, promyelocytic leukaemia; SENP, SUMO protease; SIM,
SUMO-interaction motif; SUMO, small ubiquitin-like modifier.
1
These authors contributed equally to this work.
2
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2013 Biochemical Society
386
A. Berndt and others
SUMO monobodies were generated to imitate the SIM,
thereby binding to the highly conserved SIM-binding groove
of SUMO1 [19]. Monobody-mediated inhibition of non-covalent
SUMO–protein interactions can disrupt covalent SUMOylation in
different ways. First, the inhibition of non-covalent interactions
of SUMO with target proteins via the SIM can lead to
a decrease in SUMOylation levels of the respective target
proteins [14]. Secondly, binding of SUMO monobodies in vitro
hinders binding of the E1 Sae1/2 heterodimer to SUMO1,
therefore inhibiting the covalent coupling of SUMO1 to its target
protein [19].
Despite the very elegant in vitro work, there have been no
reports of the use of SUMO-specific monobodies in cells. In
the present study, we assess their potential use for inhibiting
SUMOylation, identifying new SUMO1 targets and for detection
of SUMO1. In pull-down assays two monobodies, hS1MB4
and hS1MB5, differentiate between endogenous and exogenous
SUMO1 and SUMO2, inhibit protein SUMOylation in vivo and
also effectively recognise and bind to endogenously SUMOylated
proteins.
EXPERIMENTAL
Cell culture and transfection
HEK (human embyronic kidney)-293T and HeLa cells were
cultured in DMEM (Dulbecco’s modified Eagle’s medium)
(Lonza) supplemented with 10 % (v/v) FBS (Labtech), 350 μg/ml
L-glutamine (Life Technologies) and 10 μg/ml gentamicin
(Sigma). All cells were incubated at 37 ◦ C at 5 % CO2 . Rat
primary cortical neurons were prepared from E18 (embryonic
day 18) Wistar rats as described previously [22]. Unless stated
otherwise, 5×105 cells were plated 24 h prior to transfection
with TransIt® -LT1 (Mirus) according to the manufacturer’s
instructions. Rat brain tissue was obtained from an adult female
rat. All experiments in the present study were performed in
accordance with U.K. Home Office Schedule 1 guidelines.
Animals were killed by cervical dislocation using procedures
approved by the Home Office Licensing Team at the University
of Bristol (UIN UB/12/008).
Oligonucleotides and plasmids
All oligonucleotides were obtained from biomers.net. See Table 1
for the sequences of cloning primers. The bacterial expression
plasmids encoding the human SUMO1-specific monobodies 4 and
5, pHFT2-hS1MB4 and pHFT2-hS1MB5, have been described
previously [19]. The mammalian expression vectors encoding
YFP-fused conjugatable and non-conjugatable human SUMO1
(YFP–SUMO1, YFP–SUMO1GG) or SUMO2 (YFP–SUMO2,
YFP–SUMO2GG) respectively have also been described
previously [23]. For mCherry–SUMO1 and SUMO2 GG and
GG, mCherry was amplified by PCR using the primers 5 mCherry and 3 -mCherry, cut with NheI and BglII, and ligated into
pEYFP-C1-SUMO1GG/GG or pEYFP-SUMO2GG/GG that
had been cut with NheI and BglII to excise the YFP sequence. The
fidelity of both constructs was confirmed by DNA sequencing.
Mammalian vectors expressing FLAG-tagged monobodies 4
and 5 (pFlag-hS1MB4 and pFlag-hS1MB5 respectively) were
generated by taking the monobody sequences from plasmids
pHFT2-hS1MB4 and pHFT2-hS1MB5 and introducing them
into pHM1546 [24] (plasmid pHM1546 was a gift from
Professor Thomas Stamminger, Erlangen, Germany) via BamHI
and XhoI restriction sites. For GFP-tagged monobodies, the
c The Authors Journal compilation c 2013 Biochemical Society
Table 1
Oligonucleotides used for cloning
Primer name
Sequence (5 →3 )
3_MB-Kpn
5_GFPntermMBBgl
5_GFPntermMBBgl-linker
5 mCherry
3 mCherry
MB5-E33R-F
MB5-E33R-R
ATGGGTACCCTAGGTACGGTAGTTAATCG
ATGCAGATCTCCTCCGTTTCTTCTGTTCCG
ATGCAGATCTCCCGAAGTATCGCAACGTCCTCCGTTTCTTCTGTTCCG
GAGGCTAGCGCCACCATGGCCATCATCAAGGAGTTC
CTCAGATCTTCCACCTCCAAGCTCGTCCATGCCGCCGG
GTGTCCCACTACAGGATAACGTACGG
CCGTACGTTATCCTGTAGTGGGACAC
monobody sequences were amplified by PCR using primers
5_GFPntermMB-Bgl and 3_MB-Kpn, and inserted into pGFPC2 via BglII and KpnI, resulting in the plasmids pGFPhS1MB4 and pGFP-hS1MB5 respectively. To introduce a linker
sequence between the GFP and the monobody, the monobody
sequences were amplified with primers 5_GFPntermMBBgl-linker and 3_MB-Kpn and inserted into pGFP-C2 via
BglII and KpnI, resulting in plasmids pGFP-hS1MB4L and
pGFP-hS1MB5L. The plasmids pHFT2-hS1MB5E33R, pFlaghS1MB5E33R and pGFP-hS1MB5E33R, harbouring a mutated
sequence of monobody 5, were obtained by a site-directed
mutagenesis kit (Stratagene) according to the manufacturer’s
instructions, using primers MB5-E33R-F and MB5-E33R-R.
Bacterial protein expression, cell lysis and pull-down assays
His-tagged monobodies were expressed in BL21(DE3) E. coli.
