Download Full-Length 16S Amplification, SMRTbell™ Library Preparation and

Unsupported Protocol
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and
without any warranty. Use of these protocols is offered to those customers who understand and accept the associated terms and
®
conditions and wish to take advantage of their potential to help prepare samples for analysis using the PacBio system. If any of these
protocols are to be used in a production environment, it is the responsibility of the end user to perform the required validation.
Full-Length 16S Amplification, SMRTbell™
Library Preparation and Sequencing
This document contains protocols for amplification and sequencing of the entire 16S gene from
bacterial DNA isolated from metagenomic samples. Tests with mock community samples produced
discrete 16S amplicons with adequate yield for library prep and SMRT sequencing. Data analysis
showed good representation of community members in the samples, with low rates of chimerism.
Before You Begin
This procedure requires a KAPA HiFi HotStart PCR Kit from Kapa Biosystems and the following PCR primers:
27F: AGRGTTYGATYMTGGCTCAG
1492R: RGYTACCTTGTTACGACTT
Use only high-quality primers; damaged bases at the ends of the amplicons cannot be repaired by DNA Damage
Repair enzymes and will lower library yield. HPLC purification of PCR primers is recommended. Primers should
be stored at high concentration in buffered solution (e.g., 100uM primer in 10mM Tris pH8), and should not be
subjected to repeated freeze thaws.
Additionally, this procedure requires the following PacBio® products:
•
•
•
•
•
•
•
SMRTbell™ Template Prep Kit
AMPure® PB beads
DNA/Polymerase Binding Kit
MagBead Kit and MagBeads
DNA Sequencing Reagent
DNA Internal Control Complex
SMRT® Cells
Extracting Genomic DNA from Metagenomic Samples
It is often difficult to extract high quality, intact genomic DNA (gDNA) from metagenomic samples, due to the
harsh lysis methods required for some organisms. Yield may be a few nanograms or less for some types of
samples. However, for most samples the quality and yield is still likely to be sufficient for full-length 16S
amplification. The relative abundance of gDNA for community members may be impacted by the extraction
method used1. An improved method for isolating DNA of the human intestinal microbiome has been described2;
samples generated with this method have given excellent sequencing results for PacBio.
Additional tips:
• DNAStable® Plus from Biomatrica may be used to help preserve extracted DNA. Purify samples that
contain DNAStable Plus with 1X AMPure PB beads prior to amplification. Note that DNAStable Plus may
impact quantitation; quantitate after AMPure PB bead purification.
• If damage of input DNA is suspected, treat with DNA Damage Repair reagents from a SMRTbell
Template Prep Kit. Note that DNA Damage Repair would still be done on the amplicons as well.
Unsupported Protocol
Optional: Multiplexing of Amplicons in Sample Preparation and Sequencing
For studies targeting a single consensus sequence per sample, or for identification of relatively abundant
organisms in non-complex metagenomic communities, amplicons may be multiplexed to utilize the
complete capacity of a SMRT Cell. Note that a typical PacBio RSII SMRT Cell generates 40,000-60,000
reads after primary filtering. Further filtering in Reads Of Insert analysis will reduce the number of reads.
PacBio has designed a set of 16-base barcodes for optimal discrimination with SMRT Sequencing.
Barcodes may be incorporated into SMRTbell libraries through the use of either barcoded PCR primers
or barcoded adapters. There are 2 options using barcoded PCR primers, and a third option for preexisting amplicons:
1. Forward and reverse universal-tail 16S primers with the PacBio Barcoded Universal Primer set
(96 barcodes): This method does not require synthesis of barcode-specific 16S PCR primers.
Instead, a universal tail is added to the forward and reverse primers above, and barcodes are added
in a second round of amplification, with PacBio Barcoded Universal forward and reverse primers.
See pages 3-4 for details. For more background on PacBio Universal primers, see Preparing
SMRTbell™ Libraries using PacBio® Barcoded Universal Primers for Multiplex SMRT® Sequencing.
