Download A specific domain in α-catenin mediates binding to β

1759
Journal of Cell Science 110, 1759-1765 (1997)
Printed in Great Britain © The Company of Biologists Limited 1997
JCS9592
A specific domain in α-catenin mediates binding to β-catenin or plakoglobin
Otmar Huber, Michael Krohn and Rolf Kemler*
Max-Planck Institute for Immunobiology, Stübeweg 51, D-79108 Freiburg, Germany
*Author for correspondence (e-mail: [email protected])
SUMMARY
The E-cadherin-catenin adhesion complex has been the
subject of many structural and functional studies because
of its importance in development, normal tissue function
and carcinogenesis. It is well established that the cytoplasmic domain of E-cadherin binds either β-catenin or plakoglobin, which both can assemble α-catenin into the
complex. Recently we have identified an α-catenin binding
site in β-catenin and plakoglobin and postulated, based on
sequence analysis, that these protein-protein interactions
are mediated by a hydrophobic interaction mechanism.
Here we have now identified the reciprocal complementary
binding site in α-catenin which mediates its interaction
with β-catenin and plakoglobin. Using in vitro association
assays with C-terminal truncations of α-catenin expressed
INTRODUCTION
The Ca2+-dependent cell adhesion molecule E-cadherin plays
an important role during mouse embryonic development
(Larue et al., 1994; Riethmacher et al., 1995) and in the proper
organization of epithelia (for review see Gumbiner, 1996). For
its function in epithelial cell polarity and epithelial tissue
integrity, the cytoplasmic tail of E-cadherin must be associated
with three proteins termed α-, β- and γ-catenin (plakoglobin)
(for review see Kemler, 1993). Catenins link cadherins to the
actin microfilament network, but they also interact with other
transmembrane or cytoplasmic proteins and have been considered as more general linker or adaptor proteins (for review see
Huber et al., 1996a). β-Catenin and plakoglobin are members
of the armadillo protein superfamily (Peifer et al., 1994) and
have recently attracted much attention because of their possible
signaling function besides their demonstrated involvement as
structural components in adherens junctions and desmosomes
(Gumbiner, 1995; Huber et al., 1996a,b; Miller and Moon,
1996; Behrens et al., 1996; Molenaar et al., 1996).
The α-catenin primary sequence reveals homology to
vinculin, a protein first described as a component of focal
contacts, where it may be part of a molecular network connecting the extracellular matrix with the intracellular
cytoskeleton. The sequence homology is restricted to three
regions within the molecules: an N-terminal region, a central
domain, and the C-terminal region (Herrenknecht et al., 1991;
Nagafuchi et al., 1991). α-Catenin mediates the contact of the
cadherin-catenin complex with the actin cytoskeleton (Ozawa
as recombinant fusion proteins, we found that the Nterminal 146 amino acids are required for this interaction.
We then identified a peptide of 27 amino acids within this
sequence (amino acid positions 117-143) which is necessary
and sufficient to bind β-catenin or plakoglobin. As shown
by mutational analysis, hydrophobic amino acids within
this binding site are important for the interaction. The
results described here, together with our previous work,
give strong support for the idea that these proteins
associate by hydrophobic interactions of two α-helices.
Key words: E-cadherin-catenin-complex, α-Catenin binding site,
Site-directed mutagenesis
et al., 1990) and may bind to actin microfilaments directly
and/or in association with α-actinin (Rimm et al., 1995;
Knudsen et al., 1995). Similar actin binding properties have
been reported for vinculin, and based on the sequence
homology the interaction of these two proteins with actin
filaments may be regulated in a similar way (for review see
Jockusch and Rüdiger, 1996).
The essential function of α-catenin for the cadherin-catenin
complex was shown in mouse development by mutational
analysis (Torres et al., 1997), as well as in cancer cell lines
(PC-9 and PC-3) which exhibit impaired adhesion due to a lack
of a large portion or of the complete α-catenin gene
(Shimoyama et al., 1992; Morton et al., 1993; Ewing et al.,
1995). In human esophageal cancer tissue, loss of α-catenin
expression also correlates with the degree of infiltration and the
extent of lymph node metastasis (Kadowaki et al., 1994).
Biochemical analysis of the cadherin-catenin complex
revealed the presence of two mutually exclusive complexes
within the same cell, composed of either E-cadherin, β-catenin
and α-catenin, or E-cadherin, plakoglobin and α-catenin (Butz
and Kemler, 1994; Näthke et al., 1994). β-Catenin and plakoglobin bind to amino acid (aa) positions 832-862 in the cytoplasmic domain of E-cadherin (Ozawa et al., 1990; Stappert
and Kemler, 1994). The sites in β-catenin and plakoglobin
which mediate the interaction with E-cadherin appear to be less
defined and are located in the multiple armadillo repeats
(Hülsken et al., 1994). α-Catenin associates with the complex
by interacting with either β-catenin or plakoglobin (Aberle et
al., 1994; Hülsken et al., 1994). The sequence comprising aa
1760 O. Huber, M. Krohn and R. Kemler
positions 120-151 in β-catenin is necessary and sufficient for
the interaction of β-catenin with α-catenin (Aberle et al., 1994,
1996). A homologous amino acid sequence in plakoglobin was
identified which mediates its interaction with α-catenin
(Aberle et al., 1996; Sacco et al., 1995). No detailed information was available on the amino acid sequences in α-catenin
necessary for the interaction with β-catenin and plakoglobin,
although it had been found, using a two-hybrid assay, that the
N-terminal 606 aa of α-catenin bind to β-catenin (Jou et al.,
1995). Here we have characterized the binding sites in αcatenin more precisely, identifying a peptide of 27 aa in the αcatenin sequence which is sufficient to bind β-catenin or plakoglobin.
