Download QTL analysis of yield traits in an advanced backcross

Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
Research Article
Open Access
Isolation and Expression Analysis of a β-Ketoacyl-Acyl Carrier Protein
Synthase Ⅰ gene from Arachis hypogaea L.
Xiaoyuan Chi , Mingna Chen , Qingli Yang , Ya’nan He , Lijuan Pan , Yuan Gao , Shanlin Yu
Shandong Peanut Research Institute, Qingdao, 266100
Corresponding author email: [email protected];
Authors
Legume Genomics and Genetics 2010, Vol.1 No.3 DOI:10.5376/lgg.2010.01.0003
Received: July 1, 2010
Accepted: September 10, 2010
Published: October 10, 2010
This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article as:
Chi et al., 2010, Isolation and Expression Analysis of a β-Ketoacyl-Acyl Carrier Protein Synthase Ⅰ gene from Arachis hypogaea L., Legume Genomics
and Genetics, Vol.1 No.3 (DOI:10.5376/lgg.2010.01.0003)
Abstract β-ketoacyl-acyl carrier protein synthase (KAS) plays a pivotal role in de novo fatty acid biosynthesis, joining short carbon
units to construct fatty acyl chains by a three-step Claisen condensation reaction in plants and bacteria. A putative KASⅠ cDNAs was
isolated from peanut by searching a peanut seedling full-length cDNA library. The AhKASⅠ contains four strictly conserved
residues Cys221–His361–Lys392–His397 in the active site, which is an important characteristic of KAS Is in plants and bacteria. The
AhKASⅠ gene containing 1 912 bp cDNA sequence with a 1 413 bp ORF, encodes 470 amino acids. The predicted amino acid
sequences translated from the AhKASⅠ gene shared 90.2% sequence identity to the corresponding protein in Glycine max. The
cDNA was cloned into plasmid pET-28a and expressed in Escherichia coli BL21. Quantitative real-time PCR analysis suggested
AhKASⅠ was expressed with higher levels in leaf and seed than those in other tissues. In addition, AhKASⅠ RNA was found in high
abundance at 45 and 65 DAP (days after pegging) during seed development. This work may serve as a foundation for further studies
on the mechanisms regulating the expression of KASⅠ gene and provide candidate genes for modifying oil quality via transgenic
plants.
Keywords Fatty acid biosynthesis, β-ketoacyl-ACP synthase Ⅰ, Expression analysis, peanut (Arachis hypogaea L.)
Background
The de novo fatty acid biosynthesis is a very important primary metabolic pathway, producing palmitic acid (16:0) and
stearic acid (18:0) that serve as the precursors for other fatty acids with different lengths and saturation levels (Ohkrigge
and Browse, 1995). Fatty acid biosynthesis in higher plants is mainly catalyzed by a suit of enzymes in plastids and the
two-carbon elongation reactions are catalyzed by β-ketoacyl-acyl carrier protein (ACP) synthase (KAS, EC 2.3.1.41)
family. KASⅢ initiates the fatty acid synthesis to form 4:0-ACP in plants by catalyzing the condensing reaction of
acetyl-CoA and malonyl-ACP. KASⅠ catalyzes the condensations of acetate unites to a growing acyl-ACP leading to
the synthesis of palmitoyl-ACP (16:0-ACP). KASⅡ is responsible for the elongation of 16:0-ACP to 18:0-ACP
(Shimakata and Stumpf, 1982). A fourth KAS enzyme (KASⅣ) located in plastid specific for the synthesis of
medium-chain acids has also been reported (Siggaard-Andersen et al., 1994; Dehesh et al., 1998). In addition, the
mitochondrial condensing enzyme (mtKAS), which catalyzes all the condensation reactions in mitochondrial fatty acid
synthesis, has been characterised from A. thaliana (Yasuno et al., 2004) and the crystal structure of this enzyme has
been determined (Olsen et al., 2004).