In brief, BL21(DE3) bacteria harbouring either pHFT2-hS1MB4,
pHFT2-hS1MB5 or pHFT2-hS1MB5E33R were grown in LB
broth and protein expression was induced by incubation with
1 mM IPTG overnight at 18 ◦ C. Cells were harvested and
resuspended in lysis buffer containing 50 mM NaH2 PO4 , 300 mM
NaCl, 20 mM imidazole, 0.1 % Triton X-100 and cOmpleteTM
EDTA-free protease inhibitors (Roche Applied Science) and
incubated on ice with lysozyme for 10 min. After sonication
(3×10 s using a Misonix Microson XL ultrasonic cell disruptor at
4 ◦ C), lysates were cleared by centrifugation and stored in aliquots
at − 80 ◦ C. Mammalian cells were lysed in SDS/Triton lysis
buffer [20 mM Tris/HCl, pH 7.6, 150 mM NaCl, 1 mM EDTA,
0.1 % SDS, 1 % Triton X-100, 40 mM NEM (N-ethylmaleimide),
1 mM PMSF and cOmpleteTM EDTA-free protease inhibitors] for
10 min on ice, followed by sonication (12 pulses using a Misonix
Microson XL ultrasonic cell disruptor at 4 ◦ C). The lysates
were cleared by centrifugation and used directly in pull-down
assays. Protein concentrations were determined with Bradford
reagent (Bio-Rad Laboratories) according to the manufacturer’s
instructions.
Adult rat brain tissue was homogenized in buffer containing
50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 20 mM NEM and
cOmpleteTM EDTA-free protease inhibitors, using a dounce
homogenizer. Detergents were then added to a final concentration
of 1 % Triton X-100, 0.5 % sodium deoxycholate and 0.1 % SDS,
and the lysate was incubated on a rotating wheel at 4 ◦ C for
1 h. The lysate was then cleared by centrifugation at 40 000 g
for 30 min. Approximately 2 mg of brain lysate was used per
pulldown.
Monobody purification and pull-down assays were performed
using Ni-NTA (Ni2 + -nitrilotriacetate) agarose (Qiagen) according
to a modified manufacturer’s protocol. Briefly, bacterial lysates
were mixed with the Ni-NTA agarose slurry and incubated at
Inhibition of SUMOylation in vivo
4 ◦ C. After washing the beads, cell lysates were added and further
incubated at 4 ◦ C for 2–4 h. The beads were then washed three
times with lysis buffer and all bound proteins were eluted by
boiling the beads in NuPAGE LDS Sample buffer (4×) (Life
Technologies). The eluates were analysed by Western blotting
and Coomassie Blue staining.
For IPs (immunoprecipitations), 2 μg of commercial antibodies
were bound to Protein A–Sepharose (Sigma) by incubation for
1 h at 4 ◦ C in RIPA buffer (50 mM Tris/HCl, 150 mM NaCl,
1 % Triton X-100, 0.5 % sodium deoxycholate and 0.1 % SDS,
pH 7.4). After binding, beads were washed once in RIPA buffer.
Cleared HEK-293T lysate (approximately 2 mg total protein)
was applied to the beads and incubated on a wheel at 4 ◦ C for
2 h. Beads were subsequently washed three times in RIPA buffer
before analysis by Western blotting. IPs using GFP-Trap® beads
(ChromoTek) were performed according to the manufacturer’s
instructions.
Western blotting, Coomassie-Blue-stained protein gels and
antibodies
Proteins were separated on 7.5–15 % polyacrylamide or 4–
20 % polyacrylamide gradient gels (Thermo Scientific) and
either stained with Coomassie Brilliant Blue G (Sigma–
Aldrich) or transferred on to nitrocellulose membranes (Protran
BR3; Schleicher & Schuell). Proteins were detected using
chemiluminescence and fluorescence with a LI-COR ODYSSEY
FC Dual-imaging system. Endogenous and exogenous proteins
were detected or immunoprecipitated with rabbit polyclonal
anti-GFP (FL), anti-SUMO1 (FL-101) (both Santa Cruz
Biotechnology), anti-(β-tubulin III) (Sigma–Aldrich), sheep
anti-SUMO1 or anti-SUMO2/3 (both antibodies were a
gift from Professor Ron Hay, School of Life Sciences,
University of Dundee, Dundee, U.K.), or goat polyclonal antiRanGAP1 (N-19) (Santa Cruz Biotechnology) antibodies. Mouse
monoclonal antibodies were used for anti-His•Tag® (Merck),
anti-SUMO1 21C7, anti-SUMO2 8A2 (both Developmental
Studies Hybridoma Bank, University of Iowa, Des Moines, IA,
U.S.A.), anti-SUMO1 (D-11) (Santa Cruz Biotechnology), antiSUMO2/3 (1E7) (MBL), anti-RFP (5F8) (ChromoTek), antiGFP (Roche), anti-FLAG M2 and anti-β-actin (both Sigma–
Aldrich). HRP (horseradish peroxidase)-conjugated anti-mouse,
anti-rabbit, anti-rat and anti-goat secondary antibodies (Sigma)
were used as appropriate. Fluorescence-conjugated anti-mouse
and anti-rabbit secondary antibodies were obtained from LI-COR
Biotechnology.
Immunofluorescence analysis
For direct immunofluorescence analysis, 105 HeLa cells were
grown on coverslips and transfected using TransIt® -LT1 (Mirus)
as described above. Briefly, cells were washed with PBS and
fixed for 10 min with 4 % paraformaldehyde solution at room
temperature (21 ◦ C). Cells were permeabilized with 0.2 % Triton
X-100 in PBS for 20 min at 4 ◦ C. Nuclei were visualized
using DAPI-containing Hard Set mounting medium (Vector
Laboratories).