MATERIALS AND METHODS
Chemicals and reagents
Molecular biological reagents and enzymes were purchased from
Boehringer Mannheim or New England Biolabs. Oligonucleotides
were synthesized on an Applied Biosystems model 394A synthesizer.
The peptide S27D was synthesized on an Applied Biosystems model
431A synthesizer using Fmoc (N-(9-fluorenyl)methoxycarbonyl)
chemistry. For purification of the peptide a reversed-phase column
(Vydac 218 TP) connected to a BioCad Sprint perfusion chromatography system (Perseptive Biosystems) was used. For biotinylation
the purified peptide was incubated at pH 9 with Biotin-XX-NHS ester
(Calbiochem). To remove excess biotinylation reagent the reaction
mixture was acidified with trifluoroacetic acid (TFA), applied to a C18
Sep-Pak cartridge (Waters Millipore) equilibrated with 5% (v/v)
acetonitrile + 0.1% (v/v) TFA, and washed with the same solvent. The
peptide was eluted with 70% (v/v) acetonitrile + 0.1% (v/v) TFA,
dried in a Speedvac and dissolved in water (1 mg/ml). The peptide
was coupled to tosyl-activated magnetic beads (Dynal) in 0.15 M
NaHCO3 + 10% (w/v) PEG 8000. Non-reacted tosyl-groups were
blocked with 5% (v/v) ethanolamine, pH 9.0. Control beads were
directly blocked with ethanolamine.
Antibodies and detection systems
Antibodies against α-catenin, β-catenin and plakoglobin have been
described previously (Butz and Kemler, 1994) or were purchased from
Transduction Laboratories (Lexington, USA). Chicken antibodies
against MBP and anti-IgY monoclonal antibody were obtained from
Nanotools (Denzlingen, Germany). Peroxidase-labeled secondary
antibodies were from Dianova (Hamburg, Germany) or Sigma
(Deisenhofen, Germany). The ECL detection kit and Hyperfilm-ECL
were purchased from Amersham.
Construction of vectors for maltose binding protein
α-catenin fusion proteins and expression in
(MBP)-α
Escherichia coli
The deletion constructs MPBα1-246 and MBPα1-146 were generated
by PCR using Pwo DNA-polymerase with forward primer 5′-CAGGCCTCGGGATCCATGACTGCCGTCCACGCA-3′ and reverse
primers 5′-CGGGATCCCTGCTTGTATATCAAGTC-3′ and 5′TCGCGAGGATCCATCTGCCATGTCAGCCAG-3′. These primer
pairs generate BamHI sites to use for cloning the PCR product into a
modified pMalC2 vector (New England Biolabs). pMalC2 was
digested with HindIII, blunt ended with the Klenow fragment of DNA
polymerase I, and religated to obtain an in-frame stop codon. Ligation
and transformation in E. coli strain XL-1 were done by standard procedures (Sambrook et al., 1989). Transformants were checked for
correct orientation of the insert by colony-PCR. For expression
plasmids were transformed in E. coli BL21RE4 carrying the pREP4
plasmid (Qiagen) encoding the lac repressor. A 20 ml volume of an
overnight culture was used to inoculate 1 l of LB medium + 10 g/l
glucose + antibiotics. Bacteria were grown at 30°C to an OD578 = 0.5
and expression of the fusion protein was induced by addition of 1 mM
IPTG (Biomol). After 1 hour bacteria were harvested and washed with
PBS. For ultrasonic lysis bacteria were resuspended at an OD578 =
200 in 20 mM Hepes-NaOH, pH 7.4 + Complete™ protease inhibitor
mixture (Boehringer Mannheim). The lysate was adjusted to 10 ml
with 20 mM Hepes-NaOH, pH 7.4, and ultracentrifuged for 30
minutes at 4°C at 45,000 rpm in an AH650 swing-out rotor. The supernatant was applied to 2 ml amylose resin (New England Biolabs) and
incubated for 15 minutes at 4°C on a rotatory shaker. To achieve
complete binding the flow-through was reapplied to the settled beads.
After washing the amylose beads 2× with 10 ml PBS, the fusion
protein was eluted with 20 mM maltose in PBS, dialysed against 20
mM Tris-HCl, pH 8.0, and stored after shock freezing in liquid
nitrogen. pMalα129 was constructed by digestion of pMalα146 with
XhoI and SalI and religation. pMalα98 was generated by digestion of
pMalα146 with NspV and XbaI. Overhanging ends were filled by
Klenow polymerase treatment to allow blunt-end ligation. Expression
of these constructs was done as described for MBPα146. β-Catenin
and plakoglobin, each carrying a C-terminal His6-tag, were expressed
with pQE60 (Qiagen) and purified on Ni2+-chelating Sepharose
(Pharmacia). GST-β-catenin was expressed as described previously
(Aberle et al., 1994).