By now, several species of β-ketoacyl-ACP synthases in plants and bacteria have been identified, distinct in amino acid
sequence, chain length specificity for their substrates and sensitivity to cerulenin, an inhibitor of condensing enzymes
(Vance et al., 1972; Kauppinen et al., 1988). The KAS family (fabB, fabF and fabH) have been most extensively studied
in E. coli and their crystal structures have been determined (White et al., 2005). In contrast to the well-studied E. coli
KAS family, plant KAS family is largely uncharacterized except in A. thaliana (Li et al., 2009). KASⅢ was first
purified to homogeneity from spinach (Clough et al., 1992) and its cDNAs have been cloned from several plant species
Page 1 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
(Tai and Jaworski, 1993; Tai et al., 1994; Slabaugh et al., 1995; Chen and Post-Beittenmiller, 1996). In addition, cDNAs
of KASⅡ have also been isolated from many species including soybean, rape, perilla and Arabidopsis (Aghoram et al.,
2006; Carlsson et al., 2002; Hwang et al., 2000). It has been demonstrated that the altered expression levels of KASⅡ
and KASⅢ lead to change of oil content and qualities in A. thaliana (Abbadi et al., 2000; Dehesh et al., 2001;
Pidkowich et al., 2007). KASⅠ has been purified from Spinacia oleracea leaves, and a gene encoding KASⅠ has
also been characterized in barley (Shimakat et al., 1983; Kauppinen, 1992). However, the function and the regulation of
KAS family were still not well understood in higher plants.
Peanut is one of the four most important oil crops widely grown in the world. It would be of great importance to study
the fatty acid biosynthesis pathway for improving oil quality and increasing oil content of peanut. In this study, we
isolated and characterized a cDNA containing the complete coding region of KASⅠ gene, and analyzed its expression
in different organs and at different developmental stages of seeds.
1 Results
1.1 Molecular cloning of AhKASⅠ gene from peanut
One full-length AhKAS Ⅰ cDNA clone was identified from a peanut seedling full-length cDNA library
(unpublished data) based on the amino acid similarity. The AhKASⅠ gene is 1 912 bp in length containing a 1
413 bp ORF, starting with an initiating codon at 238 bp and ending with a stop codon at 1 650 bp (accession
number FJ768729). The predicted protein product of AhKASⅠ comprises 470 amino acids with the calculated
molecular mass of 49.958 9 kD and a pI of 8.46. Prediction of subcellular location suggested that AhKASⅠ
protein probably located in chloroplast. The first 48 amino acids at the N-terminal end of the deduced protein have
a high proportion of hydroxylated and small, hydrophobic amino acids, typical of chloroplast transit peptide. We
have tentatively identified the transit peptide cleavage site at amino acid 49 based on the ChloroP 1.1 Server. A
Blast search revealed that the primary structure of AhKASⅠ shared 90.2%, 84.8%, 84.5%, 81.3% identity with
KASⅠ genes from Glycine max, Ricinus communis, Helianthus annuus and Arabidopsis thaliana, respectively
(Figure 1). In addition, using Rapid Amplification of cDNA Ends (RACE) method, we have isolated a KASⅡ
gene (accession number FJ358425) containing a 1 521 bp complete open reading frame (ORF) from peanut
seedling, named AhKASⅡ, which was presumed to be located in chloroplast. The plastid-localized AhKASⅠ and
AhKASⅡ are 50.3% identical in this study, compared with 38% in E. coli. AhKASⅠ shared 28.8% and 38.5%
identity with EcFabB and EcFabF, respectively, whereas AhKASⅡ shared 26.7% and 35.8% identity.
1.2 Sequence and phylogenetic analysis of AhKASⅠ gene
A subgroup of β-ketoacyl-ACP synthases, including mitochondrial β-ketoacyl-ACP synthase, bacterial plus plastid
β-ketoacyl-ACP synthases Ⅰ and Ⅱ, and a domain of human fatty acid synthase, have a Cys-His-His triad and
also a completely conserved Lys in the active site, which are referred to as the CHH group (von
Wettstein-Knowles et al., 2006). Another group of decarboxylating condensing enzymes called CHN (N for
asparagine), represented by KASⅢ and certain polyketide synthases (Qiu et al., 1999; Davies et al., 2000;
Scarsdale et al., 2001) with an active site composed of a cysteine nucleophile, a histidine and an asparagine. Four
conserved residues Cys221–His361–Lys392 –His397 of AhKASⅠ were revealed by sequence alignments
(Figure 1). The CHH active site (Cys–His–His) was highly conserved in KASⅠ and KASⅡ in higher plants and
