Download Cloning and sequence analysis of putative type II fatty

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
227
Cloning and sequence analysis of putative type II fatty acid synthase
genes from Arachis hypogaea L.
MENG-JUN LI, AI-QIN LI, HAN XIA, CHUAN-ZHI ZHAO, CHANG-SHENG LI, SHU-BO WAN,
YU-PING BI and XING-JUN WANG*
High-Tech Research Center, Shandong Academy of Agricultural Sciences, Key Laboratory for Genetic Improvement of
Crop, Animal and Poultry of Shandong Province, Key Laboratory of Crop Genetic Improvement and Biotechnology,
Huanghuaihai, Ministry of Agriculture, Ji’nan 250100, China
*Corresponding author (Email, [email protected])
The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty
acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing
a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of
acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP synthase (I, II, III), β-ketoacyl-ACP
reductase, β-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that
primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were
strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing
in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide
polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids
except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and
mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.
[Li M-J, Li A-Q, Xia H, Zhao C-Z, Li C-S, Wan S-B, Bi Y-P and Wang X-J 2009 Cloning and sequence analysis of putative type II fatty acid
synthase genes from Arachis hypogaea L.; J. Biosci. 34 227–238]
1.
Introduction
Oils are glycerol triesters of fatty acids and are mainly
derived from plant sources. Peanut is widely grown and ranks
fifth among the world oil crops (Moretzsohn et al. 2004). It
is of great importance to study the fatty acid biosynthesis
pathway for improving oil quality and increasing oil content
of peanut through biotechnology-based approaches.
Fatty acid biosynthesis is catalysed by two types of fatty
acid synthase (FAS). Type I FAS, as found in vertebrates,
yeast and some bacteria, contains all the active sites on
one or two multidomain polypeptides. In type II FAS of
many bacteria, plant plastids and mitochondria, the active
centres reside in discrete gene products. E. coli serves as the
paradigm for the type II FAS system. Acyl carrier protein
(ACP) functions to sequester the growing acyl chain attached
to the prosthetic phosphopantetheine group from solvent as
it shuttles the intermediates between type II FAS enzymes
(Zhang et al. 2003b). The condensation of malonyl-ACP
with acyl-ACP to form β-ketoacyl-ACP is catalysed by small
β-ketoacyl-ACP synthase (KAS) family enzymes. FabH
(β-ketoacyl-ACP synthase III, KASIII) condenses acetylCoA with malonyl-ACP to form 4:0-ACP, FabB (KAS I)
is responsible for the elongation of 4:0-ACP to 16:0-ACP,
and FabF (KAS II) mediates the elongation of 16:0-ACP
to 18:0-ACP. The formation of malonyl-ACP is catalysed
Keywords. Arachis hypogaea L.; EST sequencing; gene cloning; type II FAS
Abbreviations used: ACAT, acetyl CoA:ACP transacylase; ACP, acyl carrier protein; DAP, days after pegging; ENR, enoyl-ACP
reductase; EST, expressed sequence tag; FAS, fatty acid synthase; HD, β-hydroxyacyl-ACP dehydrase; KAS, β-ketoacyl-ACP synthase;
KR, β-ketoacyl-ACP reductase; MCAT, malonyl-CoA:ACP transacylase; NCBI, National Center for Biotechnology; ORF, open reading
frame; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; SNP, single-nucleotide polymorphism
http://www.ias.ac.in/jbiosci
J. Biosci. 34(2), June 2009, 227–238, © Indian Academy
Sciences
227
J. Biosci.of34(2),
June 2009
228
Meng-Jun Li et al
by acetyl-CoA carboxylase and FabD (malonyl-CoA:ACP
transacylase, MCAT). The reduction of β-ketoacyl-ACP to
β-hydroxyacyl-ACP by FabG (β-ketoacyl-ACP reductase,
KR) is the first reductive step. Two isozymes, FabA and
FabZ (β-hydroxyacyl-ACP dehydratases, HD), catalyse the
dehydration of β-hydroxyacyl-ACP to trans-2-acyl-ACP.
FabA is a bifunctional enzyme involved in the introduction
of a cis-double bond into the growing acyl chain (Heath and
Rock 1996). The last reduction in each elongation cycle is
catalysed by FabI (enoyl-ACP reductase, ENR).
The isolation and cloning of cDNAs encoding plant
plastid type II FAS genes have been reported in Arabidopsis
thaliana (Post-Beittenmiller et al. 1989; Lamppa and
Jacks 1991; Hlousek-Radojcic et al. 1992; Tai et al. 1994;
Carlsson et al. 2002), Brassica napus (Kater et al. 1991;
Simon and Slabas 1998), Cuphea sp (Klein et al. 1992;
Voetz et al. 1994; Slabaugh et al. 1995), Spinacia oleracea
(Scherer and Knauf 1987; Schmid and Ohlrogge 1990; Tai
and Jaworski 1993), Hordeum vulgare (Hansen and von
Wettstein-Knowles 1991; Hansen and Kauppinen 1991),
Coriandrum sativum (Mekhedov et al. 2001), and Allium
ampeloprasum (Chen and Post-Beittenmiller 1996). The
crystal structure determination of E. coli type II FAS
enzymes has been completed (White et al. 2005), but
only the crystal structure of B. napus KR and ENR has
been determined in higher plants (Rafferty et al. 1995;
Fisher et al. 2000). Most of the work with plant plastid
type II FAS is focused on ACP (Hlousek-Radojcic et al.
1992; Kopka et al. 1993; Suh et al. 1999; Bonaventure
and Ohlrogge 2002) and KAS (Clough et al. 1992; Olsen
et al. 1999; Abbadi et al. 2000; Dehesh et al. 2001; Pidkowich
et al. 2007). Plant ACPs are encoded by a multigene
family which expresses in a constitutive manner (HlousekRadojcic et al. 1992) or in a tissue-specific manner
(Bonaventure and Ohlrogge 2002). The altered expression
levels of KASII and KASIII lead to a change in oil content
and qualities in A. thaliana (Abbadi et al. 2000; Dehesh
et al. 2001; Pidkowich et al. 2007). In contrast to the
well-studied E. coli type II FAS system, plant type II FAS
enzymes located in plastids are largely uncharacterised
except in A. thaliana.