Construction of eukaryotic α-catenin expression vectors
and expression in Neuro2A cells
α-Catenin cDNA was cloned into the EcoRI site of pCIneo (Promega).
To obtain His6-tagged α-catenin, pCIneo α-cat was digested with
BspEI and SmaI. This fragment was replaced by a corresponding
fragment obtained from pQE60 α-cat (Aberle et al., 1994) by
digestion with HindIII, Klenow DNA-polymerase treatment to create
a blunt end and subsequent digestion with BspEI. A Koszak sequence
was introduced by PCR amplification with Pwo-polymerase using the
oligonucleotide 5′-CCGGAATTCGCCGCCATGACTGCCGTCCACGCA-3′ and a pCIneo T3 primer. The amplification product was
digested with EcoRI and NotI and cloned into pCIneo. pCIneo αcat∆143 was generated by an identical procedure using the oligonucloetide 5′-CGGGAATTCGCCGCCATGGCAGATGTCTACAAATTAC-3′ and the T3 primer.
Transient transfections of α-catenin and β-catenin cDNAs in
Neuro2A cells and immunoprecipitation experiments with Neuro2A
cell lysates were performed as described (Huber et al., 1996b).
Site-directed mutagenesis
Site-directed mutagenesis was performed as described (Stappert et al.,
1992). For the primer extension reaction the forward primer 5′CAGGCCTCGGGATCCGACATGACTGCCGTCCACGCA-3′ containing the tag sequence necessary for subsequent PCR amplification
was used. The following mutagenic primers containing mismatches
were used to replace specific amino acids and to introduce or remove
restriction sites by silent mutation for colony identification: V125A, 5′CGAGGCAACATGGCGCGCGCAGCTCGAGCTTTG-3′; R126A,
5′- CGAGGCAACATGGTCGCGGCAGCTCGAGCTTTGCTC - 3′;
R129A,
5′-ATGGTCCGGGCAGCTGCAGCTTTGCTCTCTGCC;
S133A, 5′-GC TCGAGCTTTGCTCGCTGCCGTCACCCGGCTG-3′;
T136A, 5′-TTGCTCTCTGCCGTCGCCCGGCTGCTGATTCTG-3′;
R137A, 5′-CTCTCTGCCGTCACCGCGCTGCTGATTCTGGCT-3′;
L131A, 5′-CGGGCAGCTCGAGCAGCGCTCTCTGCCGTCACC-3′;
L132A, 5′-GCAGCTCGAGCTTTGGCTAGCGCCGTCACCCGGCTG-3′; V135A, 5′-TTGCTCTCTGCCGCCACCCGGCTGCTG-3′;
L138A, 5′-TCTGCCGTCACCCGAGCGCTGATTCTGGCTGAC-3′;
L139A, 5′-GTCACCCGGCTGGCGATTCTGGCTGACATG-3′. The
mutagenized strand was selectively amplified by PCR using the forward
primer 5′-CAGGCCTCGGGATCCGAC-3′ and the reverse primer
5′-TCGCGAGGATCCATCTGCCATGTCAGCCAG-3′. Mutations for
amino acids 141 and 142 were directly introduced by PCR: L141A,
α-Catenin binding site for β-catenin and plakoglobin 1761
5′-GCGGGATCCATCTGCATCTGCCATGTCAGCCGCAATCAGCAGCCGGGT-3′; A142S, 5′-GCGGGATCCATCTGCCATGTCCGACAGAATCAGCAGCCGGGT-3′.
Reconstitution assays and affinity purification
For in vitro reconstitution, recombinant proteins were mixed in 250
µl association buffer (10 mM Hepes-NaOH, pH 7.4, 0.1 M KCl, 1
mM MgCl2, 0.1% Triton X-100). After incubation for 30 minutes at
room temperature precipitated material was removed by centrifugation for 10 minutes at 14,000 rpm. For isolation of the reconstituted
heterodimers 250 µl of association buffer and 50 µl of a 50% slurry
of glutathione-agarose beads (Sigma) were added. After 30 minutes
gentle agitation at 4°C the beads were pelleted (1 minute, 2,000 g)
and washed four times with 2× association buffer + 20 mM imidazole.
Bound protein complexes were eluted from the beads by incubation
in Laemmli sample buffer for 3 minutes at 95°C, separated by SDSPAGE, and analyzed by immunoblotting or Coomassie Blue staining.
For peptide binding assays, magnetic beads were incubated for 1 hour
at 4°C with recombinant β-catenin-His6 and washed 5× in 2× association buffer + 20 mM imidazole. The collected beads were resuspended in 20 µl sample buffer and heated for 3 minutes at 95°C.
Bound proteins were analyzed by immunodetection with M14M polyclonal antibody against β-catenin.