E. coli (Li et al., 2009).
To examine the relationships among different sources of KASⅠ genes, the neighbour-joining method was used to
construct the phylogenetic trees (Figure 2). All tree topologies are highly congruent. As shown in the phylogenetic
tree, all of the AhKASⅠ genes fell into two subfamilies: the bacteria subfamily and the cyanobacteria/green
algae/mosses/higher plants subfamily. The AhKASⅠ gene from peanut clustered with those from higher plants,
and the genes from cyanobacteria may be the origin of genes from higher plants, mosses and eukaryotic algae.
1.3 Heterologous expression of AhKASⅠ gene in E. coli cells
The AhKASⅠ enzyme was overexpressed using the pET vector system in E. coli. Gene expression and the
Page 2 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
Figure 1 Alignment of the complete deduced amino acid sequences of β-ketoacyl-ACP synthase Ⅰ genes
Note: Conserved amino acid residues are highlighted in black boxes. The sequences are denoted by their strain names. The four conserved
residues of A. hypogaea KASⅠ corresponding to E. coli FabB Cys163, His298, Lys328 and His333 are highlighted in asterisks. Accession
numbers for the sequences were as follows: Arachis hypogaea (FJ768729), Glycine max (AAF61730), Arabidopsis thaliana (AAC49118),
Ricinus communis (AAA33873), Escherichia coli (AAC67304), Jatropha curcas (ABJ90468), Helianthus annuus (ABM53471)
Figure 2 Neighbor-joining tree based on the deduced amino acid sequences of KASⅠ homologs
Note: Sequences are shown by their accession numbers and strain names; Bootstrap values from neighbor-joining analyses are listed
to the left of each node, with values more than 50 are shown
molecular weight of this enzyme were monitored by SDS-PAGE (Figure 3). After IPTG induction, a novel
polypeptide with the molecular mass of approximately 49 kD was expressed in E. coli as revealed by SDS-PAGE.
The recombinant protein reached maximal expression levels 4 to 8 h after induction and showed a similar
molecular weight of approximately 49 kD compared to the deduced value.
Page 3 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
Figure 3 The SDS-PAGE map of AhKASⅠ protein expression
Note: M: Protein marker MP102 (Tiangen, China); 1: AhKASⅠ recombination protein containing His.Tag not induced with IPTG;
2~6: AhKASⅠ recombination protein containing His.Tag induced with IPTG for 1 h, 2 h, 4 h, 6 h, 8 h, respectively
1.4 Quantitative real-time PCR analysis of AhKASⅠ gene
The quantitative real-time PCR (qRT-PCR) was employed to confirm the expression patterns of AhKASⅠ gene in
four peanut tissues and at different developmental stages of seeds. β-actin was used as an internal reference
control for total RNA input. β-actin PCR product was not detected when reverse transcriptase was omitted,
indicating that the RNA template was free of genomic DNA. The results revealed that AhKASⅠ gene displayed
tissue-specific expression patterns in peanut (Figure 4). The AhKASⅠ gene was expressed dominantly in leaf
among four tissues tested, and expressed at the lowest level in stem. In addition, comparative analysis among
seeds over five development stages showed that AhKASⅠ gene expressed in an irregular course during seed
development. It had highest expression at 45 DAP and the expression level at 65 DAP was also relatively high
(Figure 5).
Figure 4 Expression analysis of AhKASⅠ gene in four different tissues
Figure 5 Expression analysis of AhKASⅠ gene in seed at different developmental stages
2 Discussion
The formation of carbon–carbon bonds is a fundamental biochemical reaction. A number of enzymes involved in
Page 4 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
various biosynthetic pathways accomplish this reaction by different means. Among them, one mechanism is the
Claisen condensation, a reaction catalyzed by β-ketoacyl-ACP synthase (KAS) enzymes (Olsen et al., 2001). In
higher plants five types of KAS, namely, KASⅠ, KASⅡ, KASⅢ, KASⅣ and mitochondrial KAS, have been
reported (Li et al., 2009). In the present study, we isolated a KASⅠ orthologue in peanut seedling. We
investigated the homology of this gene, the deduced protein’s active sites, physicochemical properties and its
subcellular location through bioinformatics analysis. The results revealed that the amino acid sequences of peanut
AhKASⅠ shared high sequence identity, 90.2% and 84.8%, with Glycine max and Ricinus communis KASⅠ
proteins, respectively. Moreover, phylogenetic analysis showed that AhKASⅠ gene clustered with those from
higher plants, and the genes from cyanobacteria may be the origin of genes from higher plants, mosses and
eukaryotic algae. Real-time PCR analysis revealed that the expression level of AhKASⅠ was higher in leaf and
seed than those in other tissues. In addition, AhKASⅠ RNA was found in high abundance at 45 and 65 DAP
during seed development.