2. A set of 16S barcoded primers: Amplify as described on this page, using a set of forward and
reverse PCR primers with 5’ PacBio barcode sequences. Guidelines and spreadsheets for primer
ordering may be found in the Guidelines for Using PacBio Barcodes for SMRT Sequencing
Unsupported Protocol. Sequences for 384 PacBio barcodes are provided.
3. For multiplexing 16S amplicons that have already been generated, or if barcoded PCR primers
cannot be used, PacBio Barcoded Adapters with 96 barcodes are available for SMRTbell library
preparation. See Preparing SMRTbell™ Libraries using PacBio® Barcoded Adapters for Multiplex
SMRT® Sequencing.
All the reference documents cited herein may be downloaded from the PacBio website.
16S Amplification
In tests with mock community samples, this protocol yields 500 ng to 1 µg of amplicon product from 5 ng
to as little as 50 pg of template DNA. Yield may be lower for some samples with a large amount of
contaminating non-bacterial gDNA. Note that if amplicons will be pooled for library preparation and
sequencing, 400-500 ng is required for the pool of amplicons going into DNA Damage repair. If a small
number of cells will be run, lower input amounts may be used (see page 5, DNA Input Requirements).
When amplifying multiple samples, prepare a PCR master mix with the appropriate volumes of all common
components (except water, if varying volumes of template DNA are used). Note that if barcoded PCR primers
are being used, they must be added separately (with forward and reverse barcoded primers pre-mixed). Insure
that reagents are thawed and mixed prior to preparing the master mix.
Volume, 50 μl reaction
Component
As required for 50 μl rtn
PCR-grade water
5X KAPA HiFi Buffer
10 μl
10 mM dNTPs
1.5 μl
10 μM Forward Primer
1.5 μl
10 μM Reverse Primer
Template DNA, 50 pg to 5 ng
1.5 μl
*
As required
1 U/ μl KAPA HiFi Hot Start DNA Polymerase
1.0 µl
Final volume
50 μl
*
If yield is below 500 ng, or if the sample is suspected of having a large amount of contaminating large genome DNA, >5 ng input may be
required. Lower inputs may be used for multiplexed samples, as described below. Higher input of clean metagenomic DNA may lead to
increased chimera formation.
Aliquot master mix, template and other required components. Cap or seal and spin down briefly.
Unsupported Protocol
Cycle using the following conditions:
Step
Temp
Time
Denaturation
95°C
30 sec
Annealing
57°C
30 sec
Extension
72°C
60 sec
# Cycles
20 to 27
(see right)
Input DNA
# Cycles
5 ng
20
0.5 ng
23
50 pg
27
A higher number of cycles may be required for contaminated samples or very low input samples.
Multiplexing with PacBio Barcoded Universal Primers
This method employs 2 rounds of PCR, the first with universal primer-tailed 16S PCR primers and the
second with PacBio barcoded universal primers.
Before You Begin
•
•
This procedure uses the PacBio® Barcoded Universal F/R Primers Plate – 96 for the second
round of amplification.
The first round of amplification requires user-supplied 16S Primers Tailed with Universal
Sequences. In addition to universal sequence tails, a 5’ block is added, (e.g., 5’NH4-C6) to
ensure that carry-over amplicons from first round PCR are not ligated to the SMRTbell adapters in
subsequent steps. HPLC purification may be desired. The structure of the oligos is 5’ Block universal sequence - 16S primer:
Primer
27F:
1492R:
5’ Block universal sequence
16S PRIMER
/5AmMC6/ gcagtcgaacatgtagctgactcaggtcac AGRGTTYGATYMTGGCTCAG
/5AmMC6/ tggatcacttgtgcaagcatcacatcgtag RGYTACCTTGTTACGACTT
First-Round Amplification using 16S PCR Primers Tailed with Universal Primers
Prepare a PCR master mix with the appropriate volumes of all common components (except water, if
varying volumes of template DNA are used). Insure that reagents are thawed and mixed prior to
preparing the master mix.