SW480 cells were metabolically labeled with 71.5 µCi/ml [35S]Promix (50 mCi/ml [35S]methionine + 21.5 mCi/ml [35S]cysteine;
>1,000 Ci/mmol) (Amersham) for >12 hours, washed 3× with PBS,
and extracted with 0.8 ml lysis buffer (10 mM Hepes-NaOH, pH 7.4,
0.1 M KCl, 1 mM MgCl2, 2 mM EGTA, 0.2% (v/v) Triton X-100, 1
mM NaVO4, 1 mM NaF). The soluble extract was precleared with the
appropriate beads and incubated with 2 µg of MBP-α-catenin 1-146
for 10 minutes. Then Protein G-Sepharose beads (Pharmacia) preincubated with 2 µg of chicken-anti-MBP polyclonal antibody and 2 µg
monoclonal anti-IgY were added, and after incubating for 1 hour at
4°C under gentle agitation, beads were washed 5× with lysis buffer.
Bound protein complexes were eluted with Laemmli buffer, separated
by SDS-PAGE and analyzed by fluorography or immunoblotting.
RESULTS
Identification of the β-catenin binding site in αcatenin
Previous experiments have shown that β-catenin and α-catenin
expressed in E. coli form heterodimers in solution with a 1:1 stoichiometry (Aberle et al., 1994). An E-cadherin-catenin complex
was even assembled in vitro upon addition of the cytoplasmic
domain of E-cadherin. Therefore, this assay system was used to
identify the binding site for β-catenin in α-catenin. MBP-αcatenin fusion constructs coding for a series of C-terminally
truncated α-catenins were expressed in E. coli, taking care to
optimize bacterial growth conditions and the controlled induction
of protein expression (see Materials and Methods). The structure
1
Fig. 1. Schematic representation of MBPfusion proteins and peptide used. The
ability of the constructs to interact with βcatenin is indicated at the right. The
numbers refer to aa positions in α-catenin
according to the published sequence
(Herrenknecht et al., 1991).
of the fusion proteins is schematically summarized in Fig. 1.
Recombinant β-catenin tagged with glutathione-S-transferase
(GST) was mixed in solution with various mutated MBP-αcatenin proteins, the resultant protein complexes were purified on
glutathione-agarose beads and subjected to immunoblot analysis
(Fig. 2). Full-length α-catenin and a truncated protein encoding
the N-terminal 246 amino acids were both able to associate with
GST-β-catenin (Aberle et al., 1994; not shown). Of all the Cterminal truncations of α-catenin only MPB-α-catenin 1-146 was
able to interact with β-catenin (Figs 1, 2). No interaction was
observed between α- and β-catenin when N-terminal deletion
constructs of α-catenin were analyzed (not shown).
α-catenin 1-146 binds native β-catenin
MBP-α
SW480 cells, which exhibit a large pool of cytoplasmic βcatenin (Munemitsu et al., 1995; Jou et al., 1995), were
analyzed to test whether MBP-α-catenin 1-146 is able to bind
endogenous β-catenin. Cell lysates from 35S-metabolically
labeled SW480 cells were mixed with each of the truncated αcatenin fusion proteins depicted in Fig. 1, and protein
complexes were immunoprecipitated with antibodies against
the MBP fusion partner. Only MBP-α-catenin 1-146 was able
to bind endogenous β-catenin (Fig. 3A); this was confirmed by
subjecting the immunoprecipitates to immunoblot analysis
with anti-β-catenin antibodies (Fig. 3B). These results demonstrate that a sufficient β-catenin binding site is encoded within
the N-terminal 146 amino acids of α-catenin.
α-Catenin∆
∆143 is unable to bind to β-catenin in
Neuro2A cells
To study the interaction between α-catenin and β-catenin in
living cells transient expression experiments with subsequent
immunoprecipitations were performed. Neuro2A cells possess
no endogenous E-cadherin and catenins (Hülsken et al., 1994).
They were co-transfected with expression vectors encoding βcatenin and α-catenin or α-catenin deleted for the N-terminal
143 aa (α-catenin∆143). In immunoprecipitates collected with
anti-β-catenin antibodies full-length α-catenin, but not αcatenin∆143, was found associated with β-catenin (Fig. 4).
β-Catenin binds to α-catenin peptide S27D
Amino acid sequence analysis of the first 150 aa of α-catenin
revealed that aa 117-143 sequence is rich in hydrophobic
amino acid residues, which could represent a complementary
motif to the recently mapped hydrophobic binding site in βcatenin and plakoglobin (Sacco et al., 1995; Aberle et al.,
1996). To provide experimental support for this possibility, the
corresponding peptide S27D (aa 117-143) was synthesized,
HPLC-purified, coupled to tosyl-activated magnetic beads, and
906
α-catenin
binding to
β-catenin
MBP
146
MBP−α-catenin 1-146
+
MBP
129
MBP−α-catenin 1-129
-
MBP
98
MBP−α-catenin 1- 98
-
peptide S27D
+
127
143
1762 O. Huber, M. Krohn and R. Kemler
Fig. 2. Mapping of the β-catenin binding site in α-catenin. Cterminal truncated α-catenin expressed as MBP fusion protein and
GST-tagged β-catenin were incubated in an in vitro reconstitution
assay as described in Materials and Methods. Proteins bound to GSTβ-catenin were affinity purified with glutathione-agarose, separated
by SDS-PAGE, and analyzed by Coomassie staining and western
blotting.
tested for interaction with His6-tagged β-catenin. Binding of
β-catenin was found only to beads coupled with peptide S27D
but not to control beads blocked with ethanolamine (Fig. 5).