Plant seed oil production can be manipulated through modifying the plant type Ⅱ FAS components. Despite
recent progress in detailed characterization of many enzymes involved in plant fatty acid synthesis, the
mechanism of plant fatty acid synthesis is not well understood (Ohlrogge and Jaworski, 1997). To increase the
expression of a single gene in a complex fatty acid synthesis pathway is not effective in changing the final product,
unless concomitant changes in other enzymes involved are achieved. Therefore the regulation should be spread
out and coordinated among the many enzymes involved in the pathway (Dehesh et al., 2001). In the present study,
the β-ketoacyl-ACP synthase Ⅰ gene from peanut was identified. This enzyme is critical to the elongation step
and plays a pivotal role in the regulation of the entire pathway (Magnuson et al., 1993). This work may serve as a
foundation for further studies on the mechanisms regulating the expression of KASⅠ gene and provide candidate
genes for modifying oil quality via transgenic plants.
3 Materials and methods
3.1 Plant materials
Peanut seeds (Arachis hypogaea L. cultivar Huayu19) were sown in sand and soil mixture (1:1), grown in a
growth chamber under a 16 h-8 h light-dark cycle at 26°C and 22°C, respectively. Three kinds of 12-day-old
tissues including root, stem and leaves were collected as experimental materials for quantitative real-time RT-PCR
analysis. In addition, the immature peanut seeds from 25 to 60 days after pegging (DAP) were also collected for
expression analysis. The peanut cultivar was provided by Shandong Peanut Research Institute, Qingdao, China.
3.2 Nucleic acid manipulation
Total RNA was extracted from samples using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s
instructions. The RNA samples were used for real-time RT-PCR after RQ1 RNase-free DNaseI (Promega,
Wisconsin, USA) treatment to remove genomic DNA. The first-strand cDNA was synthesized with RT-PCR kit
(Promega, Wisconsin, USA) using 500 ng of total RNA according to the manufacturer’s instructions. Controls
received water instead of reverse transcriptase to assess any contamination from genomic DNA as described by
Zhou et al. (2007).
3.3 Full-length cDNA sequence isolation
PCR was performed with the LA PCR system (Takara) using 2.5 μL of 10×PCR buffer with MgCl2, 1 μL of 10
μmol/L each primer, 4.0 μL of 10 mmol/L dNTPs, 1 μL cDNA samples and 0.5 μL LA Taq™ DNA polymerase,
and 15 μL double distilled water. Reaction conditions were as follows: 5 min denaturation at 94°C, followed by 30
cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min 30 s, finally extended at 72°C for 10 min. The PCR
products were run on 1% agarose gel and purified with Gel Extraction Kit (TaKaRa) according to the
manufacturer’s protocol. The purified products were then cloned into the pMD18-T Easy vector (TaKaRa) and
Page 5 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
sequenced (Shangon, Shanghai).
3.4 Sequence analysis
Open reading frame (ORF) and encoded amino acid sequence of genes were deduced by BioXM 2.6.
Physicochemical
properties
of
the
deduced
protein
were
predicted
by
Protparam
(http://www.expasy.ch/tools/protparam.html). The putative subcellular localizations of the candidate proteins were
estimated
by
TargetP
(http://www.cbs.dtu.dk/services/TargetP/)
and
Predotar
(http://urgi.versailles.inra.fr/predotar/predotar.html). The potential N-terminal presequence cleavage site was
predicted by ChloroP (http://www.cbs.dtu.dk/services/ChloroP/).