Volume, 25 μl reaction
Component
PCR-grade water
5X KAPA HiFi Buffer
10 mM dNTPs
10 μM Forward Primer
10 μM Reverse Primer
Template DNA, 25 pg – 2.5 ng*
1 U/ μl KAPA HiFi Hot Start DNA Polymerase
Final volume
As required for 25 μl rtn
5 μl
0.75 μl
0.75 μl
0.75 μl
As required
0.75 µl
25 μl
*
If PCR yield is below 500 ng, or if the sample is suspected of having a large amount of contaminating large genome DNA,
input may be increase to 5 ng. Lower inputs may be used for multiplexed samples. Higher input of clean metagenomic DNA
may lead to increased chimera formation.
Cycle using the following conditions:
Step
Denaturation
Temp
95°C
Time
# Cycles
30 sec
Annealing
57°C
30 sec
Extension
72°C
60 sec
20 to 27
(see right)
Input DNA
# Cycles
2.5 ng
20
0.25 ng
23
25 pg
27
A higher number of cycles may be required for contaminated samples or very low input samples.
Unsupported Protocol
Sample QC and Normalization for Second Round PCR
It is highly recommended that you check amplification from first round PCR prior to taking samples into
the second PCR round. For best results, normalize samples going into the second-round PCR step:
1. Load samples on an agarose gel for visual inspection, or quantitate using the Agilent® 2200 or 4200
TapeStation instrument or an Agilent 2100 Bioanalyzer System. If the TapeStation instrument or
Bioanalyzer system is used for visualization, dilute 1 µL of PCR product with 1 µL of EB or water
prior to loading. If samples show excess primer dimers or non-specific products, purification or reoptimization is required. Samples may be purified using AMPure PB bead purification to remove
primer dimers, or short non-specific products present in the samples.
2. The amount of PCR product for use in second round of PCR should be roughly equimolar across
samples. If some samples appear weak or undetectable, use more volume in the second round, or
re-amplify with a higher number of cycles.
Second-Round Amplification using 16S PCR Primers Tailed with Universal Primers
Prepare a PCR master mix with the appropriate volumes of all common components (except water, if
varying volumes of template DNA are used). Insure that reagents are thawed and mixed prior to
preparing the master mix.
Volume, 25 μl reaction
Component
As required for 25 μl rtn
PCR-grade water
5 μl
5X KAPA HiFi Buffer
0.75μl
10 mM dNTPs
2 μM Barcoded Universal Primers
3.75 μl
*
As required
1 U/ μl KAPA HiFi Hot Start DNA Polymerase
0.5 µl
Final volume
25 μl
Template DNA, 1-2 ng
*
Higher input may lead to increased chimera formation. Use higher volumes for samples with weak or
undetectable bands on agarose gel QC.
Cycle using the following conditions:
Step
Temp
Time
Denaturation
95°C
30 sec
Annealing
57°C
30 sec
Extension
72°C
60 sec
# Cycles
20
A higher number of cycles may be required for contaminated samples or very low input samples.
Unsupported Protocol
Pooling Barcoded Amplicons into a single SMRTbell™ library
If amplicons have been prepared with barcoded PCR primers, pooling may be done prior to library
preparation, following the step below.
1. In order to obtain adequate data from each sample in a pool, individually quantitate each amplicon
to determine how much to add to the pool. Estimate or determine the concentration of the ~1.5 kb
16S band or peak from the qualitative assessment on an Agilent 2100 Bioanalyzer System, Agilent
2200 TapeStation, or agarose gel electrophoresis. When using agarose gel electrophoresis, be
sure to include a control fragment at several known concentrations.
2. Calculate the DNA mass needed to obtain equimolar representation of each sample in the final
pool. Ideally, amplicons should be AMPure PB bead purified prior to multiplexing. For highthroughput operations, purifying every reaction prior to pooling may not be practical. If unpurified
amplicons will be pooled, prepare a pool with double the input requirement mass, or 1 µg, to allow
for inaccuracies in quantitation as well as loss during initial AMPure PB bead clean-up. If amplicons
are purified with AMPure PB beads prior to pooling, the final pool should contain 500 ng.