Plant mitochondrial fatty acid synthesis is also catalysed
by the type II FAS system (Olsen et al. 2004), in which only
ACP from Pisum sativum (Wada et al. 1997) and A. thaliana
(Shintani and Ohlrogge 1994), and KAS from A. thaliana
(Yasuno et al. 2004) have been characterised. The crystal
structure of mitochondrial KAS has been determined (Olsen
et al. 2004). Mitochondrial ACP functions as an essential
cofactor in lipoic acid synthesis (Shintani and Ohlrogge
1994; Wada et al. 1997). Mitochondrial KAS with its broad
chain length specificity accomplishes all condensation steps
in mitochondrial fatty acid synthesis (Yasuno et al. 2004).
The role of the mitochondrial fatty acid synthetic pathway
J. Biosci. 34(2), June 2009
is unclear because mitochondrial membrane fatty acids are
believed to originate outside mitochondria (Wada et al.
1997).
In this study, we report the cloning of A. hypogaea type
II FAS genes in plastids and two ACPs in mitochondria
by expressed sequence tag (EST) sequencing of a fulllength cDNA library and homology-based cloning
from immature peanut seeds. The primary structures of
plant type II FAS enzymes were analysed by sequence
alignments, and compared with that of E. coli. Furthermore,
homologues of each peanut type II gene in developing
seeds were investigated by cloning and sequencing. The
goal of our study was to provide a basis for elucidating the
molecular mechanism of fatty acid synthesis in peanut seed
development.
2.
2.1
Materials and methods
RNA isolation and cDNA library construction
Peanut (A. hypogaea cultivar luhua-14) was grown in
the farm and gynophores were labelled. The immature
peanut seeds from 20 to 60 days after pegging (DAP) were
collected, frozen in liquid N2 immediately and stored in a
freezer at –80ºC. Total RNA was extracted from the seeds by
the RNAgent kit (Promega, Madison, WI, USA). Messenger
RNA was isolated and purified from total RNA (Promega).
Directional cDNA synthesis (using adapters of EcoRI,
XhoI restriction sites) and library construction followed
the protocol of Stratagenes pBluescript II cDNA library
construction kit.
2.2
Analysis of ESTs
Each sequence obtained was edited using the Lasergene
SeqMan II Module (DNAStar) (http:/www.DNAStar.com).
Comparison of peanut ESTs with non-redundant protein
sequence databases (tBLASTx) at the National Center for
Biotechnology (NCBI) was performed to determine the
open reading frame (ORF) of the cDNA and probably gene
function.
2.3
Gene cloning
The full-length cDNAs of ACP, HD, ENR were identified
from our EST contigs. The 3′-end MCAT was cloned by
3′-rapid amplification of cDNA ends (3′-RACE). The KR,
KASI, KASII and KASIII genes were isolated by homologybased cloning. Primers were designed based on the homology
of KAS sequences from the NCBI. Fragments of KAS genes
were amplified by polymerase chain reaction (PCR) using
One-Shot LA PCRTM Mix (TaKaRa, Dalian, China). The
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
5′-RACE and 3′-RACE (5′/3′ RACE Kit, 2nd Generation,
Roche) primers were constructed based on known sequences
of KAS genes. PCR products were cloned into the pMD18-T
vector (TaKaRa).
2.4
Homologue analysis of type II FAS genes
Total RNA was isolated at six different seed development
stages (stage 1, 15 DAP; stage 2, 20 DAP; stage 3, 25 DAP;
stage 4, 35 DAP; stage 5, 45 DAP; stage 6, 70 DAP) using
RNAiso Reagent (TaKaRa) as described by the manufacturer.
Five microgram of RNA was reverse transcribed using a
PrimerScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa)
with oligo (dT) as the primer according to the protocol
provided by the supplier. The resulting cDNA was mixed
and diluted 10-fold and 1 μl was used as a template for
PCR amplification using 2×pfu PCR MasterMix (Tiangen
Biotech, Beijing, China) with the specific primers of each
type II FAS gene. The PCR products were cloned into the
pMD18-T vector (TaKaRa). Primers applied in homologue
analysis are available in supplementary materials.
Plasmid DNA was prepared using the EZNA Plasmid
Minipreps DNA Purification System (Omega Bio-Tek,
USA). Purified plasmid DNA was sequenced to obtain
the 5′- and 3′-end with BigDyeR Terminator v3.1 Cycle
Sequencing Kit (ABI) on an ABI 3730XL DNA Analyzer.
Nucleotide sequence assembly and homology searches
were performed using the tBLASTx tool online. Sequence
reassembly and coding region prediction were performed
using the Lasergene SeqMan II Module (DNAStar) (http:
//www.DNAStar.com). Multiple sequence alignments
were analysed using the ClustalW1.83 software (http:
//www.ch.embnet.org/software/ClustalW.html). Sequences
were shaded using the BoxShade program (http://
www.ch.embnet.org/software/BOX_form.html).
3.
3.1
Results
Cloning and sequence analysis of AhACP
Forty-three ACP cDNA clones were identified from ESTs
derived from the full-length cDNA library; these could be
divided into three groups: AhACP1 (36 clones), AhACP2
(6 clones) and AhACP3 (1clone) based on their amino acid
similarity. Twenty-seven ACPs from 6 plant species revealed
primary structure conservation among plant ACPs (figure 1).
Plant ACPs can clearly be divided into two types, which are
located in plastids (figure 1A) and mitochondria (figure 1B).
The central region encompassing the phosphopantetheine
attachment site consists of a serine residue within a DSL
motif recognised by members of the phosphopantetheinyl
transferase family (Mofid et al. 2002). The prosthetic
229
group forms a thioester bond with fatty acids resulting in
activation of the carboxyl carbon of the acyl group (Suh et
al. 1999). Helix II was the most conserved in plant ACP 4
α helices. Helix II plays a dominant role in the interaction
with type II FAS partner enzymes in plastids and has been
termed the ‘recognition helix’ of ACP (Zhang et al. 2003a).