Use of monobodies for Western blotting and immunofluorescence
To produce pure His–FLAG-tagged hS1MB5 and hS1MB5E33R
for Western blotting and immunofluorescence, monobody
expression was induced in BL21(DE3) bacteria as described
above. Cleared bacterial lysate was then incubated with 1 ml
387
of pre-washed Ni-NTA beads for 2 h at 4 ◦ C. After extensive
washing in lysis buffer, monobodies were eluted from the beads
in 10 mM Hepes, pH 7.4, and 150 mM NaCl containing 200 mM
imidazole. To use the purified monobodies for Western blotting,
after blocking the membrane in 5 % (w/v) non-fat dried skimmed
milk powder/PBST, bacterially purified His–FLAG–monobodies
(approximately 0.5 μg/μl) were diluted in 5 % (w/v) non-fat dried
skimmed milk powder/PBST (PBS with 0.1 % Tween 20) at
dilutions ranging from 1:250 to 1:1000 and incubated with the
membrane overnight. After three brief washes in PBST, mouse
anti-FLAG antibody was applied for 1 h at room temperature
in order to detect the bound monobody. After washing, HRPconjugated anti-mouse secondary antibody was applied for 1 h at
room temperature. Membranes were then washed three times and
signal was detected as described above.
For immunostaining, HeLa cells on coverslips were transfected
with pEYFP-SUMO1 and fixed and permeabilized as described
above. Cells were incubated with purified monobody (0.5 μg/μl)
diluted 1:50 in PBS containing 5 % BSA for 1 h and washed
three times with PBS before incubation with mouse antiFLAG antibody in PBS containing 5 % BSA for 45 min.
After further washes with PBS, cells were incubated with Cy3
(indocarbocyanine)-conjugated anti-mouse secondary antibody
(Jackson ImmunoResearch Laboratories) in PBS containing 5 %
BSA for 45 min. Cells were washed extensively with PBS and
mounted on to slides using DAPI-containing Hard Set mounting
medium.
RESULTS
Monobodies hS1MB4 and hS1MB5 bind specifically to SUMO1
Monobodies hS1MB4 and hS1MB5 were originally selected for
their ability to recognise the SIM-binding region within human
SUMO1, but not SUMO2/3, in an in vitro cell-free environment
[19]. Given that the SIM-binding motif is well conserved between
SUMO isoforms [12,25], this was unexpected. In the present
study we extended these experiments to determine monobody
specificity under more physiological conditions in mammalian
cells using a monobody pull-down assay.
hS1MB4, hS1MB5 and hS1MB5E33R were expressed in
BL21(DE3) E. coli cells and purified on Ni-NTA agarose beads.
HEK-293T cells, transiently transfected with YFP–SUMO1,
YFP–SUMO1GG, YFP–SUMO2, YFP–SUMO2GG or GFP
(Figures 1A, 1C and 1E) were lysed in SDS/Triton lysis buffer,
complemented with protease inhibitors and 40 mM NEM to
inhibit SENP (SUMO protease) activities and total cell lysates
were incubated with the purified agarose-bound monobodies.
Bound proteins were eluted from the beads by boiling with
sample buffer and analysed by Western blotting using an antiGFP polyclonal antibody to detect YFP–SUMO, and an antiHis monoclonal antibody to detect purified monobodies. YFP–
SUMO1 and YFP–SUMO1GG, but not YFP–SUMO2 or YFP–
SUMO2GG, were pulled down by the wild-type monobodies
(Figures 1A and 1C). There was a 20-fold more efficient pulldown of YFP–SUMO1 compared with YFP–SUMO2 and GFP
(Figures 1B and 1D). Consistent with the loss of binding of the
E33R point mutated monobody in in vitro assays [19], this mutant
did not pull-down SUMO1 (Figures 1E and 1F).
Monobodies hS1MB4 and hS1MB5 also show specificity for
endogenous human SUMO1 from HEK-293T cell lysate not
treated with the SENP inhibitor NEM to ensure a maximum
amount of free unconjugated SUMO1. All samples were analysed
by Western blotting using monoclonal anti-SUMO1, anti-SUMO2
and anti-His antibodies. As shown in Figures 2(A) and 2(B), both
c The Authors Journal compilation c 2013 Biochemical Society
388
Figure 1
A. Berndt and others
Binding capacities of hS1MB4, hS1MB5 and hS1MB5E33R from HEK-293T cell lysate
(A, C and E) hS1MBs were expressed in bacteria and purified with Ni-NTA agarose. Pull-down assays were performed using whole-cell lysates from HEK-293T cells transfected with 0.5 μg of
YFP–SUMO1, YFP–SUMO1GG, YFP–SUMO2, YFP–SUMO2GG or GFP. Eluates were analysed by Western blotting using polyclonal rabbit anti-GFP or monoclonal mouse anti-His antibody.
Molecular masses in kDa are indicated. w/o, without. (B, D and F) Statistical analysis of SUMO binding to hS1MBs. Band intensities were normalized to the monobody signal, followed by establishing
∗∗∗
the ratio of the band intensity to the YFP–SUMO1 signal. For (F), the ratio between the wild-type and mutant was calculated. Error bars are +
−S.E.M. P < 0.001.
monobodies are highly selective for endogenous SUMO1 over
SUMO2 in vivo. To further validate these findings, we tagged
hS1MB5 and hS1MB5E33R with GFP and co-expressed them
in HEK-293T cells with mCherry–SUMO1GG or mCherry–
SUMO2GG respectively. After subjecting the lysates to
purification with GFP-Trap® beads, analysis by Western blot
revealed GFP–hS1MB5, but not the E33R mutant, bound strongly
to SUMO1, but there was no interaction with SUMO2 (Figure 2C).
Taken together, these data demonstrate that SUMO-targeted
monobodies recognise SUMO1 independently of an attached
epitope tag and also very effectively discriminate between
c The Authors Journal compilation c 2013 Biochemical Society
endogenous SUMO1 and SUMO2 expressed in clonal HEK-293
cell lysates.