3. Should off-target products be present, purify as described below. Purification may be done after
pooling if all undesired fragments can be removed by the same method. To determine the
amount of each sample to pool, quantitate the target amplicons only (see below). For pools
requiring gel purification, increase the input amount by an additional 2- to 3-fold, to at least 2 µg.
Purity and Sizing of Amplicon Samples
It is important to check the size and purity of amplicon samples before preparing SMRTbell libraries for
sequencing. Visualize an aliquot of each PCR reaction using an Agilent 2100 Bioanalyzer system, Agilent 2200
or 4200 TapeStation instrument, or manual agarose gel electrophoresis, with appropriate markers or ladders.
Note: if the Bioanalyzer system or TapeStation instrument is used for visualization, dilute 1 µL of PCR product
with 1 µL of EB or water prior to loading. If aberrant products are present, they must be removed prior to, or
during, library preparation as described on the following pages. If present in the final library, shorter
contaminants may represent a substantial percentage of the sequencing reads.
If Required: Methods for Isolating Target Amplicons from Undesired PCR Products
If amplification reactions contain secondary bands that are <1.0 kb, and are both considerably shorter and less
abundant than the desired product, it may be possible to remove them using AMPure PB bead purification as
described in this document. For substantial levels of contaminating products, several rounds of AMPure PB bead
purification may be required.
If the contaminating bands are quite close in size or larger than the desired amplicon, or for any contaminants
>1.5 kb, a gel-based method is strongly recommended (see below).
Note: Recovery of a given target using a gel-based extraction method is typically <50% of the mass of the target.
To insure adequate recovery of DNA following extraction, increase the input amount to 1.0 – 1.5 µg.
Gel-based Size Selection – See Amplicon Protocols
To remove contaminants of similar or larger sizes than the desired product, we recommend the use of an
automated gel electrophoresis system such as the BluePippin™ or SageELF™ systems from Sage Science,
which have reduced risk of sample cross contamination. See the protocols for size selection with the BluePippin
or SageELF systems.
Size selection may also be performed by manual excision from an agarose gel. Recommendations for manual
gel size selection are provided in Procedure & Checklist - Amplicon Template Preparation and Sequencing.
Unsupported Protocol
DNA Input Requirements
Check recovery of purified amplicons to insure adequate input for library preparation. We recommend Qubit® or
Nanodrop® instruments for quantitation of AMPure PB bead-purified amplicons. If an Agilent Bioanalyzer or Tape
Station instrument is used for quantitation, include all peaks or sizes where DNA is present in determining
ng/μL.
For full-length 16S amplicons of around 1.5 kb, 400-500 ng is recommended going into the DNA Damage Repair
step.
If recovery is below 400 ng, consider running additional replicates of the primary PCR. If this is not
possible, there are several options for sequencing samples that do not meet the above input
requirements:
1. If the project meets the criteria for multiplexed sample prep and sequencing, consider using Barcoded
Adapters (option 3 on page 2).
2. For single samples, if there is at least 50 ng, this protocol may be used, but library yield is likely to be lower
than would be obtained from the recommended input. Estimate number of SMRT Cells from a library with
10-15% yield using the Binding Calculator. It may be necessary to disable standard concentrations in the
Calculator, and SMRT Cell yields may be slightly lower than normal. Use the MagBead One Cell Per Well
(OCPW) run protocol.
3. For full-length 16S amplicons with only 5-50 ng available, consider using the Procedure & Checklist - Very
Low (10 ng) 2 kb Library Preparation with Carrier DNA protocol.
Note that for lower input samples, gel purification is not recommended. Use AMPure PB bead purification for
removal of shorter contaminants, as described below.