Three other α helices, helix I, helix III and helix IV, were the
main distinguishing features of plant ACPs in plastids and
mitochondria (figure 1).
A CT-rich sequence and the motif CTCCGCC and its
derivative are conserved in the 5′-leader region of 18 plastid
ACP cDNA (Bonaventure and Ohlrogge 2002). Site-directed
mutagenesis of the CT-rich sequence, TTCTCTCTCCT,
resulted in a three-fold reduction in transcription of the
AtpC::uidA gene fusion (Bolle et al. 1996). The motif
CTCCGTC and two CT-rich sequences were identified in
the 5′-leader region of AhACP1 but not in AhACP2 and
AhACP3 (table 1). Lack of these two motifs may lead to
a difference in expression between AhACP1 and AhACP2,
AhACP3 in developing peanut seeds.
3.2
Cloning and sequence analysis of AhMCAT
In Sreptomyces coelicolor, MCAT is a key enzyme in both
fatty acid and polyketide synthesis (Keatinge-Clay et al.
2003). A MCAT cDNA clone was obtained from the peanut
cDNA library. AhMCAT contained a 1158 bp ORF, encoding
a protein of 385 amino acids with a predicted molecular
weight of 40.9 kD and a pI of 7.793. The deduced AhMCAT
sequence shared 32.7% sequence identity with E. coli FabD
(Serre et al. 1995).
In EcFabD, the active site, Ser92, is hydrogen-bonded
to His201. Gln250 serves as an H-bond acceptor during
interaction with His201. Arg117 might play a role in binding
the free carboxyl group. Gln11 can serve as an H-bond
donor (Serre et al. 1995). The residues of AhMCAT, Gln89,
Ser174, Arg199, His287 and Gln336, equivalent to EcFabD
Gln11, Ser92, Arg117, His201 and Gln250, were strictly
conserved in higher plants (figure 2). The GLSLGEY motif
containing the catalytic residue (serine174 in AhMCAT)
was completely conserved in higher plants, compared with
the E. coli GHSLGEY motif (figure 2). The G(H/L)SLG
pentapeptide belongs to the GXSXG motif (where x is any
residue) prevalent in α/β hydrolases (Keatinge-Clay et al.
2003), which is conserved in all bacterial species (Simon
and Slabas 1998).
3.3
Cloning and sequence analysis of AhKAS
In higher plants, five types of KAS have been reported;
namely, KASI, KASII, KASIII, KASIV and mitochondrial
KAS, but there were no KAS ESTs in our peanut full-length
J. Biosci. 34(2), June 2009
Meng-Jun Li et al
230
Figure 1. Multiple sequence alignment of selected acyl carrier protein (ACP) homologues. Protein sequences were aligned using the
CLUSTALW alignment algorithm and shaded using BoxShade. Identical and conserved residues are shaded black and grey, respectively.
The 4 α helices are indicated. Plant ACP Ser, corresponding to E. coli prosthetic group attachment site (Ser36), is marked with a triangle.
GenBank accession numbers are as follows : Ah1, EE127470; Ah2, EG373603; Ah3, EU823319; At1, NP_187153; At2, NP_175860;
At3, NP_564663; At4, NP_194235; At5, NP_198072; At6, NM_130026; At7, NP_176708; At8, NP_199574; Cl1, CAA54714; Cl2,
CAA54715; Cl3, CAA54716; Cl4, CAA64542; So1, CAA36288; So2, P07854; Os1, NP_001050125; Os2, NP_001051948; Os3, NP_
001055387; Os4, NP_001059204; Os5, NP_001062441; Os6, NP_001066930; Os7, NP_001067983; Hv1, AAA32920; Hv2, AAA32921
Hv3, AAA32922; Ec, AAB27925. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Cl, Cuphea lanceolata; So, S. oleracea; Os, Oryza
sativa; Hv, Hordeum vulgare; Ec, E. coli.
Table 1.
Proximal upstream sequence of acyl carrier protein (ACP) genes in peanut
ACP isoform
Sequence*
AhACP1
gcattctcattaccacaaacactcttctcgtgctCTCCGTCcaaatctcagatctctctctctgtgaaa atg
AhACP2
gagctaaagagagaagaactgagaagtgagaaccgagaatagagaagaagcaaagaagggttttaggtttttgtgtagatcgattttgca atg
AhACP3
gacactcactcattcattcttcaaagaagaagaa atg
*
The motif CTCCGTC is indicated in upper case. The CT-rich sequences are underlined. The ATG start codon is separated by one
space at the right end of the sequences.
cDNA library. We cloned three members of the KAS family
by a homology-based approach using KAS sequences of
Glycine, Medicago and peanut ESTs in GenBank. The
peanut AhKASI, AhKASII and AhKASIII contained a 1413
J. Biosci. 34(2), June 2009
bp, 1647 bp and 1206 bp ORF, encoding for a protein of 470,
548 and 401 amino acids with a predicted molecular mass
of 50.0, 58.7, 42.5 kDa and a pI of 8.192, 8.090 and 6.940,
respectively. AhKASI shared 51.5% sequence identity with
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
231
Figure 2. Multiple sequence alignment of selected malonyl-CoA:ACP transacylase (MCAT) homologues. Protein sequences
were aligned using the CLUSTALW alignment algorithm. The five conserved residues of A. hypogaea MCAT corresponding
to E.coli FabD Gln11, Ser92, Arg117, His201 and Gln250 are shaded black and position numbers are indicated. The motif
G(L/H)SLG is boxed. GenBank accession numbers are as follows: Ah, EU823322; Gm, ABB85235; At1, AAM14913; At2,
AAM64515; Bn, CAB45522; Pf, AAG43518; Ca, ACF17665; Os, ABF95452, Ec, 1MLA. Abbreviations: Ah, A. hypogaea;
Gm, Glycine max; At, A. thaliana; Bn, B. napus; Pf, Perilla frutescens; Ca, Capsicum annuum; Os, O. sativa; Ec, E. coli.