Expression of monobodies in HEK-293T cells decreases levels of
protein SUMOylation
Monobodies prevent SUMO1ylation in in vitro assays via
inhibition of the E1 step [19]. Monobodies can be expressed
in mammalian cell lines [21], but there are no reports of
the effects of SUMO-specific monobodies on SUMOylation
in vivo. We therefore FLAG-tagged hS1MB4, hS1MB5 and
Inhibition of SUMOylation in vivo
Figure 2
389
Monobody specificity against SUMO1 in HEK-293T cells
hS1MB4 (A) and hS1MB5 (B) were expressed in bacteria and purified with Ni-NTA agarose. Pull-down assays were performed using whole-cell lysates from HEK-293T cells. Eluates were analysed
by Western blotting using monoclonal mouse anti-His, anti-SUMO1 and anti-SUMO2 antibodies. To control for unspecific binding, the experimental set-up included samples without hS1MBs or
cell lysate (lanes 2 and 4). (C) GFP–hS1MB5 and GFP–hS1MB5E33R were co-expressed with either mCherry–SUMO1GG or mCherry–SUMO2GG in HEK-293T cells. GFP-tagged monobodies
were purified by GFP-Trap® beads and analysed by Western blotting using polyclonal rabbit anti-GFP and rat monoclonal anti-RFP antibody against mCherry. Molecular masses in kDa are
indicated.
hS1MB5E33R by subcloning into the plasmid pHM1546 [24]
and expressed them in HEK-293T cells. Expression of hS1MB4
and hS1MB5 significantly reduced the total levels of SUMO1modified proteins compared with cell lysates without monobody
expression (Figures 3A and 3B). Despite apparently lower
expression levels of FLAG–hS1MB4 compared with FLAG–
hS1MB5, it more effectively inhibited SUMO1ylation, consistent
with in vitro assays [19]. Furthermore, consistent with earlier
results from pull-down assays, the E33R point mutant did
not significantly decrease the level of SUMO1ylated proteins
(Figures 3E and 3F).
RanGAP1 is the prototypic SUMO substrate [3,4] and
expression of hS1MB5 significantly decreased levels of
SUMOylated RanGAP1, whereas hS1MB4 was less effective
(Figures 3G and 3H). Unexpectedly, since both monobodies are
highly selective for SUMO1, expression of FLAG–hS1MB4 and
FLAG–hS1MB5 also induced a significant decrease in the levels
of SUMO2-modified proteins (Figures 3C and 3D). One possible
explanation is that removal of SUMO1 modification leads to
subsequent changes in SUMO2 modification, because SUMO1
can act as a terminator of SUMO2/3 chains [26].
Expression of GFP-tagged monobodies in HEK-293T cells
also significantly reduced the levels of SUMO1-modified proteins
(Figures 4A and 4B). However, this decrease was less pronounced
than that observed with FLAG–hS1MBs (compare Figures 3A
and 3B with Figures 4A and 4B). In these assays we also
observed that direct fusion of GFP to hS1MB4 promotes GFP–
hS1MB4 degradation (Figure 4A, lane 2). Interestingly, GFP–
hS1MB4 stability is increased when a short linker sequence is
inserted between GFP and the monobody, possibly destroying a
protease recognition site (Figure 4A, compare lane 2 with lanes
3–4) [27].
GFP-tagged monobodies distribute throughout the nucleus and
cytoplasm
To test whether monobodies localize to specific cellular
compartments, HeLa cells were transiently transfected with pGFP,
pGFP-hS1MB4, pGFP-hS1MB4L, pGFP-hS1MB5 or pGFPhS1MB5L. Free GFP was uniformly distributed throughout the
cytoplasm and the nucleus (Figure 4C, panels f and l). GFP–
hS1MB4 displayed a similar lack of localization at any specific
compartment (Figure 4C, panels g and m). We attribute this
to the fact that GFP–hS1MB4 is rapidly cleaved to release
free GFP (Figure 4A). In contrast, although still present in
the cytoplasm, monobodies GFP–hS1MB4L, GFP–hS1MB5 and
GFP–hS1MB5L preferentially localized within the nucleus,
but surprisingly they did not highlight the transcriptionally
active PML bodies (Figure 4C, panels h and n, i and o,
and k and p respectively), possibly because co-expression of
mCherry–SUMO1 with the monobody blocks SUMOylation of
PML. Nonetheless, since most SUMOylated proteins are present
in the nucleus [2], the distribution observed in Figure 4(C) is
consistent with the monobodies binding SUMO in vivo. This
is further supported by the overlapping nuclear distribution of
mCherry–SUMO and co-expressed GFP–hS1MB4L or GFP–
hS1MB5L in HeLa cells (Figure 4D, panels g and h).
c The Authors Journal compilation c 2013 Biochemical Society
390
Figure 3
A. Berndt and others
Monobodies decrease SUMOylation levels in vivo
(A, C, E and G) HEK-293T cells were transfected with 2 μg of either pcDNA3.1, FLAG–hS1MB4, FLAG–hS1MB5 or FLAG–hS1MB5E33R as indicated. At 36 h post-transfection, cells were harvested,
lysed and analysed by Western blotting. The membranes were probed with monoclonal mouse anti-SUMO1, anti-SUMO2, anti-FLAG or anti-β-actin antibodies (A, C and E) or polyclonal goat
anti-RanGAP1 and rabbit anti-β-tubulin (G). Molecular masses in kDa are indicated. (B, D, F and H) Band intensities corresponding to (A), (C), (E) and (G) respectively were normalized to the
∗
∗∗∗
β-actin (B, D and E) or β-tubulin (G) signal, followed by establishing the ratio of the band intensity to the signal in lane 1 of the respective blots. Error bars are +
−S.E.M. P < 0.05, P < 0.001.