3.5 Phylogenetic analysis
Amino acid sequences were aligned using ClustalX program with the implanted BioEdit (Thompson et al., 1994).
The neighbor-joining (NJ) method in MEGA4 (Tamura et al., 2007) was used to construct the phylogenetic tree.
Bootstrap with 1 000 replicates was used to establish the confidence limit of the tree branches. Default program
parameters were used.
3.6 Expression of AhKASⅠ in E. coli
Two specific primers (KASⅠ-F2 and KASⅠ-R) were used to obtain the full-length open reading frames (Table
1). The 5’ end of the KASⅠ-F2 and KASⅠ-R2 contains an EcoRⅠ or an XhoⅠ restriction site (underlined) to
facilitate subsequent manipulations. The amplified fragment was digested with EcoRⅠ and XhoⅠ, followed by
ligation with EcoRⅠ/XhoⅠ-digested pET-28a (Novagen) to produce pET-KASⅠ, and no amplification errors
were detected through re-sequencing. The constructed plasmid was transformed into E. coli strain BL21 and
grown in 50 mL LB medium containing 50 ug/ml kanamycin at 37°C to a optical density of A 600=0.6~0.8. The
expression of recombinant protein was induced by adding isopropyl β-D-thiogalactoside (IPTG) to the culture at a
final concentration of 1.0 mmol/L. Cells were harvested by centrifugation after incubation at 37℃ for 1 h, 2 h, 4
h, 6 h, 8 h, respectively. The protein extracts were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE)
and stained with Coomassie brilliant blue R-250.
Table 1 Primers used in experiment
Type
Full-length
Name
cDNA
sequence
KASⅠ-F1
cloning
Real-time PCR
Prokaryotic expression
Oligonucleotide sequence (5’–3’)
ATGCAAGCCATTCACACACC
KASⅠ-R1
TCAGGGCTTGAAAGCAGAAAA
qActin-F
TTGGAATGGGTCAGAAGGATGC
qActin-R
AGTGGTGCCTCAGTAAGAAGC
qKASⅠ-F
TCTACTCTTGCTGGTGACTTGG
qKASⅠ-R
ATTGAATTGATTGATTGACGGATGC
KASⅠ-F2
TTGGAATTCATGCAAGCCATTCACAC
KASⅠ-R2
TACCTCGAGTCAGGGCTTGAAAGCAG
3.7 Quantitative real-time PCR
The real-time PCR analysis was performed by using a LightCycler 2.0 instrument system (Roche, Germany).
β-actin gene was taken as reference gene. Three pairs of gene-specific primers (Table 1) were designed according
to the AhKASⅠ cDNA (qKASⅠ-F and qKASⅠ-R) and β-actin (qActin-F and qActin-R) sequences. The
real-time RT-PCR reactions were performed by using the SYBR Premix Ex Taq polymerase (TaKaRa, Japan)
according to the manufacturer’s instructions. The expression of the gene was calculated relative to the calibration
sample and the β-actin to normalize the sample input amount. All the experiments were performed in triplicate to
Page 6 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
ensure the data accuracy.
Authors’contributions
Xiaoyuan Chi was responsible for the large part of data acquisition. Mingna Chen, Qingli Yang, Ya’nan He, Lijuan Pan, Yuan Gao analyzed data and wrote
substantial parts of the paper. Shanlin Yu conceived the overall study, performed the experiment designs and took part in the data analysis and the writing. All
authors read and approved the final manuscript.