Plakoglobin binds to peptide S27D
Homologous domains in β-catenin (aa positions 120-151) and
plakoglobin (aa positions 109-137) are interaction sites for αcatenin (Aberle et al., 1996). Therefore, it seemed likely that
β-catenin and plakoglobin could bind both to the same amino
acid sequence in α-catenin. Binding experiments with recombinant GST-plakoglobin and SW480 cell extracts indicated that
plakoglobin also binds to the MBP-α-catenin 1-146 fusion
protein, but not to MBP-α-catenin 1-129 or MBP-α-catenin 198, as shown in Fig. 6A,B. Since plakoglobin is only a minor
component in SW480 cells, plakoglobin was not easily
detected in binding experiments with 35S-metabolically labeled
cell lysates (not shown), but an interaction was unambigously
demonstrated by subjecting the immunoprecipitates to
Fig. 3. Recombinant MBP-α-catenin 1-146 binds to endogenous βcatenin. (A) MBP-α-catenin fusion proteins were incubated with 35Slabeled cell lysates of SW480 cells. Proteins bound to MBP-α-catenin
fusion proteins were precipitated with anti-MBP polyclonal antibody.
Immunocomplexes were purified on Protein G-Sepharose beads,
separated by SDS-PAGE, and processed for fluorography. Only MBPα-catenin 1-146 bound endogenous β-catenin. (B) Immunoblot with
anti-β-catenin antibody (M14M) demonstrating that the endogenous
protein indeed represents β-catenin. 14C-methylated molecular mass
markers (MW) from top: myosin, 200 kDa; phosphorylase b, 97.4
kDa; bovine serum albumin, 69 kDa; ovalbumin, 46 kDa.
immunoblot analysis with anti-plakoglobin antibodies (Fig.
6B). More importantly, peptide S27D coupled to magnetic
beads was able to bind His6-tagged recombinant plakoglobin
(Fig. 6C), demonstrating that there is a unique binding site in
α-catenin for both β-catenin and plakoglobin.
Site-directed mutagenesis
Mutational analysis revealed that hydrophobic amino acids in
both plakoglobin and β-catenin are indispensable for their
interaction with α-catenin. Within the binding site hydrophobic aa residues are spaced appropriately for an α-helical interaction mechanism (Aberle et al., 1996). This suggested that the
hydrophobic aa residues in the binding site in α-catenin identified here might have a similar importance. The DNAstar
software package and the PHD PredictProtein mail server
program (Rost, 1996; Rost and Sander, 1993, 1994), predicted
a secondary structure of α-catenin with two α-helical regions
separated by a loop at aa positions 113-122. The second α-
Fig. 4. α-Catenin deleted for the N-terminal 143
aa no longer binds to β-catenin. Neuro2A cells
expressing no endogenous E-cadherin and catenins
were transiently transfected with cDNAs encoding
β-catenin, and α-catenin or α-catenin∆143.
Expression of the catenins was analyzed by
western blotting of whole cell lysates (lanes 1-4
for α-catenin and 9-12 for β-catenin).
Immunoprecipitation experiments revealed
association of β-catenin with full-length α-catenin
(lane 5) but not with α-catenin∆143 (lane 6).
Neuro2A cells co-transfected with α-catenin and
β-catenin (lanes 1, 5, 9, 13), or with αcatenin∆143 and β-catenin (lanes 2, 6, 10, 14),
negative control: Neuro2A cells mock transfected
with pCIneo (lanes 3, 7, 11, 15), and positive
control: SW480 cell lysate (lanes 4, 8, 12, 16). The faster migrating bands in lanes 5-8 and 13-16 result from cross-reactivity of the second
antibody in immunoblots with immunoprecipitating anti-β-catenin antibodies.
α-Catenin binding site for β-catenin and plakoglobin 1763
Fig. 5. Peptide S27D is sufficient to bind β-catenin. Peptide S27D
encoding aa 117-143 of α-catenin was covalently linked to tosylactivated magnetic beads as described in Materials and Methods.
Control activated beads were blocked with ethanolamine. Beads were
incubated with recombinant β-catenin with a C-terminal His6-tag as
indicated. Bound protein was separated by SDS-PAGE and analyzed
by western blotting with anti-β-catenin antibody.
helical domain, starting at aa position 123, was within the βcatenin binding site (aa positions 117-143). In an α-helical
wheel model of aa sequence 124-143, all hydrophobic amino
acids except Ile140 are located on one side of the helix (Fig.
7). In an approach comparable to that used by Aberle et al.
(1996), hydrophobic as well as hydrophilic aa residues shown
in the helical wheel model were individually mutated to Ala in
the MBPα1-146 construct. Fusion proteins carrying the single
aa substitutions were mixed with β-catenin from metabolically
35S-labeled SW480 cell lysates. Bound β-catenin was quantified by PhosphoImager analysis. Association with β-catenin
was reduced whenever hydrophobic aa residues were mutated.
Introducing a hydrophilic Ser (mutation A142S) into the
hydrophobic part of the α-helix also greatly reduced the
binding of β-catenin binding. Comparably hydrophilic and
charged aa located on the opposite side of the α-helix were
exchanged to Ala. Interestingly, three of these mutant proteins
(R126A, S133A and T136A) exhibited an increased binding to
β-catenin. These results, summarized in Fig. 7B, suggest that
the association with β-catenin indeed is mediated by a
hydrophobic interaction mechanism.