Monobodies pull down SUMOylated proteins
Monobodies bind to the SIM-binding motif on SUMO. This
interaction should be unaffected by SUMOylation, since it
occurs at a site separate from the C-terminus required for the
covalent attachment of SUMO to target proteins [13,25,28].
Therefore a useful potential application for monobodies would
be to purify SUMOylated proteins (Figure 5A). To test this, we
incubated lysate from bacteria expressing hS1MB4 or hS1MB5
with Ni-NTA agarose beads. The washed monobody-loaded
Ni-NTA beads were then incubated with HeLa cell lysate.
Following extensive washing, beads were boiled with SDS sample
buffer and the resultant eluates were analysed on a Coomassie
c The Authors Journal compilation c 2013 Biochemical Society
Blue-stained polyacrylamide gel. Multiple protein bands were
detected in the monobody/HeLa cell lysate lanes compared
with control lanes lacking either monobody or cell lysate
(Figure 5B).
We next compared the efficiency of monobody pull-downs
to conventional SUMO IP with anti-SUMO antibodies. HEK293T lysates were incubated with either hS1MB4, hS1MB5
or hS1MB5E33R monobody bound to Ni-NTA beads or with
anti-SUMO antibodies bound to Protein A beads. Samples
were analysed by Western blotting using sheep anti-SUMO1
and anti-SUMO2/3 antibodies to avoid cross reactions with
immunoglobulin bands. Both monobodies and D-11 anti-SUMO1
antibody pulled down multiple SUMOylated proteins (Figure 5C).
Inhibition of SUMOylation in vivo
Figure 4
391
Inhibition of SUMOylation and intracellular distribution of GFP-tagged monobodies
(A) HEK-293T cells were transfected with 1 μg of either GFP, GFP–hS1MB4, GFP–hS1MB4L, GFP–hS1MB5 or GFP–hS1MB5L respectively. At 36 h post transfection, cells were harvested, lysed
and analysed by Western blotting. Nitrocellulose membranes were incubated with polyclonal rabbit anti-GFP, or monoclonal mouse anti-SUMO1 or anti-β-actin antibodies. Molecular masses in kDa
∗
are indicated. (B) Band intensities were normalized to the β-actin signal, followed by establishing the ratio of the SUMO signal intensity to the signal in lane 1. Error bars are +
−S.E.M. P < 0.05,
∗∗
P < 0.001. (C and D) HeLa cells were transfected with 0.5 μg of GFP, GFP–hS1MB4, GFP–hS1MB4L, GFP–hS1MB5, GFP–hS1MB5L or mCherry–SUMO1 as indicated. At 36 h post transfection,
cells were fixed and analysed with an immunofluorescence microscope. Nuclei were stained with DAPI. For microscopic analysis a 63 × magnification was used. For (C), representative cells were
selected and pictures cut to size accordingly.
Although many of the same molecular mass immunoreactive
bands were present in both hS1MB5 and D-11 lanes, some
differences were evident, suggesting that the monobodies and D11 may recognise distinct but overlapping populations of SUMO
substrates.
We next analysed lysates from HEK-293T and HeLa cells,
rat cortical neurones and adult rat brain. Because the amino
acid sequences of human and rat SUMO1 are identical,
we reasoned the monobodies should recognise both with
equal affinity. Using an anti-SUMO1 monoclonal antibody,
multiple high-molecular-mass bands were detected (Figure 6A),
demonstrating monobody-mediated pull-down of endogenous
SUMO1ylated proteins. Anti-SUMO2 monoclonal antibody also
detected multiple purified proteins that were modified by SUMO2
(Figure 6B). Since the monobodies are highly selective for
SUMO1 over SUMO2 (Figures 1 and 2), we attribute these
bands to proteins endogenously modified by both SUMO1 and
SUMO2. This could be via distinct SUMO sites or via SUMO2/3
chains terminated by SUMO1 [26]. This is consistent with
previous reports of several proteins that possess more than one
functional SUMO site, which can be SUMOylated by either
SUMO1 or SUMO2/3 [14,24,29]. Importantly, SUMOylated
RanGAP1 was effectively purified by monobody pull-downs
(Figure 6C).
Monobodies provide an effective new tool to detect SUMO1
As the monobodies are highly specific for SUMO1, we reasoned
that they could be used as an alternative to conventional antibodies
c The Authors Journal compilation c 2013 Biochemical Society
392
Figure 5
A. Berndt and others
Monobodies as a tool for the isolation of SUMO targets
(A) Schematic drawing for the experimental set-up of the pull-down assays. His-tagged hS1MBs were purified on Ni-NTA agarose. Endogenous SUMO from whole-cell lysates binds to hS1MBs
via the SIM-binding site. If bound SUMO is attached covalently to a target protein, this protein is co-purified. MB, monobody. (B) hS1MB4 and hS1MB5 were purified from bacterial lysate with
Ni-NTA agarose. Bead-bound monobodies were incubated with HeLa whole-cell lysate, eluted and analysed on a Coomassie-Blue-stained polyacrylamide gel. To control for unspecific binding, the
experimental set-up included samples without hS1MBs or HeLa lysate (lanes 2, 4 and 5). (C) hS1MB4, hS1MB5 and hS1MB5E33R were purified from bacterial lysate with Ni-NTA agarose and used
in a pull-down assay from HEK-293T lysate. In parallel, SUMO1 and SUMO2/3 were precipitated from HEK-293T cell lysate using anti-SUMO1 (D-11 and FL-101) as well as anti-SUMO2/3 (1E7)
antibodies. Samples were analysed by Western blotting using sheep polyclonal anti-SUMO1 and anti-SUMO2/3 antibodies. Molecular masses in kDa are indicated.