AhKASII and only 6.5% with AhKASIII. EcFabF shared
43.8% and 45.3% identity with AhKASI and AhKASII,
whereas EcFabB shared 33.7% and 31.8% identity, which
is consistent with results in Arabidopsis (von WettsteinKnowles et al. 2000). EcFabF was more closely related to
peanut plastid KASI and KASII than EcFabB.
The active site triads, Cys22–His36–His397 of AhKASI
and Cys299–His439–His475 of AhKAS II, were revealed
by sequence alignments. The Cys–His–His active site triad
was strictly conserved in KASI and KASII of higher plants
(figure 3).
The greatest distinction between the active-site
architecture of KASI, KASII and KASIII is the presence of
two histidines in KASI and KASII and a histidine plus an
asparagine in KASIII (von Wettstein-Knowles et al. 2000).
AhKASIII shared 41% sequence identity with EcFabH and
also had a Cys–His–Asn active site triad (Cys177, His327,
Asn357), corresponding to EcFabH Cys112, His244,
Asn274 (Qiu et al. 1999). The Cys–His–Asn active site triad
and the motif GNTSAAS were strictly conserved in higher
plants with the exception of Elaeis oleifera KASIII (Cys→
Tyr) (figure 4). Deletion of the tetrapeptide of GNTS led to a
change in secondary structure and complete loss of AtKASIII
condensing activity. The motif GNTSAAS was proposed to
be responsible for the binding of acyl-ACPs (Abbadi et al.
2000). The Arg332 of AhKASIII, corresponding to Arg249
of EcFabH, a critical residue in the interaction between
EcFabH and ACP (Zhang et al. 2001), was also strictly
conserved in higher plants (figure4).
3.4
Cloning and sequence analysis of AhKR
No KR clone was identified in our sequenced ESTs. By
searching public databases, we found two AhKR ESTs
(GenBank accession no. EG029580, ES715710) and the
two sequences were used for primer design. The cDNAs of
AhKR were cloned, which contained a 972 bp ORF encoding
a protein of 323 amino acids with a predicted molecular
mass of 33.8 kDa and a pI of 9.004. The deduced amino
acid sequence of AhKR was 69.7% and 49.6% identical to
B. napus KR (Fisher et al. 2000) and E. coli FabG (Price et
al. 2001).
On comparing BnKR with EcFabG, three active
site residues – Ser217, Tyr230 and Lys234 of AhKR
– corresponding to Ser138, Tyr151 and Lys155 of EcFabG,
were found. The Ser–Tyr–Lys catalytic triad was completely
conserved in higher plants (figure 5). The tyrosine and
lysine residues are involved in actual catalysis, whereas
serine participates in substrate binding and alignment
(Price et al. 2001). Lys208 (Arg in BnKR) and Arg251 of
AhKR, corresponding to Arg129 and Arg172 of EcFabG,
made a significant contribution to ACP docking and were
strictly conserved in higher plants (Zhang et al. 2003b). The
catalytic YX3K motif conserved in FabG was also highly
conserved in higher plants.
3.5
Cloning and sequence analysis of AhHD
One full-length cDNA of HD was identified in the peanut
cDNA library, which contained a 663 bp ORF encoding a
protein of 220 amino acids with a predicted molecular mass
of 24.0 kDa and a pI of 9.069. The deduced amino acid
sequence shared 43.1% and 13.4% identity with EcFabZ
and EcFabA, respectively.
The two genes, FabA and FabZ, encoding β-hydroxyacylACP dehydratases have been well studied in E. coli. The
catalytically important active site residues are His70 and
Asp84′ in EcFabA (Leesong et al. 1996) and His54 and
J. Biosci. 34(2), June 2009
Meng-Jun Li et al
232
Figure 3. Multiple sequence alignment of selected β-ketoacyl-ACP synthase I (KASI) (A) and KASII (B) homologues. Protein sequences
were aligned using the CLUSTALW alignment algorithm. (A) The three conserved residues of A. hypogaea KASI corresponding to E.coli
FabB Cys163, His298 and His333 are shaded black and position numbers are indicated. GenBank accession numbers are as follows:
Ah1, EU823325; Gm11, AAF61730; Gm12, AAF61731; At11, AAC49118; At12, AAM65396; Pf1, AAC04691; Rc1, AAA33873; Jc1,
ABJ90468; Os1, BAD35225; Hv1, AAA32968; Ec1, AAC67304. (B) The three conserved residues of A. hypogaea KASII corresponding
to E. coli FabF Cys164, His304 and His341 are shaded black and position numbers are indicated. GenBank accession numbers are as
follows: Ah2, EU823327; Gm21, AAW88762; Gm22, AAW88763; Gm23, AAF61737; At21, AAK69603; At22, AAL91174; Pf2,
AAC04692; Rc2, AAA33872; Jc2, ABJ90469; Os2, BAC79989; Hv21, CAA84022; Hv22, CAA84023; Ec2, CAA84431. Abbreviations:
Ah, A. hypogaea; Gm, G. max; At, A. thaliana; Pf, P. frutescens; Rc, Ricinus communis; Jc, Jatropha curcas; Os, O. sativa; Hv, H. vulgare;
Ec, E. coli.
Glu68′ in EcFabZ (Kimber et al. 2004). In AhHD, the
His/Glu catalytic dyad, His121 and Glu135′, and the motif
LPHRFPFLLVDRV were completely conserved in plant HD
and EcFabZ (figure 6), which suggested that plant HD may
function, like EcFabZ, in the metabolism of both saturated
and unsaturated long chain acyl-ACPs (Kimber et al. 2004).
3.6
Cloning and sequence analysis of AhENR
One ENR homologue was isolated from the peanut cDNA
library. It contained a 1170 bp ORF encoding a protein of
389 amino acids with a predicted molecular mass of 41.4
kDa and a pI of 8.571. The predicted protein sequence
J. Biosci. 34(2), June 2009
showed 29.0% identity with EcFabI and 84.3% identity with
BnFabI (Rafferty et al. 1995). AhFabI had 15.5% sequence
identity with AhKR, similar to that of BnFabI and BnKR
(Fisher et al. 2000).