DISCUSSION
Originally, immunoprecipitation experiments with antibodies
against E-cadherin led to the identification of α-, β-catenin and
plakoglobin complexed to E-cadherin via its cytoplasmic
domain (Ozawa et al., 1989; Nagafuchi et al., 1989). Subsequently, two major lines of research led to a better understanding of the role of catenins. First, establishing the primary
structure of catenins provided important insights into their
possible biological function and opened up new perspectives,
for example revealing β-catenin and plakoglobin to be homologous to the Drosophila armadillo protein. Second, biochemi-
Fig. 6. Plakoglobin binds to the identical domain in α-catenin.
(A) GST-plakoglobin binds to MBP-α-catenin 1-146 as analyzed by
Coomassie staining and western blotting. (B) Plakoglobin from
SW480 lysates coprecipitates with MBP-α-catenin 1-146 as shown
by immunoblot of the immunoprecipitates with anti-plakoglobin
antibody. (C) Peptide S27D binds His6-tagged plakoglobin.
cal analysis on the assembly of the cadherin-catenin complex
and heterotypic expression studies of normal and mutant
proteins elucidated the stoichiometry of the complex and the
mode of interaction between these proteins (Aberle et al., 1994;
Hülsken et al., 1994).
Here we report on one heretofore missing piece of information, namely the binding site in α-catenin for its association
with β-catenin or plakoglobin. Our results show that the Nterminal region of α-catenin harbors the β-catenin/plakoglobin-binding site. Further analysis let us identify peptide S27D
corresponding to aa 117-143 of α-catenin as being sufficient
to bind β-catenin or plakoglobin. These results are consistent
with data recently reported by Nieset et al. (1997) where the
domain in α-catenin that interacts with β-catenin and plakoglobin was mapped to aa 97-148 by two-hybrid and in vitro
association assays.
Detailed mutational analysis had previously shown that
mostly hydrophobic amino acids in an α-helical structure in
plakoglobin and β-catenin are necessary for efficient interaction with α-catenin, and a similar motif for the heterodimerizing peptide sequence within α-catenin was postulated (Aberle
1764 O. Huber, M. Krohn and R. Kemler
catenin. Whether α-catenin binds to β-catenin or plakoglobin
via hydrophobic forces within parallel or antiparallel arranged
α-helical stretches remains elusive. To obtain a final picture of
this protein interaction, NMR or X-ray structural analysis will
be required.
αN-catenin, a recently identified isoform of αE-catenin, is
expressed predominantly in nervous tissue (Uchida et al.,
1994). Transfection experiments in an α-catenin-deficient cell
line showed that αE- and αN-catenin are funtionally interchangeable in developing mouse or chicken embryos despite
their temporally and spatially regulated expression (Hirano et
al., 1992). Comparison of the S27D peptide sequence with the
corresponding aa sequences in the αN-catenins reveals a highly
conserved β-catenin/plakoglobin binding site in α-catenin
isoforms with only a single aa exchange at position 123, where
Asp in mouse αE-catenin is exchanged to Thr in mouse, human
and chicken αN-catenin.
α-Catenin is homologous to the focal adhesion protein
vinculin (Herrenknecht et al., 1991; Nagafuchi et al., 1991).
Alignment of the 27 aa β-catenin/plakoglobin binding site in
mouse α-catenin with the corresponding site in mouse vinculin
reveals only 29.6% identity on the aa level, and computer
analysis does not predict an α-helical secondary structure for
this aa sequence in vinculin.
Decreased cell-cell adhesion is a phenomenon often seen in
tumors. The interaction domains within the cadherin-catenin
complex represent potential mutational hot spots in tumorigenesis. Mutations in the β-catenin/plakoglobin binding site of
α-catenin could result in low affinity or lost interaction with
the actin cytoskeleton, leading to reorganizations of the
cytoskeleton. Such changes destabilize intercellular junctions
and could lead to a switch from an adhesive to an invasive state
during tumor progression.
A
V
L
9
L
16
A
2
D
20
T
13
R
6
I
17
5
V
12
A
19
M
R
1
L
8
S
10
3
R
14
L
15
A
A
11
L
18
A
7
4
B
MBP
MBP 1-98
A142S (19)
L141A (18)
L139A (16)
L138A (15)
R137A (14)
T136A (13)
V135A (12)
S133A (10)
L132A (9)
L131A (8)
R129A (6)
R126A (3)
V125A (2)
WT
0
20
40
60
80
100
%
Fig. 7. Summary of the mutational analysis. (A) An α-helical wheel
model representing 20 amino acids of the β-catenin binding site in αcatenin (aa 124-143). All hydrophobic residues are located on one
side of the α-helix comparable to the α-catenin binding domain in βcatenin and plakoglobin (see Aberle et al., 1996). (B) Single aa
substitutions in the α-catenin binding site affect binding to β-catenin.
The aa differing from the wild-type sequence model are indicated.