for the detection of SUMO1. We transfected HEK-293T with
either GFP or YFP–SUMO1 and analysed the lysates by Western
blotting using conventional monoclonal anti-GFP or anti-SUMO1
(D-11) antibodies. To test the ability of the monobodies to
detect SUMO1, we incubated the membranes with ∼2 μg/ml of
purified hS1MB5 or hS1MB5E33R monobody. As the pHFT2hS1MB vector not only encodes a His-tag, but also a FLAGtag fused to the monobody sequence, the first incubation was
followed by incubation with mouse monoclonal anti-FLAG
antibody to detect the bound monobody. Finally, HRP-tagged
anti-mouse antibody was used. The conventional antibodies
and hS1MB5 monobody all very effectively detected the YFP–
c The Authors Journal compilation c 2013 Biochemical Society
SUMO1 (Figure 7A). As expected, the hS1MB5E33R monobody
showed no signal. These data indicate that the monobodies provide
a cost-effective reagent for the detection of SUMO1 by Western
blotting. Furthermore, a similar result was obtained by using
the monobodies in immunofluorescence analyses (Figure 7B).
To do this, HeLa cells were transfected with YFP–SUMO1,
fixed and stained with purified monobody. Bound monobody
was then detected by mouse anti-FLAG staining followed by
addition of Cy3-conjugated anti-mouse secondary antibody.
Although both hS1MB5 and D-11 detected signal overlapping
with YFP–SUMO1 and strongly labelled nuclear PML bodies,
the non-binding hS1MB5E33R mutant did not. Together with the
Inhibition of SUMOylation in vivo
Figure 6
393
Pull-down assays to purify endogenous SUMOylated proteins
Bacterially expressed hS1MB4, hS1MB5 and hS1MB5E33R were purified with Ni-NTA agarose. To purify SUMOylated proteins, bead-bound hS1MBs were incubated with whole-cell lysate from
HEK-293T cells (upper panel), HeLa cells (second panel), primary rat cortical neurons (third panel) or rat brain tissue (bottom panel). Eluates were analysed by Western blotting. hS1MBs were
detected with monoclonal anti-His antibody. SUMOylated proteins were detected with monoclonal mouse anti-SUMO1 (A), anti-SUMO2 (B) or polyclonal goat anti-RanGAP1 (C) antibody. Molecular
masses in kDa are indicated.
pull-down data, these findings suggest that monobodies may be
useful alternatives to conventional antibodies for a variety of
applications.
DISCUSSION
Protein SUMOylation is a key regulator of cell function
and has been implicated in a wide range of diseases,
including neurodegenerative disorders, diabetes, heart disease
and carcinogenesis [30]. Non-covalent SUMO–SIM interactions
regulate substrate SUMOylation, so developing effective and
specific inhibitors may provide an important route for therapeutic
intervention. Previous attempts to inhibit SUMO modification
and interactions in vivo have either lacked SUMO isoform
specificity or lead to lethal phenotypes [17,31]. However, a
strategy targeted at disrupting non-covalent SUMO–SIM binding
c The Authors Journal compilation c 2013 Biochemical Society
394
Figure 7
A. Berndt and others
Using hS1MB to detect SUMO1 in Western blot and immunostaining
(A) HEK-293T cells were transfected with either GFP or YFP–SUMO1. At 36 h post-transfection, cells were lysed and subjected to Western blot analysis. The membranes were probed with monoclonal
anti-GFP or anti-SUMO1 D-11 antibodies (upper panels). Membranes were also treated with either purified FLAG–hS1MB5 or FLAG–hS1MB5E33R, followed by incubation with HRP-conjugated
anti-mouse antibodies (lower panels). Molecular masses in kDa are indicated. (B) HeLa cells were transfected with YFP–SUMO1 and fixed 36 h post-transfection. The cells were stained with mouse
monoclonal anti-SUMO1 D-11 antibody or purified monobodies. Bound monobody was then detected by application of anti-FLAG antibody followed by Cy3-conjugated secondary antibody. For
microscopic analysis a 63 × magnification was used.
with small peptides may produce reliable SUMO inhibitors
[17].
In the present study we extend the in vitro work of Koide
et al. [19] to show that SUMO1-targeted monobodies recognise
SUMO1 over SUMO2/3 and inhibit SUMOylation in mammalian
cells. This is important, because it demonstrates that monobodies
are non-toxic in in vivo systems and that they effectively bind
to and pull down SUMOylated proteins in a cellular context,
suggesting a use for screening and detection of novel SUMO
substrates.
Both hS1MB4 and hS1MB5 monobodies exhibited a strong
specificity for SUMO1 over SUMO2 and binding to SUMO1
was severely attenuated by introduction of an E33R mutation into
hS1MB5. We observed a 20-fold selectivity for YFP–SUMO1
over YFP–SUMO2; whereas, in vitro, a 360-fold selectivity was
previously reported [19]. Although still highly selective, we
attribute this apparent reduction to the fact that we used pull
downs from physiologically relevant complex protein mixtures in
cell lysates, whereas the in vitro work was done using purified
proteins and SPR (surface plasmon resonance).
An important finding is that monobody expression does not
affect cell viability over the 36 h time period we investigated and
we did not detect any cell morphology or nuclear abnormalities in
our immunofluorescence experiments. GFP-tagged monobodies
are present throughout the cell, but are enriched in the nucleus.
This distribution differs to SIM peptides, which exclusively
localize to the nucleus [17]. However, the fact that a NLS (nuclear
localization signal) was incorporated into the SIM peptide, but not
our GFP–monobody expression plasmid, most likely accounts for
these differences.
By binding SUMO, monobodies can inhibit SUMO1ylation
in vitro and in vivo. Although the mechanism of inhibition is
not yet fully resolved, in vitro experiments suggest it is due to
a steric hindrance during the E1 stage of SUMO conjugation
[19]. We observed a marked decrease in global SUMOylation
with expression of hS1MB4 and, to a lesser extent, hS1MB5,
consistent with the in vitro results and probably due to the higher
affinity of hS1MB4 [19].