AMPure® PB Bead Purification
Purify individual and pooled amplicons using appropriate volumes of AMPure PB beads. In addition to
removing PCR reagents and exchanging buffers, this step will remove primer dimers, and is essential prior to
SMRTbell library preparation. To remove contaminants from 1.5 kb 16S amplicons, use 0.60X AMPure beads
for contaminants < 500 bp (i.e., use 0.60X the volume of AMPure PB beads relative to the sample volume). If
contaminants are in the 500 bp to 1 kb range, use 0.50X AMPure PB beads. For more stringent purification.
0.45X AMPure PB beads may be used (with very careful pipetting). There will be some 16S amplicon loss but
also a greater reduction of contaminants.
Tips for AMPure PB Bead Purifications
•
•
•
•
Perform all AMPure PB bead purification steps at room temperature.
Before using, mix the bead reagent well until the solution appears homogenous. Pipette the reagent
slowly since the bead mixture is viscous and precise volumes are critical to the purification process.
Carry out purifications in Eppendorf LoBind tubes or equivalent
We recommend using a VWR vortex mixer with a foam microtube attachment (see the relevant Guide
for part numbers). If using other instrumentation, ensure that the mixing is continual and complete.
Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and
reduced sample recoveries.
Unsupported Protocol
Recovery of clean samples from AMPure PB bead purification should be between 80-100%; however, yields will
be lower for samples with smaller contaminating fragments or primer dimers.
STEP
1
2
3
4
AMPure PB Bead Purification Protocol
Determine the sample volume. Add 0.60X volume (or 0.50X volume for contaminant
removal, as described above) of AMPure PB magnetic beads to the sample. For 25 µL PCR
reactions, add an additional 25 µL of high quality water or EB, then add the appropriate
volume AMPure beads to allow for minor pipetting errors with AMPure beads.
Mix the bead/DNA solution thoroughly
Quickly spin down the tube (for 1 second) to collect the beads
®
Allow the DNA to bind to beads by mixing in a VWR vortex mixer at 2000 rpm for 10
minutes at room temperature. Note that the bead/DNA mixing is critical to yield. After mixing,
the bead/DNA mixture should appear homogenous.
5
6
Spin down the tube (for 1 second) to collect the beads
7
With the tube still on the magnetic bead rack, slowly pipette off cleared supernatant and save
in another tube. Avoid disturbing the bead pellet.
If the DNA is not recovered at the end of this Procedure, you can add equal volumes of
AMPure PB beads to the saved supernatant and repeat the AMPure PB bead purification
steps to recover the DNA.
Wash beads with freshly prepared 70% ethanol.
Note that 70% ethanol is hygroscopic and should be prepared FRESH to achieve optimal
results. Store 70% ethanol in a tightly capped polypropylene tube for no more than 3 days.
– Do not remove the tube from the magnetic rack.
– Use a sufficient volume of 70% ethanol to fill the tube (1.5 mL for 1.5 mL tube or 2 mL for 2
mL tube). Slowly dispense the 70% ethanol against the side of the tube opposite the beads.
Let the tube sit for 30 seconds.
– Do not disturb the bead pellet.
– After 30 seconds, pipette and discard the 70% ethanol.
Repeat step 8 above.
Remove residual 70% ethanol and dry the bead pellet.
– Remove tube from magnetic bead rack and spin to pellet beads. Both the beads and any
residual 70% ethanol will be at the bottom of the tube.
– Place the tube back on magnetic bead rack.
– Pipette off any remaining 70% ethanol.
Check for any remaining droplets in the tube. If droplets are present, repeat step 10.
Remove the tube from the magnetic bead rack and allow beads to air-dry (with the tube caps
open) for 30 to 60 seconds.
Add 37- 38 μL of PacBio Elution Buffer to the beads to elute the DNA
– Mix until homogeneous.
– Vortex for 1-2 minutes at 2000 rpm.
– Spin the tube down to pellet beads, then place the tube back on the magnetic bead rack.
– Carefully collect the eluted sample.
– Discard the beads.
After AMPure PB bead clean-up, quantitate PCR products using the Qubit or Nanodrop
platforms.
8
9
10
11
12
13
14
Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the
solution appears clear. The actual time required to collect the beads to the side depends on
the volume of beads added.