Their corresponding positions in the α-helical wheel are given in
brackets. Relative percentages of bound 35S-labeled β-catenin was
quantified using a PhosphoImager. Wild-type MBP-α-catenin 1-146
was set to 100%. The graph represents mean values of 4 experiments.
et al., 1996). Our alanine mapping approach supports this view
and underlines the importance of hydrophobic amino acid
residues for stable interactions between α-catenin and βcatenin/plakoglobin. Replacement of hydrophobic aa in αcatenin affected the protein interaction more moderately
compared to the complementary substitutions in β-catenin or
plakoglobin. As a possible explanation for this apparent discrepancy, we note that the hydrophobic region in α-catenin
includes more hydrophobic amino acids. This may explain why
a single mutation influences less dramatically the binding to β-
We gratefully acknowledge Dr James Nelson (Stanford University,
Palo Alto, CA) for providing the cell line SW480, Dr Heinz
Hoschützky for providing antibodies, Kathi Hansen for technical
assistance, Lore Lay and Edith Ruscher for preparing the photographs,
and Dr Randy Cassada for critically reading the manuscript. This
work was supported by the Max-Planck Society and the MinnaJames-Heineman Foundation.
REFERENCES
Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschützky,
H. (1994). Assembly of the cadherin-catenin complex in vitro with
recombinant proteins. J. Cell Sci. 107, 3655-3663.
Aberle, H., Schwartz, H., Hoschützky, H. and Kemler, R. (1996). Single
amino acid substitutions in proteins of the armadillo gene family abolish their
binding to α-catenin. J. Biol. Chem. 271, 1520-1526.
Behrens, J., Von Kries, J. P., Kühl, M., Bruhn, L., Wedlich, D., Grosschedl,
R. and Birchmeier, W. (1996). Functional interaction of β-catenin with the
transcription factor LEF-1. Nature 382, 225-230.
Butz, S. and Kemler, R. (1994). Distinct cadherin-catenin complexes in Ca2+dependent cell-cell adhesion. FEBS Lett. 355, 195-200.
Ewing, C. M., Ru, N., Morton, R. A., Robinson, J. C., Wheelock, M. J.,
Johnson, K. R., Barrett, J. C. and Isaacs, W. B. (1995). Chromosome 5
suppresses tumorigenicity of PC3 cancer cells: correlation with reexpression of α-catenin and restoration of E-cadherin function. Cancer Res.
55, 4813-4817.
Gumbiner, B. M. (1995). Signal transduction by β-catenin. Curr. Opin. Cell
Biol. 7, 634-640.
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue
architecture and morphogenesis. Cell 84, 345-357.
α-Catenin binding site for β-catenin and plakoglobin 1765
Herrenknecht, K., Ozawa, M., Eckerskorn, C., Lottspeich, F., Lenter, M.
and Kemler, R. (1991). The uvomorulin-anchorage protein α-catenin is a
vinculin homologue. Proc. Nat. Acad. Sci. USA 88, 9156-9160.
Hirano, S., Kimoto, N., Shimoyamy, Y., Hirohashi, S. and Takeichi, M.
(1992). Identification of a neural α-catenin as a key regulator of cadherin
function and multicellular organization. Cell 70, 293-301.
Huber, O., Bierkamp, C. and Kemler, R. (1996a). Cadherins and catenins in
development. Curr. Opin. Cell Biol. 8, 685-691.
Huber, O., Korn, R., McLaughlin, J., Ohsugi, M., Herrmann, B. G. and
Kemler, R. (1996b). Nuclear localization of β-catenin by interaction with
transcription factor LEF-1. Mech. Dev. 59, 3-10.
Hülsken, J., Birchmeier, W. and Behrens, J. (1994). E-cadherin and APC
compete for the interaction with β-catenin and the cytoskeleton. J. Cell Biol.
127, 2061-2069.
Jockusch, B. M. and Rüdiger, M. (1996). Crosstalk between cell-adhesion
molecules – vinculin as a paradigm for regulation by conformation. Trends
Cell Biol. 6, 311-315.
Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J. and Marrs, J. A. (1995).
Genetic and biochemical dissection of protein linkages in the cadherincatenin complex. Proc. Nat. Acad. Sci. USA 92, 5067-5071.
Kadowaki, T., Shiozaki, H., Inoue, M., Tamura, S., Oka, H., Doki, Y.,
Iihara, K., Matsui, S., Iwazawa, T., Nagafuchi, A., Tsukita, S. and Mori,
T. (1994). E-cadherin and α-catenin expression in human esophageal cancer.
Cancer Res. 54, 291-296.
Kemler, R. (1993). From cadherins to catenins: cytoplasmic protein
interactions and regulation of cell adhesion. Trends Genet. 9, 317-321.
Knudsen, K. A., Soler, A. P., Johnson, K. R. and Wheelock, M. J. (1995).
Interaction of α-actinin with the cadherin catenin cell-cell adhesion complex
via α-catenin. J. Cell Biol. 130, 67-77.
Larue, L., Ohsugi, M., Hirchenhain, J. and Kemler, R. (1994). E-cadherin
null mutant embryos fail to form a trophectoderm epithelium. Proc. Nat.
Acad. Sci. USA 91, 8263-8267.
Miller, J. R. and Moon, R. T. (1996). Signal transduction through β-catenin
and specification of cell fate during embryogenesis. Genes Dev. 10, 25272539.
Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J.,
Godsave, S., Korinek, V., Roose, J., Destree, O. and Clevers, H. (1996).
XTcf-3 transcription factor mediates β-catenin-induced axis formation in
Xenopus embryos. Cell 86, 391-399.
Morton, R. A., Ewing, C. M., Nagafuchi, A., Tsukita, S. and Isaacs, W. B.
(1993). Reduction of E-cadherin levels and deletion of the α-catenin gene in
human prostate cancer. Cancer Res. 53, 3585-3590.
Munemitsu, S., Albert, I., Souza, B., Rubinfeld, B. and Polakis, P. (1995).
Regulation of intracellular β-catenin levels by the adenomatous polyposis
coli (APC) tumor-suppressor protein. Proc. Nat. Acad. Sci. USA 92, 30463050.
Nagafuchi, A. and Takeichi, M. (1989). Transmembrane control of cadherinmediated cell adhesion: a 94 kDa protein functionally associated with a
specific region of the cytoplasmic domain of E-cadherin. Cell Regul. 1, 3744.
Nagafuchi, A., Takeichi, M. and Tsukita, S. (1991). The 102 kD cadherinassociated protein: similarity to vinculin and posttranscriptional regulation of
expression. Cell 65, 849-857.
Näthke, S. I., Hinck, L., Swedlow, J. R., Papkoff, J. and Nelson, W. J.
(1994). Defining interactions and distributions of cadherin and catenin
complexes in polarized cells. J. Cell Biol. 125, 1341-1352.
Nieset, J. E., Redfield, A. R., Jin, F., Knudsen, K. A., Johnson, K. R. and
Wheelock, M. J. (1997). Characterization of the interactions of α-catenin
with α-actinin and β-catenin/plakoglobin. J. Cell Sci. 110, 1013-1022.
Ozawa, M., Baribault, H. and Kemler, R. (1989). The cytoplasmic domain of
the cell adhesion molecule uvomorulin associates with three independent
proteins structurally related in different species. EMBO J. 8, 1711-1717.
Ozawa, M., Ringwald, M. and Kemler, R. (1990). Uvomorulin-catenin
complex formation is regulated by a specific domain in the cytoplasmic region
of the cell adhesion molecule. Proc. Nat. Acad. Sci. USA 87, 4246-4250.
Peifer, M., Berg, S. and Reynolds, A. B. (1994). A repeating amino acid motif
shared by proteins with diverse roles in the cell. Cell 76, 789-791.
Riethmacher, D., Brinkmann, V. and Birchmeier, C. (1995). A targeted
mutation in the mouse E-cadherin gene results in defective preimplantation
development. Proc. Nat. Acad. Sci. USA 92, 855-859.
Rimm, D. L. Koslov, E. R., Kebriaei, P., Cianci, C. D. and Morrow, J. S.
(1995). α1(E)-catenin is an actin-binding and -bundling protein mediating
the attachment of F-actin to the membrane adhesion complex. Proc. Nat.
Acad. Sci. USA 92, 8813-8817.
Rost, B. and Sander, C. (1993). Prediction of protein structure at better than
70% accuracy. J. Mol. Biol. 232, 584-599.
Rost, B. and Sander, C. (1994). Combining evolutionary information and
neural networks to predict protein secondary structure. Proteins 19, 55-72.
Rost, B. (1996). PHD: predicting one-dimensional protein structure by profile
based neural networks. Meths Enzymol. 266, 525-539.
Sacco, R. A., McGranahan, T. M., Wheelock, M. J. and Johnson, K. R.
(1995). Identification of plakoglobin domains required for association with
N-cadherin and α-catenin. J. Biol. Chem. 270, 20201-20206.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual, 2nd edn. New York: Cold Spring Harbor Laboratory
Press.
Shimoyama, Y., Nagafuchi, A., Fujita, S., Gotoh, M., Takeichi, M., Tsukita,
S. and Hirohashi, S. (1992). Cadherin dysfunction in a human cancer cell
line: possible involvement of loss of α-catenin expression in reduced cell-cell
adhesion. Cancer Res. 52, 5770-5774.
Stappert, J., Wirsching, J. and Kemler, R. (1992). A PCR method for
introducing mutations into cloned DNA by joining an internal primer to a
tagged flanking primer. Nucl. Acid Res. 20, 624.
Stappert, J. and Kemler, R. (1994). A short core region of E-cadherin is
essential for catenin binding and is highly phosphorylated. Cell Adhes.
Commun. 2, 319-327.
Torres, M., Stoykova, A., Huber, O., Chowdhury, K., Bonaldo, P.,
Mansouri, A., Butz, S., Kemler, R. and Gruss, P. (1997). An α-E-catenin
gene trap mutation defines its function in preimplantation development.
Proc. Nat. Acad. Sci. USA 94, 901-906.
Uchida, N., Shimamura, K., Miyatani, S., Copeland, N. G., Gilbert, D. J.,
Jenkins, N. A. and Takeichi, M. (1994). Mouse αN-catenin: Two isoforms,
specific expression in the nervous system, and chromosomal localization of
the gene. Dev. Biol. 163, 75-85.
(Received 20 January 1997 – Accepted, in revised form,
3 June 1997)