The decrease in SUMO2ylation was unexpected. Although
SUMO1 cannot form chains, it can act as a chain terminator
c The Authors Journal compilation c 2013 Biochemical Society
[26]. Therefore, inhibiting SUMO1ylation may leave SUMO2/3
chains unstable and more prone to SENP-mediated deconjugation.
Although in in vitro experiments it has been suggested that the
SUMO monobodies hinder binding of the E1 Sae1/2 heterodimer
to SUMO1, which contributes to the inhibition of SUMOylation,
this could not be shown for SUMO 2/3. Assuming that this steric
hindrance is responsible for the decrease in SUMOylation, we
therefore assume that only SUMO1ylation is affected directly.
Screens for SUMOylated proteins and SIM interactors have
used coIP and/or overexpression of exogenous tagged SUMO
isoforms in cells [6,32,33]. An important feature of monobodies
is their potential to provide an additional tool for isolating
SUMO target proteins. CoIPs are often limited by the appearance
of immunoglobulin bands in the purified protein sample and
SUMO overexpression can lead to non-physiological interactions
and distributions. These issues are completely avoided with
monobodies. Our proof-of-concept data show that endogenous
SUMOylated proteins are effectively pulled down from human
and rat cells and monobody pull-downs compare favourably
with conventional antibody IPs. Furthermore, monobodies appear
to be at least equivalent to the available antibodies for the
detection of SUMO1ylated proteins in Western blotting and
immunofluorescence assays. Finally, a major advantage of
monobodies is that, unlike antibodies, they are produced in
bacteria, are extremely cost-effective and avoid the use of animals
associated with the production of conventional antibodies.
In summary, we show that two monobodies bind specifically
to SUMO, inhibit protein SUMOylation in vivo, are potent tools
for the purification of SUMO1 conjugates from mammalian cell
lysates and tissue, and can also be used as an alternative to
conventional antibodies for the detection of SUMO1 in a variety
of assays. Therefore, we believe that monobodies are likely to be
extremely useful new reagents for investigating the mechanisms,
targets and functional outcomes of protein SUMOylation.
AUTHOR CONTRIBUTION
Anja Berndt, Kevin Wilkinson and Jeremy Henley designed the research. Anja Berndt, Kevin
Wilkinson, Michaela Heimann and Paul Bishop performed the research. Anja Berndt,
Inhibition of SUMOylation in vivo
Kevin Wilkinson and Jeremy Henley analysed the data. Anja Berndt, Kevin Wilkinson and
Jeremy Henley wrote the paper. All authors read and approved the paper.
ACKNOWLEDGEMENTS
We thank Dr Shohei Koide (Biochemistry and Molecular Biophysics, University of
Chicago, Chicago, IL, U.S.A.) for the monobody clones and Professor Thomas Stamminger
(Institut für Klinische und Molekulare Virologie, Universitäts-Klinikum Erlangen, Erlangen,
Germany) for the pHM1546 plasmid. We also thank Ron Hay for the sheep anti-SUMO
antibodies and Franke Melchior (University of Heidelberg, Heidelberg, Germany) for the
YFP–SUMO plasmids.
FUNDING
This work was funded by the European Research Council grant SUMOBRAIN [agreement
number 232881] and the Medical Research Council.
REFERENCES
1 Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12
2 Geiss-Friedlander, R. and Melchior, F. (2007) Concepts in sumoylation: a decade on. Nat.
Rev. Mol. Cell Biol. 8, 947–956
3 Matunis, M. J., Coutavas, E. and Blobel, G. (1996) A novel ubiquitin-like modification
modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the
cytosol and the nuclear pore complex. J. Cell Biol. 135, 1457–1470
4 Mahajan, R., Delphin, C., Guan, T., Gerace, L. and Melchior, F. (1997) A small
ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex
protein RanBP2. Cell 88, 97–107
5 Wilkinson, K. A. and Henley, J. M. (2010) Mechanisms, regulation and consequences of
protein SUMOylation. Biochem. J. 428, 133–145
6 Bruderer, R., Tatham, M. H., Plechanovova, A., Matic, I., Garg, A. K. and Hay, R. T. (2011)
Purification and identification of endogenous polySUMO conjugates. EMBO Rep. 12,
142–148
7 Hannoun, Z., Greenhough, S., Jaffray, E., Hay, R. T. and Hay, D. C. (2010)
Post-translational modification by SUMO. Toxicology 278, 288–293
8 Praefcke, G. J., Hofmann, K. and Dohmen, R. J. (2012) SUMO playing tag with ubiquitin.
Trends Biochem. Sci. 37, 23–31
9 Berndt, A., Wilkinson, K. A. and Henley, J. M. (2012) Regulation of neuronal protein
trafficking and translocation by SUMOylation. Biomolecules 2, 256–268
10 Desterro, J. M., Rodriguez, M. S., Kemp, G. D. and Hay, R. T. (1999) Identification of the
enzyme required for activation of the small ubiquitin-like protein SUMO-1. J. Biol. Chem.
274, 10618–10624
11 Gong, L., Li, B., Millas, S. and Yeh, E. T. (1999) Molecular cloning and characterization of
human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS
Lett. 448, 185–189
12 Kerscher, O. (2007) SUMO junction-what’s your function? New insights through
SUMO-interacting motifs. EMBO Rep. 8, 550–555
13 Song, J., Zhang, Z., Hu, W. and Chen, Y. (2005) Small ubiquitin-like modifier (SUMO)
recognition of a SUMO binding motif: a reversal of the bound orientation. J. Biol. Chem.