NOTES
Unsupported Protocol
Repair DNA Damage
Use the following table to repair any DNA damage.
1. In a LoBind microcentrifuge tube, add the following reagents. For more than 1 sample, prepare a pre-mix of
DNA Damage Repair Buffer, NAD+, ATP high, and dNTP, and add 11 μL of pre-mix per sample.
Reagent
Tube Cap Color
Stock Conc.
Final Conc.
Notes
37 μL
dsDNA
10X
5.0 μL
1X
NAD+
100X
0.5 μL
1X
ATP high
10 mM
5.0 μL
1 mM
dNTP
10 mM
0.5 μL
0.1 mM
DNA Damage Repair
Buffer
2.0 μL
DNA Damage Repair
Mix
*
50.0 μL
Total Volume
*
Volume
If necessary, add H2O to bring the volume to 50 µL.
2. Mix the reaction well by pipetting or flicking the tube.
3. Spin down contents of tube with a quick spin in a microfuge.
4. Incubate at 37ºC for 60 minutes or longer, up to 150 minutes, then return the reaction to 4°C for 1 minute.
Repair Ends
Use the following table to prepare your reaction then purify the DNA.
Reagent
Tube Cap Color
Stock Conc.
DNA (Damage
Repaired)
End Repair Mix
Total Volume
20 X
Volume
Final Conc.
50 μL
-
2.0 μL
1X
52.0 μL
-
Notes
1. Mix the reaction well by pipetting or flicking the tube.
2. Spin down contents of tube with a quick spin in a microfuge.
3. Incubate at 25ºC for 5 minutes, return the reaction to 4ºC. Do not incubate the End Repair reaction longer
than 5 minutes. Proceed directly to the next step.
Unsupported Protocol
STEP
Purify DNA
2
Add 0.6X volume or 31.5 μL of AMPure PB beads of AMPure PB beads to the
End-Repair reaction (For more details, see the AMPure PB Bead Purification
section, pages 6-7.)
Mix the bead/DNA solution thoroughly.
3
Quickly spin down the tube (for 1 second) to collect the beads. Do not pellet beads.
4
Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for
10 minutes at room temperature.
5
Spin down the tube (for 1 second) to collect beads.
6
Place the tube in a magnetic bead rack to collect the beads to the side of the tube.
7
Slowly pipette off cleared supernatant and save (in another tube). Avoid disturbing
the bead pellet.
8
Wash beads with freshly prepared 70% ethanol.
9
Repeat step 8 above.
1
10
Remove residual 70% ethanol and dry the bead pellet.
– Remove tube from magnetic bead rack and spin to pellet beads. Both the
beads and any residual 70% ethanol will be at the bottom of the tube.
– Place the tube back on magnetic bead rack.
– Pipette off any remaining 70% ethanol.
11
Check for any remaining droplets in the tube. If droplets are present, repeat step
10.
12
Remove the tube from the magnetic bead rack and allow beads to air-dry (with
tube caps open) for 30 to 60 seconds.
13
Elute the DNA off the beads:
– Add 31-32 μL Elution Buffer, mix until homogenous
– Vortex for 1-2 minute at 2000 rpm
– Spin the tube down to pellet beads, then place the tube back on the magnetic
bead rack.
– Carefully collect the eluted sample.
– Discard the beads.
14
Optional: Verify your DNA amount and concentration using a Nanodrop or Qubit
quantitation platform, as appropriate.
Actual recovery per μL and total available sample material:
Note that typical yield at this point of the process (following End- Repair and one
AMPure PB bead purification) is approximately 80-100% of the total starting
material going into the Damage Repair reaction.
15
The End-Repaired DNA can be stored overnight at 4ºC, or at -20ºC for longer
duration.
Notes
Unsupported Protocol
Prepare Blunt-Ligation Reaction
Use the following table to prepare your blunt-ligation reaction:
1. In a LoBind microcentrifuge tube (on ice), add the following reagents in the order shown.
• Template Prep Buffer and ATP low may be pre-mixed; blunt adapter and ligase should be added
separately in the order listed below and mixed well prior to the next step.