The Tyr–Tyr–Lys active site triad is characteristic of FabI
homologues. The first tyrosine hydroxyl is directly involved
in catalysis (Rafi et al. 2006). The second tyrosine might
donate a proton to the enolate anion and lysine might act
to stabilise the negatively charged transition state (Rafferty
et al. 1995). In AhENR, the catalytic triad Tyr260–Tyr270–
Lys278 and the motif YGGGMSSAK, corresponding to the
YX6K motif in EcFabI, were completely conserved in higher
plants (figure 7).
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
233
Figure 4. Multiple sequence alignment of selected β-ketoacyl-ACP synthase III (KASIII) homologues. Protein sequences were aligned
using the CLUSTALW alignment algorithm. The four conserved residues of A. hypogaea KASIII corresponding to E. coli FabH Cys112,
His244, Arg249 and Asn274 are shaded black and position numbers are indicated. The motif GNTSAAS is boxed. GenBank accession
numbers are as follows: Ah, EU823328; Gm, AAF70509; At1, AAA61348; At2, CAA72385; Ca1, ACF17661; Ca2, ACF17662; Cw1,
AAA97533; Cw2, AAA97534; Ch1, AAF61398; Ch2, AAF61399; Pf1, AAC04693; Pf2, AAC04694; Aa, AAB61310; Ps, CAC08184;
Rc, ABR12417; Jc, ABJ90470; So, CAA80452; Ha, ABP93352; Eg, ABE73469; Eo, ABE73470; Ec, AAA23749. Abbreviations: Ah, A.
hypogaea; Gm, G. max; At, A. thaliana; Ca, C. annuum; Cw, C. wrightii; Ch, C. hookeriana; Pf, P. frutescens; Aa, A. ampeloprasum; Ps,
Pisum sativum; Rc, R. communis; Jc, J. curcas; So, S. oleracea; Ha, Helianthus annuus; Eg, Elaeis guineensis; Eo, E. oleifera; Ec, E. coli.
Figure 5. Multiple sequence alignment of selected β-ketoacyl-ACP reductase (KR) homologues. Protein sequences were aligned using the
CLUSTALW alignment algorithm. The five conserved residues of A. hypogaea KR corresponding to E. coli FabG Arg129, Ser138, Tyr151,
Lys155 and Arg172 are shaded black and position numbers are indicated. The motif YX3K is boxed. GenBank accession numbers are as
follows: Ah, EU823329; At1, AAG40337; At2, CAA45794; Bn1, CAC41362; Bn2, CAC41363; Bn3, CAC41364; Bn4, CAC41365; Bn5,
CAC41370; Ca, ACF17653; Cl, CAA45866; Os1, ABA97197; Os2, BAD22913; Ec, ACF17653. Abbreviations: Ah, A. hypogaea; At, A.
thaliana; Bn, B. napus; Ca, C. annuum; Cl, C. lanceolata; Os, O. sativa; Ec, E. coli.
J. Biosci. 34(2), June 2009
Meng-Jun Li et al
234
Figure 6. Multiple sequence alignment of selected β-hydroxyacyl-ACP dehydrase (HD) homologues. Protein sequences were aligned
using the CLUSTALW alignment algorithm. The catalytic dyad of A. hypogaea HD corresponding to E. coli FabZ His54, Glu68 and E.
coli FabA His70, Asp84 is shaded black and position numbers are indicated. The conserved domain in HD is boxed. GenBank accession
numbers are as follows: Ah, EU823332; At1, AAD23619; At2, AAM64548; At3, AAO24548; Bn, AAK60545; Ca, ACF17652; Os,
AAT58880; Pm1, ABA25920; Pm2, ABA25921; Ec1, AAC36917; Ec2, 1MKB_A. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn,
B. napus; Ca, C. annuum; Os, O. sativa; Pm, Picea mariana; Ec, E. coli.
Figure 7. Multiple sequence alignment of selected enoyl-ACP reductase (ENR) homologues. Protein sequences were aligned using the
CLUSTALW alignment algorithm. The three conserved residues of A. hypogaea ENR corresponding to E. coli FabI Tyr146, Tyr156 and
Lys163 are shaded black and position numbers are indicated. GenBank accession numbers are as follows: Ah, EU823333; At1, AAF37208;
At2, AAM45010; At3, CAA74175; Bn1, AAB20114; Bn2, CAA64729; Bn3, CAC41366; Bn4, CAC41367; Bn5, CAC41368; Bn6,
CAC41369; Oe, AAL93621; Ca1, ACF17650; Ca2, ACF17651; Nt1, CAA74176; Nt2, CAA74177; Os1, BAD03622; Os2, BAD26009;
Os3, CAA05816; Ec, P29132. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn, B. napus; Oe, Olea europaea; Ca, C. annuum; Nt,
Nicotiana tabacum; Os, O. sativa; Ec, E. coli.
3.7
Homologue of type II FAS genes and subcellular
target prediction
Homologues of type II FAS genes were cloned by RT-PCR
using total RNA from a peanut immature seed mixture by
J. Biosci. 34(2), June 2009
gene-specific primers. More than six clones of each gene were
picked randomly and sequenced. Homologue numbers of
each type II FAS gene expressing in peanut seed development
varied from 5 in ENR to only 1 in KASII, KASIII and HD.
The number of single-nucleotide polymorphisms (SNPs) was
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
Table 2.
Homologues of each type II FAS gene in peanut
Gene
Accession number
ACP1
EG374024*
0
EE127470
4
EE124662
2
ACP1-2
423
EU823318
1
ACP1-2
423
EE127527
3
ACP2-1
393
EG373603
3
ACP2-2
393
EU823319
2
ACP3-1
375
EU823320
1
ACP3-2
375
EU823321
4
ACP3-3
375
EU823322
1
MCAT1
1158
EU823323
4
MCAT2
1158
EU823324
3
MCAT3
1161
EU823325
4
KASI-1
1413
EU823326
2
KASI-2
1413
KASII
EU823327
10
KASII
KASIII
EU823328
7
KASIII
KR
EU823329
4
EU823330
3
ACP2
ACP3
MCAT
KASI
235
Clone numbers
Protein
ORF (bp)
SNP
InDel
ACP1-1
423
4
0
ACP1-2
423
4
0
3
0
7
1
20
0
1647
0
0
1206
0
0
KR1
972
3
0
KR2
972
EU823331
1
KR3
972
HD
EU823332
7
HD-1
663
0
0
ENR
EU823333
1
ENR1
1170
18
0
EU823334
3
ENR2
1170
EU823335
2
ENR3
1170
EU823336
1
ENR3
1170
EU823337
1
ENR3
1170
* EG374024 was found in the peanut full-length cDNA library but we did not find it on PCR-based homologue searching.
quite different in each gene. The most were identified in KASI
and ENR, while no SNP was identified in KASII, KASIII, HD.