280, 40122–40129
14 Berndt, A., Hofmann-Winkler, H., Tavalai, N., Hahn, G. and Stamminger, T. (2009)
Importance of covalent and noncovalent SUMO interactions with the major human
cytomegalovirus transactivator IE2p86 for viral infection. J. Virol. 83, 12881–12894
15 Takahashi, T. (2005) Postsynaptic receptor mechanisms underlying developmental
speeding of synaptic transmission. Neurosci. Res. 53, 229–240
395
16 Perry, J. J., Tainer, J. A. and Boddy, M. N. (2008) A SIM-ultaneous role for SUMO and
ubiquitin. Trends Biochem. Sci. 33, 201–208
17 Li, Q., He, Y., Wei, L., Wu, X., Wu, D., Lin, S., Wang, Z., Ye, Z. and Lin, S. C. (2010) AXIN
is an essential co-activator for the promyelocytic leukemia protein in p53 activation.
Oncogene 30, 1194–1204
18 Chang, P. C., Izumiya, Y., Wu, C. Y., Fitzgerald, L. D., Campbell, M., Ellison, T. J., Lam, K.
S., Luciw, P. A. and Kung, H. J. (2010) Kaposi’s sarcoma-associated herpesvirus (KSHV)
encodes a SUMO E3 ligase that is SIM-dependent and SUMO-2/3-specific. J. Biol.
Chem. 285, 5266–5273
19 Gilbreth, R. N., Truong, K., Madu, I., Koide, A., Wojcik, J. B., Li, N. S., Piccirilli, J. A.,
Chen, Y. and Koide, S. (2011) Isoform-specific monobody inhibitors of small
ubiquitin-related modifiers engineered using structure-guided library design. Proc. Natl.
Acad. Sci. U.S.A. 108, 7751–7756
20 Koide, A., Wojcik, J., Gilbreth, R. N., Hoey, R. J. and Koide, S. (2012) Teaching an old
scaffold new tricks: monobodies constructed using alternative surfaces of the FN3
scaffold. J. Mol. Biol. 415, 393–405
21 Wojcik, J., Hantschel, O., Grebien, F., Kaupe, I., Bennett, K. L., Barkinge, J., Jones, R. B.,
Koide, A., Superti-Furga, G. and Koide, S. (2010) A potent and highly specific FN3
monobody inhibitor of the Abl SH2 domain. Nat. Struct. Mol. Biol. 17, 519–527
22 Konopacki, F. A., Jaafari, N., Rocca, D. L., Wilkinson, K. A., Chamberlain, S., Rubin, P.,
Kantamneni, S., Mellor, J. R. and Henley, J. M. (2011) Agonist-induced PKC
phosphorylation regulates GluK2 SUMOylation and kainate receptor endocytosis. Proc.
Natl. Acad. Sci. U.S.A. 108, 19772–19777
23 Kantamneni, S., Wilkinson, K. A., Jaafari, N., Ashikaga, E., Rocca, D., Rubin, P., Jacobs,
S. C., Nishimune, A. and Henley, J. M. (2011) Activity-dependent SUMOylation of the
brain-specific scaffolding protein GISP. Biochem. Biophys. Res. Commun. 409,
657–662
24 Hofmann, H., Floss, S. and Stamminger, T. (2000) Covalent modification of the
transactivator protein IE2-p86 of human cytomegalovirus by conjugation to the
ubiquitin-homologous proteins SUMO-1 and hSMT3b. J. Virol. 74, 2510–2524
25 Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G. and Chen, Y. (2004) Identification
of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc. Natl. Acad. Sci.
U.S.A. 101, 14373–14378
26 Matic, I., van Hagen, M., Schimmel, J., Macek, B., Ogg, S. C., Tatham, M. H., Hay, R. T.,
Lamond, A. I., Mann, M. and Vertegaal, A. C. (2008) In vivo identification of human small
ubiquitin-like modifier polymerization sites by high accuracy mass spectrometry and an
in vitro to in vivo strategy. Mol. Cell. Proteomics 7, 132–144
27 Hu, C. D., Chinenov, Y. and Kerppola, T. K. (2002) Visualization of interactions among
bZIP and Rel family proteins in living cells using bimolecular fluorescence
complementation. Mol. Cell 9, 789–798
28 Muller, S., Hoege, C., Pyrowolakis, G. and Jentsch, S. (2001) SUMO, ubiquitin’s
mysterious cousin. Nat. Rev. Mol. Cell Biol. 2, 202–210
29 Lallemand-Breitenbach, V., Jeanne, M., Benhenda, S., Nasr, R., Lei, M., Peres, L., Zhou, J.,
Zhu, J., Raught, B. and de The, H. (2008) Arsenic degrades PML or PML-RARα through a
SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat. Cell Biol. 10, 547–555
30 Anderson, D. B., Wilkinson, K. A. and Henley, J. M. (2009) Protein SUMOylation in
neuropathological conditions. Drug News Perspect. 22, 255–265
31 Nacerddine, K., Lehembre, F., Bhaumik, M., Artus, J., Cohen-Tannoudji, M., Babinet, C.,
Pandolfi, P. P. and Dejean, A. (2005) The SUMO pathway is essential for nuclear integrity
and chromosome segregation in mice. Dev. Cell 9, 769–779
32 Wilkinson, K. A., Nishimune, A. and Henley, J. M. (2008) Analysis of SUMO-1
modification of neuronal proteins containing consensus SUMOylation motifs. Neurosci.
Lett. 436, 239–244
33 Golebiowski, F., Matic, I., Tatham, M. H., Cole, C., Yin, Y., Nakamura, A., Cox, J., Barton,
G. J., Mann, M. and Hay, R. T. (2009) System-wide changes to SUMO modifications in
response to heat shock. Sci. Signaling 2, ra24
Received 15 February 2013/23 August 2013; accepted 17 September 2013
Published as BJ Immediate Publication 17 September 2013, doi:10.1042/BJ20130241
c The Authors Journal compilation c 2013 Biochemical Society