Acknowledgements
This work was supported by a grant from Modern Agro-industry Technology Research System (nycytx-19), National High-Tech Research and Development
Plan of China (2006AA10A114; 2007AA10Z189), National Project of Scientific and Technical Supporting Program (2008BAD97B04), the National Natural
Science Foundation of China (31000728) and the Natural Science Fund of Shangdong Province (ZR2009DQ004)
References
Abbadi A., Brummel M., and Spener F., 2000, Knockout of the regulatory
site of 3-ketoacyl-ACP synthase Ⅲenhances short- and medium-chain
acyl-ACP synthesis, Plant J., 24: 1-9
Aghoram K., Wilson R.F., Burton J.W., and Dewey R.E., 2006, A mutation
in a 3-keto-acyl-ACP synthase Ⅱ gene is associated with elevated
palmitic acid levels in soybean seeds, Crop Sci., 46: 2453-2459
Carlsson A.S., LaBrie S.T., Kinney A.J., von Wettstein-Knowles P., and
Browse J., 2002, A KAS2 cDNA complements the phenotypes of the
Arabidopsis fab1 mutant that differs in a single residue bordering the
substrate binding pocket, Plant J., 29: 761-770
Chen J., and Post-Beittenmiller D., 1996, Molecular cloning of a cDNA
encoding β-ketoacyl-acyl carrier protein synthase Ⅲ from leek, Gene,
182(1-2): 45-52
Clough R.C., Matthis A.L., Barnum S.R., and Jaworski J.G., 1992,
Purification and characterization of 3-ketoacyl-acyl carrier protein
synthase- Ⅲ
from spinach: a condensing enzyme utilizing
acetyl-coenzyme A to initiate fatty acid synthesis, J. Biol. Chem., 267:
20992-20998
Davies C., Heath R.J., White S.W., and Rock C.O., 2000, The 1.8 Å crystal
structure and active site architecture of β-ketoacyl-acyl carrier protein
synthase Ⅲ (FabH) from Escherichia coli, Structure, 8: 85-195
Dehesh K., Edwards P., Fillatti J., Slabaugh M., and Byrne J., 1998, KASⅣ:
a 3-ketoacyl-ACP synthase from Cuphea sp. is a medium chain specific
condensing enzyme, Plant J., 15(3): 383-390
Dehesh K., Tai H., Edwards P., Byrne J., and Jaworski J.G., 2001,
Overexpression of 3-ketoacyl-acyl-carrier protein synthase Ⅲ s in
plants reduces the rate of lipid synthesis, Plant Physiol., 125:
1103-1114
Hwang S.K., Kim K.H., and Hwang Y.S., 2000, Molecular cloning and
expression analysis of 3-ketoacyl-ACP synthases in the immature seeds
of Perilla frutescens, Mol. cells, 10(5): 533-539
Kauppinen S., Siggaard-Andersen M., and von Wettstein-Knowles P., 1988,
β-Ketoacyl-ACP synthase Ⅰ of Escherichia coli: nucleotide sequence
of the fabB gene and identification of the cerulenin binding residue,
Carlsberg Res., Commun., 53: 357-370
Kauppinen S., 1992, Structure and expression of the Kas12 gene encoding a
β-ketoacyl-acyl carrier protein synthase Ⅰ isozyme from Barley, J.
Biol. Chem., 267(25): 23999-24006
Li M.J., Li A.Q., Xia H., Zhao C.J., Li C.S., Wan S.B., Bi Y.P., and Wang
X.J., 2009, Cloning and sequence analysis of putative type Ⅱ fatty
acid synthase genes from Arachis hypogaea L., J. Biosci., 34(2):
227-238
Magnuson K., Jackowski S., Rock C.O., and Cronan J.E.Jr., 1993,
Regulation of fatty acid biosynthesis in Escherichia coli. Microbiol,
Rev., 57: 522-542
Ohkrigge J., and Browse J., 1995, Lipid biosynthesis, The Plant Cell, 7:
957-970
Ohlrogge J.B., and Jaworski J.G., 1997, Regulation of fatty acid synthesis,
Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:109-136
Olsen J.G., Kadziola A., von Wettstein-Knowles P., Siggaard-Andersen M.,
and Larsen S., 2001, Structures of β-ketoacyl-acyl carrier protein
synthase Ⅰ complexed with fatty acids elucidate its catalytic
machinery, Structure, 9(3): 233-243
Olsen J.G., Rasmussen A.V., von Wettstein-Knowles P., and Henriksen A.,