Indel was only found in MCAT (table 2). The percentage of
transition was more than that of transversion in the identified
SNPs. The results indicated that most type II FAS genes had
more than two homologues expressing in developing peanut
seeds.
To clarify the possible subcellular compartment of peanut
type II FAS genes, amino acid sequences were used for
targeting prediction by the TargetP1.1 Server. Results clearly
indicated that ACP1, MCAT, KASI, KASII, KASIII, KR,
HD and ENR all targeted chloroplast, while ACP2 and ACP3
were confidently predicted to target mitochondria (table 3).
4.
Discussion
Fatty acid biosynthesis in higher plants is carried out by type
II FAS, which has been most extensively studied in E. coli.
The crystal structural determination of E. coli FAS enzymes
has been completed (White et al. 2005). Here, we report the
cloning of type II FAS genes from A. hypogaea for the first
time including MCAT, KASI, KASII, KASIII, KR, HD, ENR
and ACP.
FabF has acetyl CoA:ACP transacylase (ACAT)
activity and seems able to initiate fatty acid synthesis, but
it may not play this role when FabH is functional (Lai and
Cronan 2003). The ACAT activities of E. coli, spinach and
Streptomyces glaucescens FabH are approximately 0.5%,
1% and 12% of the KAS activities (Tsay et al. 1992; Olsen
et al. 1999; Han et al. 1998). In avocado, KAS III and ACAT
activities have been separated from each other and the native
molecular mass of KAS III is 69 kDa and that of ACAT is
18.5 kDa (Gulliver and Slabas 1994), which indicates that
there is a separate ACAT enzyme in avocado. However, in
higher plants, it is still uncertain whether ACAT is a separate
enzyme or a partial reaction of a condensing enzyme. No
ACAT cDNA has been reported in E. coli and higher plants.
J. Biosci. 34(2), June 2009
Meng-Jun Li et al
236
Table 3.
Subcellular compartment of peanut type II FAS enzymes predicted by the TargetP1.1 Server
Protein
Accession
Len
cTP
mTP
Localisation
RC
TPlen
ACP1
EE127470
140
0.938
ACP2
EE127527
130
0.109
0.016
Chloroplast
1
55
0.878
Mitochondria
2
40
ACP3
EU823319
124
0.082
0.923
Mitochondria
1
36
MCAT
EU823322
385
0.968
0.080
Chloroplast
1
60
KI
EU823325
470
0.910
0.104
Chloroplast
1
48
KII
EU823327
548
0.624
0.007
Chloroplast
3
39
KIII
EU823328
401
0.527
0.071
Chloroplast
5
72
KR
EU823329
323
0.618
0.022
Chloroplast
3
73
HD
EU823332
220
0.917
0.050
Chloroplast
1
41
ENR
EU823333
389
0.937
0.143
Chloroplast
2
70
*Len, sequence length; cTP, chloroplast transit peptide; mTP, mitochondrial targeting peptide; RC, reliability class, from 1 to 5, where
1 indicates the strongest prediction; TPlen, presequence length
Sequence comparisons revealed that the primary structure
of plant plastid type II FAS enzymes was strictly conserved,
especially the catalytic residues, which suggested that
these enzymes may have similar functions in higher
plants as those in E. coli. The helix II of plant ACPs
was highly conserved, but plastid ACP and mitochondrial
ACP can be distinguished by three other α helices. E. coli
FabB and FabF shared 35.2%, 49.9% identity with A.
thaliana mitochondrial KAS, and 33.7%, 46.0% with plastid
KASI, KASII, respectively. These observations suggested
that two type II FAS systems in higher plants originated
from E. coli type II FAS. Plant type II FAS in mitochondria
was more closely related to E. coli type II FAS than that in
plastids.
Homologue numbers of each type II FAS gene expressing
in developing peanut seeds varied from 5 to 1. The number
of SNPs was also quite different in each gene. The result
was consistent with that in peanut acyl-ACP thioesterase
(GenBank accession no, EF117305-EF117309). We cloned
genomic DNAs of peanut ACP1, ACP2 and ACP3 by
PCR using gene-specific primers (data not shown).
More cDNAs of ACP1 and ACP3 could be deduced
from genomic DNA clones. The cDNAs not identified
in developing seeds may be silent or may be expressed
in other tissues. More than two types of the 5′-terminal
of KAS cDNA were cloned by 5′-RACE. Based on these
results, we have reason to propose that more than two
homologues of most type II FAS genes exist in the peanut
genome although RT-PCR has its disadvantages in gene
cloning. Gene redundancy was widespread in the peanut
fatty acid synthesis pathway, which made this process more
sophisticated. The findings obtained in this study provide the
basis for future investigation of peanut FAS genes in terms
of regulation, expression pattern analysis, evolution and
gene engineering study.
J. Biosci. 34(2), June 2009
Acknowledgements
This work was supported by grants from the National High
Technology Research and Development Program of China
(2006AA10A114), Shandong Academy of Agricultural
Sciences Foundation (2006YCX030), (2007YCX001)
and Postdoctoral Foundation of Shandong Province
(200701004).
References
Abbadi A, Brummel M and Spener F 2000 Knockout of the
regulatory site of 3-ketoacyl-ACP synthase III enhances shortand medium-chain acyl-ACP synthesis; Plant J. 24 1–9
Bolle C, Herrmann R G and Oelmuller R 1996 Different sequences
for 5′-untranslated leaders of nuclear genes for plastid proteins
affect the expression of the beta-glucuronidase gene; Plant Mol.