• The adapter concentration below is appropriate for the input amounts from the table on page 2. If a
higher amount of input DNA is being used, adjust the adapter concentration accordingly to minimize
double-insert SMRTbell templates; a 30-50X molar excess of adapter is recommended.
Stock
Tube Cap Color
Reagent
Volume
Final Conc.
Notes
Conc.
DNA (End Repaired)
32 µl
20 μM
Annealed Blunt
Adapter (20 μM)
1.0 μL
0.5 μM
Mix before proceeding
Template Prep Buffer
10 X
4.0 μL
1X
ATP low
1 mM
2.0 μL
0.05 mM
Mix before proceeding
30 U/μL
Ligase
1.0 μL
0.75 U/μL
40.0 μL
*
Total Volume
*
If necessary, add H2O to bring the volume to 40 µL.
2.
3.
4.
5.
Mix the reaction well by pipetting or flicking the tube.
Spin down contents of tube with a quick spin in a microfuge.
Incubate at 25°C for 15 minutes to 24 hours (overnight).
Incubate at 65°C for 10 minutes to inactivate the ligase, then return the reaction to 4°C.
Add Exonucleases to Remove Failed Ligation Products
Reagent
Tube Cap Color
Stock Conc.
Ligated DNA
Volume
40 µL
Mix reaction well by pipetting
ExoIII
100.0 U/μL
0.5 µL
ExoVII
10.0 U/μL
0.5 µL
Total Volume
41.0 μL
1. Mix the reaction well by pipetting or flicking the tube.
2. Spin down contents of tube with a quick spin in a microfuge.
3. Incubate at 37°C for 1 hour, then return the reaction to 4°C. You must proceed with purification after this step.
Unsupported Protocol
Purify SMRTbell™ Templates
There are 2 or 3 purification steps using the appropriate volume of AMPure PB beads for each step, see table
below. For more stringent purification from shorter contaminants, 0.5X or 0.45X AMPure beads may be used
in the final steps, as discussed on page 6.
STEP
Purify SMRTbell Templates - First Purification
1
Add 0.6X volume or 24.6 µL AMPure PB beads to the exonuclease-treated
reaction, following the chart below. (For more detailed instructions, see the
AMPure PB Bead Purification section, page 6.)
2
Mix the bead/DNA solution thoroughly.
3
Quickly spin down the tube (for 1 second) to collect the beads. Do not pellet
beads.
4
Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm
for 10 minutes at room temperature.
5
Spin down the tube (for 1 second) to collect beads.
6
Place the tube in a magnetic bead rack to collect the beads to the side of the
tube.
7
Slowly pipette off cleared supernatant and save (in another tube). Avoid
disturbing the bead pellet.
8
Wash beads with freshly prepared 70% ethanol.
9
Repeat step 8 above.
10
Remove residual 70% ethanol and dry the bead pellet.
Notes
– Remove tube from magnetic bead rack and spin to pellet beads. Both the
beads and any residual 70% ethanol will be at the bottom of the tube.
– Place the tube back on magnetic bead rack.
– Pipette off any remaining 70% ethanol.
11
Check for any remaining droplets in the tube. If droplets are present, repeat step
10.
12
Remove the tube from the magnetic bead rack and allow beads to air-dry (with
tube caps open) for 30 to 60 seconds.
13
Elute the DNA off the beads:
– Add 50 μL Elution Buffer, mix until homogenous
– Vortex for 1-2 minute at 2000 rpm
– Spin the tube down to pellet beads, then place the tube back on the
magnetic bead rack.
– Carefully collect the eluted sample.
– Discard the beads.
The eluted DNA in 50 μL Elution Buffer should be taken into the second AMPure
PB bead purification step.
14
Note: 3 AMPure PB bead purifications may be required to remove all adapter dimers. For 3 purifications, repeat
the protocol above for the second AMPure purification, adding 0.6X AMPure beads (30 µL) to the sample from
the first purification. Then continue for the third AMPure PB bead purification.