2004, Structure of the mitochondrial beta-ketoacyl-[acyl carrier protein]
synthase from Arabidopsis and its role in fatty acid synthesis, FEBS
Lett., 577: 170-174
Pidkowich M.S., Nguyen H.T., Heilmann I., Ischebeck T., and Shanklin J.,
2007, Modulating seed beta-ketoacyl-acyl carrier protein synthase Ⅱ
level converts the composition of a temperate seed oil to that of a
palm-like tropical oil, Proc. Natl. Acad. Sci., USA., 104(11):
4742-4747
Qiu X., Janson C.A., Konstantinidis A.K., Nwagwu S., Silverman C., Smith
W.W., Khandekar S., Lonsdale J., and Abdel-Meguid S.S., 1999,
Crystal structure of β-ketoacyl-acyl carrier protein synthase Ⅲ. A key
condensing enzyme in bacterial fatty acid biosynthesis, J. Biol. Chem.,
274(51): 36465-36471
Scarsdale J.N., Kazanina G., He X., Reynolds K.A., and Wright H.T., 2001,
Crystal structure of the Mycobacterium tuberculosis β-ketoacyl-acyl
carrier protein synthase Ⅲ, J. Biol. Chem., 276: 20516-20522
Shimakata T., and Stumpf P.K., 1982, Isolation and function of spinach leaf
beta-ketoacyl-[acyl-carrier-protein] synthases, Proc. Natl. Acad. Sci.,
USA., 79(19): 5808-5812
Siggaard-Andersen M., Wissenbach M., Chuck J.A., Svendsen I., Olsen J.G.,
and von Wettstein-Knowles P., 1994, The fabJβ-ketoacyl-[acylcarrier protein] synthase Ⅳ from Escherichia coli is
sensitive to cerulenin and specific for short-chain substrates, Proc. Natl.
Acad. Sci., USA., 91: 11027-11031
Slabaugh M.B., Tai H., Jaworski J., and Knapp S.J., 1995, cDNA clones
encoding beta-ketoacyl-acyl carrier protein synthase Ⅲ from Cuphea
wrightii, Plant Physiol., 108: 443-444
Tai H.Y., and Jaworski J.G., 1993, 3-Ketoacyl-acyl carrier protein synthase
Ⅲ from spinach (Spinacia oleracea) is not similar to other condensing
enzymes of fatty acid synthase, Plant Physiol., 103: 1361-1367
Tai H., Post-Beittenmiller D., and Jaworski J.G., 1994, Cloning of a cDNA
encoding 3-ketoacyl-acyl carrier protein synthase Ⅲ
from
Arabidopsis, Plant Physiol., 106(2): 801-802
Tamura K., Dudley J., Nei M., and Kumar S., 2007, MEGA4: Molecular
evolutionary genetics analysis (MEGA) software version 4.0,
Molecular Biology and Evolution., 24: 1596-1599
Thompson J.D., Higgins D.G., and Gibson T.J., 1994, CLUSTAL W:
Improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and weight
matrix choice, Nucleic Acids Res., 22(22): 4673-4680
Vance D.E., Goldberg I., Mitsuhashi O., and Bloch K., 1972, Inhibition of
fatty acid synthetases by the antibiotic cerulenin, Biochem. Biophys.
Res. Commun., 48(3): 649-656
von Wettstein-Knowles P., Olsen J.G., McGuire K.A., and Henriksen A.,
Page 7 of 8
Legume Genomics and Genetics
LGG 2010, Vol.1, No.3 http://lgg.sophiapublisher.com
2006, Fatty acid synthesis. Role of active site histidines and lysine in
Cys-His-His-type β-ketoacyl-acyl carrier protein synthases, FEBS J.,
273(4): 695-710
White S.W., Zheng J., Zhang Y.M., and Rock C.O., 2005, The structural
biology of type II fatty acid biosynthesis, Annu. Rev. Biochem., 74:
791-831
Yasuno R., von Wettstein-Knowles P., and Wada H., 2004, Identification and
molecular characterization of the beta-ketoacyl-[acyl carrier protein]
synthase component of the Arabidopsis mitochondrial fatty acid
synthase, J. Biol. Chem., 279(9): 8242-8251
Zhou X.R., Robert S.S., Petrie J.R., Frampton D.M., Mansour P.M.,
Blackburn S.I., Nichols P.D., Green A.G., and Singh S.P., 2007,
Isolation and characterization of genes from the marine microalga
Pavlova salina encoding three front-end desaturases involved in
docosa- hexaenoic acid biosynthesis, Phytochemistry, 68: 785-796
Page 8 of 8