Biol. 32 861–868
Bonaventure G and Ohlrogge J B 2002 Differential regulation of
mRNA levels of acyl carrier protein isoforms in Arabidopsis;
Plant Physiol. 128 223–235
Carlsson A S, LaBrie S T, Kinney A J, von Wettstein-Knowles P and
Browse J 2002 A KAS2 cDNA complements the phenotypes of
the Arabidopsis fab1 mutant that differs in a single residue
bordering the substrate binding pocket; Plant J. 29 761–770
Chen J and Post-Beittenmiller D 1996 Molecular cloning of a
cDNA encoding 3-ketoacyl-acyl carrier protein synthase III
from leek; Gene 182 45–52
Clough R C, Matthis A L, Barnum S R and Jaworski J G 1992
Purification and characterization of 3-ketoacyl-acyl carrier protein
synthase III from spinach; J. Biol. Chem. 267 20992–20998
Dehesh K, Tai H, Edwards P, Byrne J and Jaworski J G 2001
Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs
in plants reduces the rate of lipid synthesis; Plant Physiol. 125
1103–1114
Fisher M, Kroon J T M, Martindale W, Stuitje A R, Slabas A R and
Rafferty J B 2000 The X-ray structure of Brassica napus β-keto
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.
acyl carrier protein reductase and its implications for substrate
binding and catalysis; Structure 8 339–347
Gulliver B S and Slabas A R 1994 Acetoacyl-acyl carrier protein
synthase from avocado: its purification, characterisation and
clear resolution from acetyl CoA:ACP transacylase; Plant Mol.
Biol. 25 179–191
Han L, Lobo S and Reynold K A 1998 Characterization of βketoacyl-acyl carrier protein synthase III from Streptomyces
glaucescens and its role in initiation of fatty acid biosynthesis;
J. Bacteriol. 180 4481–4486
Hansen L and Kauppinen S 1991 Barley acyl carrier protein II:
nucleotide sequence of cDNA clones and chromosomal location
of the Acl2 gene; Plant Physiol. 97 472–474
Hansen and, von Wettstein-Knowles P 1991 The barley genes Acl1
and Acl3 encoding acyl carrier proteins I and III are located on
different chromosomes; Mol. Gen. Genet. 229 467–478
Heath R J and Rock C O 1996 Roles of the FabA and FabZ βhydroxyacyl-acyl carrier protein dehydratases in Escherichia
coli fatty acid biosynthesis; J. Biol. Chem. 271 27795–27801
Hlousek-Radojcic A, Post-Beittenmiller D and Ohlrogge JB 1992
Expression of constitutive and tissue-specific acyl carrier
protein isoforms in Arabidopsis; Plant Physiol. 98 206–214
Kater M M, Koningstein G M, Nijkamp H J and Stuitje A R 1991
cDNA cloning and expression of Brassica napus enoyl-acyl
carrier protein reductase in Escherichia coli; Plant Mol. Biol.
17 895–909
Keatinge-Clay A T, Shelat A A, Savage D F, Tsai S C, Miercke L
J, O’Connell J D, Khosla C and Stroud R M 2003 Catalysis,
specificity, and ACP docking site of Streptomyces coelicolor
malonyl-CoA:ACP transacylase; Structure 11 147–154
Kimber M S, Martin F, Lu Y J, Houston S, Vedadi M,
Dharamsi A, Fiebig K M, Schmid M and Rock C O 2004 The
structure of (3R)-hydroxyacyl-acyl carrier protein dehydratase
(FabZ) from Pseudomonas aeruginosa; J. Biol. Chem. 2792
52593–52602
Klein B, Pawlowski K, Horicke-Grandpierre C, Schell J and Topfer
R 1992 Isolation and characterization of a cDNA from Cuphea
lanceolata encoding a beta-ketoacyl-ACP reductase; Mol. Gen.
Genet. 233 122–128
Kopka J, Robers M, Schuch R and Spener F 1993 Acyl carrier
proteins from developing seeds of Cuphea lanceolata Ait;
Planta 191 102–111
Lai C Y and Cronan J E 2003 β-ketoacyl-acyl carrier protein
synthase III (FabH) is essential for bacterial fatty acid synthesis;
J. Biol. Chem. 278 51494–51503
Lamppa G and Jacks C 1991 Analysis of two linked genes coding
for the acyl carrier protein (ACP) from Arabidopsis thaliana
(columbia); Plant Mol. Biol. 16 469–474
Leesong M, Henderson B S, Gillig J R, Schwab J M and Smith J
L 1996 Structure of a dehydratase-isomerase from the bacterial
pathway for biosynthesis of unsaturated fatty acids: two catalytic
activities in one active site; Structure 4 253–264
Mekhedov S, Cahoon E B and Ohlrogge J 2001 An unusual
seed-specific 3-ketoacyl-ACP synthase associated with the
biosynthesis of petroselinic acid in coriander; Plant Mol. Biol.