Unsupported Protocol
STEP
Purify SMRTbell Templates - Final Purification
1
Add 30 µL (0.6X volume) AMPure PB beads to 50 µL of eluted DNA from the
previous AMPure PB bead purification step.
2
Mix the bead/DNA solution thoroughly.
3
Quickly spin down the tube (for 1 second) to collect the beads. Do not pellet
beads.
4
Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm
for 10 minutes at room temperature.
5
Spin down the tube (for 1 second) to collect beads.
6
Place the tube in a magnetic bead rack to collect the beads to the side of the
tube.
7
Slowly pipette off cleared supernatant and save (in another tube). Avoid
disturbing the bead pellet.
8
Wash beads with freshly prepared 70% ethanol.
9
Repeat step 8 above.
10
Remove residual 70% ethanol and dry the bead pellet.
– Remove tube from magnetic bead rack and spin to pellet beads. Both the
beads and any residual 70% ethanol will be at the bottom of the tube.
– Place the tube back on magnetic bead rack.
– Pipette off any remaining 70% ethanol.
11
Check for any remaining droplets in the tube. If droplets are present, repeat step
10.
12
Remove the tube from the magnetic bead rack and allow beads to air-dry (with
tube caps open) for 30 to 60 seconds.
13
Elute the DNA off the beads:
– Add 10 μL Elution Buffer, mix until homogenous
– Vortex for 1-2 minute at 2000 rpm
– Spin the tube down to pellet beads
– Place the tube back on the magnetic bead rack and carefully collect the
eluted sample.
– Discard the beads.
i 50 the
L DNA
f El tiamount
B ff and
V concentration
t f 1 i with
t teither
2000 a Nanodrop or Qubit
Verify
14
quantitation reading.
15
Perform qualitative analysis using a Bioanalyzer instrument. Note that typical DNA
yield, at this point of the process, can range from 15-50% of the total starting
material going into the DNA Damage Repair reaction (depending on the purity and
quality of input DNA).
Notes
Unsupported Protocol
Annealing, Binding, and Sequencing SMRTbell™ Templates
The PacBio DNA/Polymerase Kit is required for this step. Use the Binding Calculator to determine conditions for
annealing the sequencing primer and binding polymerase to SMRTbell templates. Specific recommendations
are below:
•
•
•
Increase on-plate loading concentration: 0.010-0.025 nM in Custom Parameters
We suggest using MagBead OCPW run protocol
Movie length: 240-360 minutes to maximize CCS accuracy
For more information about using the Calculator, see the relevant Guide.
DNA Control Complex Dilution
The PacBio DNA Control Complex is required for this step. Dilute the DNA Control Complex according to the
volumes and instructions specified in the Calculator.
Sequence
To prepare for sequencing on the instrument, refer to the Online Help system or relevant Guide for more
information. Follow the touchscreen UI to start your run. Note that you must have a DNA Sequencing Kit
and SMRT Cells for standard sequencing.
Acknowledgement
We acknowledge Tanja Woyke, the Microbial Genomics Program Lead at the DOE Joint Genome
Institute, for her input in developing this protocol.
References
1
2
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0088982
https://www.jstage.jst.go.jp/article/jsme2/22/3/22_3_214/_article
For Research Use Only. Not for use in diagnostic procedures. © Copyright 2016, Pacific Biosciences of California, Inc. All rights reserved. Information in this document is subject to change
without notice. Pacific Biosciences assumes no responsibility for any errors or omissions in this document. Certain notices, terms, conditions and/o r use restrictions may pertain to your use
of Pacific Biosciences products and/or third p arty products. Please refer to the applicable Pacific Biosciences Terms and Conditions of Sale and to the applicable license terms at
http://www.pacificbiosciences.com/licenses.html. Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, SMRTbell, Iso-Seq, and Sequel are trademarks of Pacific Biosciences.
BluePippin and SageELF are trademarks of Sage Science, Inc. NGS-go and NGSengine are trademarks of GenDx. All other trademarks are the sole property of their respective owners.