47 507–518
Mofid M R, Finking R and Marahiel M A 2002 Recognition
of hybrid peptidyl carrier proteins/acyl carrier proteins in
237
nonribosomal peptide synthetase modules by the 4'-phosphopan tetheinyl transferases AcpS and Sfp; J. Biol. Chem. 277
17023–17031
Moretzsohn M C, Hopkins M S, Mitchell S E, Kresovich S, Valls J
F M and Ferreira M E 2004 Genetic diversity of peanut (Arachis
hypogaea L.) and its wild relatives based on the analysis of
hypervariable regions of the genome; BMC Plant Biol. 4 11
Olsen J G, Kadziola A, von Wettstein-Knowles P, SiggaardAndersen M, Lindquist Y and Larsen S 1999 The X-ray crystal
structure of beta-ketoacyl [acyl carrier protein] synthase I;
FEBS Lett. 460 46–52
Olsen J G, Rasmussen A V, von Wettstein-Knowles P and
Henriksen A 2004 Structure of the mitochondrial beta-ketoacyl[acyl carrier protein] synthase from Arabidopsis and its role in
fatty acid synthesis; FEBS Lett. 577 170–174
Pidkowich M S, Nguyen H T, Heilmann I, Ischebeck T and
Shanklin J 2007 Modulating seed beta-ketoacyl-acyl carrier
protein synthase II level converts the composition of a temperate
seed oil to that of a palm-like tropical oil;. Proc. Natl. Acad. Sci
USA 104 4742–4747
Post-Beittenmiller M A, Hlousek-Radojcic A and Ohlrogge
J B 1989 DNA sequence of a genomic clone encoding an
Arabidopsis acyl carrier protein (ACP); Nucleic Acids Res. 17
1777
Price A C, Zhang Y M, Rock C O and White S W 2001 Structure
of β-ketoacyl-[acyl carrier protein] reductase from Escherichia
coli: negative cooperativity and its structural basis; Biochemistry
40 12772–12781
Qiu X, Janson C A, Konstantinidis A K, Nwagwu S, Silverman
C, Smith W W, Khandekar S, Lonsdale J and Abdel-Meguid
S S 1999 Crystal structure of beta-ketoacyl-acyl carrier protein
synthase III. A key condensing enzyme in bacterial fatty acid
biosynthesis; J. Biol. Chem. 274 36465–36471
Rafferty J B, Simon J W, Baldock C, Artymiuk P J, Baker P J,
Stuitje A R, Slabas A R and Rice D W 1995 Common themes in
redox chemistry emerge from the X-ray structure of oilseed rape
(Brassica napus) enoyl acyl carrier protein reductase; Structure
3 927–938
Rafi S, Novichenok P, Kolappan S, Zhang X, Stratton C F, Rawat
R, Kisker C, Simmerling C and Tonge P J 2006 Structure of acyl
carrier protein bound to FabI, the FASII enoyl reductase from
Escherichia coli; J. Biol. Chem. 281 39285–39293
Scherer D E and Knauf V C 1987 Isolation of a cDNA clone for the
acyl carrier protein-I of spinach; Plant Mol. Biol. 9 127–134
Schmid K M and Ohlrogge J B 1990 A root acyl carrier protein-II
from spinach is also expressed in leaves and seeds; Plant Mol.
Biol. 15 765–778
Serre L, Verbree E C, Dauter Z, Stuitje A R and Derewenda Z S
1995 The Escherichia coli malonyl-CoA:acyl carrier protein
transacylase at 1.5-A resolution. Crystal structure of a fatty acid
synthase component; J. Biol. Chem. 270 12961–12964
Shintani D K and Ohlrogge J B 1994 The characterization of
a mitochondrial acyl carrier protein isoform isolated from
Arabidopsis thaliana; Plant Physiol. 104 1221–1229
Simon J W and Slabas A R 1998 cDNA cloning of Brassica
napus malonyl-CoA:ACP transacylase (MCAT) (fabD) and
complementation of an E. coli MCAT mutant; FEBS Lett. 435
204–206
J. Biosci. 34(2), June 2009
Meng-Jun Li et al
238
Slabaugh M B, Tai H, Jaworski J and Knapp S J 1995 cDNA clones
encoding beta-ketoacyl-acyl carrier protein synthase III from
Cuphea wrightii; Plant Physiol. 108 443–444
Suh M C, Schultz D J and Ohlrogge J B 1999 Isoforms of acyl
carrier protein involved in seed-specific fatty acid synthesis;
Plant J. 17 679–688
Tai H and Jaworski J G 1993 3-Ketoacyl-acyl carrier protein
synthase III from spinach (Spinacia oleracea) is not similar to
other condensing enzymes of fatty acid synthase; Plant Physiol.
103 1361–1367
Tai H, Post-Beittenmiller D and Jaworski J G 1994 Cloning of a
cDNA encoding 3-ketoacyl-acyl carrier protein synthase III
from Arabidopsis; Plant Physiol. 106 801–802
Tsay J T, Oh W, Larson T J, Jackowski S and Rock C O 1992
Isolation and characterization of the β-ketoacyl-acyl carrier
protein synthase III gene (fabH) from Escherichia coli K-12; J.
Biol. Chem. 267 6807–6814
Voetz M, Klein B, Schell J and Topfer R 1994 Three different
cDNAs encoding acyl carrier proteins from Cuphea lanceolata;
Plant Physiol. 106 785–786
von Wettstein-Knowles P, Olsen J G, McGuire K A and Larsen S
2000 Molecular aspects of β-ketoacyl synthase (KAS) catalysis;
Biochem. Soc. Trans. 28 601–607
Wada H, Shintani D K and Ohlrogge J B 1997 Why do mitochondria
synthesize fatty acids? Evidence for involvement in lipoic acid
production; Proc. Natl. Acad. Sci. USA 94 1591–1596
White S W, Zheng J, Zhang Y M and Rock C O 2005 The structural
biology of type II fatty acid biosynthesis; Annu. Rev. Biochem.
74 791–831
Yasuno R, von Wettstein-Knowles P and Wada H 2004 Identification and molecular characterization of the beta-ketoacyl[acyl carrier protein] synthase component of the Arabidopsis
mitochondrial fatty acid synthase; J. Biol. Chem. 279
8242–8251
Zhang Y M, Marrakchi H, White S W and Rock C O 2003a The
application of computational methods to explore the diversity
and structure of bacterial fatty acid synthase; J. Lipid Res. 44
1–10
Zhang Y M, Rao M S, Heath R J, Price A C, Olson A J, Rock C
O and White S W 2001 Identification and analysis of the acyl
carrier protein (ACP) docking site on β-ketoacyl-ACP synthase
III; J. Biol. Chem. 276 8231–8238
Zhang Y M, Wu B, Zheng J and Rock C O 2003b Key residues
responsible for acyl carrier protein and β-ketoacyl-acyl carrier
protein reductase (FabG) interaction; J. Biol. Chem. 278
52935–52943
MS received 30 September 2008; accepted 2 February 2009
ePublication: 21 March 2009
Corresponding editor: VIDYANAND NANJUNDIAH
J. Biosci. 34(2), June 2009