Download Detection of mutation status of IgVH genes and minimal residual

1st Faculty of Medicine
Charles University
Detection of mutation status of IgVH genes and minimal residual disease in
chronic lymphocytic leukemia
Dissertation Thesis
Soňa Peková
Supervisor: Jiří Schwarz, M.D, PhD.
Laboratory of PCR Diagnostics of Leukemias
Institute of Hematology and Blood Transfusion, Prague
Prague 2005
1
Acknowledgements
It is my pleasure to thank my supervisor Jiří Schwarz for helpful discussions. Moreover, I
would like to express my gratitude to Michal Dvořák and Petr Cetkovský for word of
encouragement, stimulating ideas and support.
2
List of contents
Preface…………………………………………………………………………..….4
1. Introduction…………………….…………………………………………..……4
1.1. The biology of the B-cell…………..…………………………………….……..4
1.2. From the B-cell to chronic lymphocytic leukemia……………………….….….9
1.2.1.Disease Description………………………………………………………..…..9
1.2.2. Staging CLL………………………………………………………………..….9
1.2.3. Prognostic markers in CLL……………………………………………….….10
1.2.3.1. Mutation status of IgVH genes………………………………………….….11
1.2.3.2. Surrogate markers for IgVH status…………………………………………12
1.2.3.3. Genomic aberrations in CLL……………………………………………..…12
1.2.3.4. Aberrations of the p53 gene………………………………………………...14
1.2.4. Therapeutical modalities in CLL…………………………………………..….15
2. Results…………………………………………………………………………...17
Touch-down RT-PCR detection of IgVH rearrangement and Sybr-Green-based real-time
RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic
leukemia…………………………………………………………………….………..18
3. Conclusion……………………………………………………………………..…46
4. References………………………………………………………………………..46
5. List of author’s publications………………………………………………………46
3
Preface
The aim of this work was to introduce the detection of hypermutation status of IgVH genes in
chronic lymphocytic leukemia in the Czech republic, as at the time of working on this project,
there was no laboratory engaged in this type of molecular investigation.
Although some time has elapsed since then, nothing has changed on the fact that mutation
status of IgVH genes is one of the most important independent prognostic factors in chronic
lymphocytic leukemia.
Moreover, we have extended our work to the investigation of minimal residual disease in
chronic lymphocytic leukemia, which at the time of starting with the project was only
experimental. Nowadays, both of the investigations (detection of the hypermutation status of
IgVH genes, as well as the detection of minimal residual disease) have been fully implemented
in the clinical practice and help the hematologists in their clinical decision-making.
1. Introduction:
1.1. The biology of the B-cell:
The development of a B-cell starts in the bone marrow, after a committed pluripotent
hematopoietic cell had “decided” to follow the fate of the lymphocytic lineage. The process of
the decision is believed to be completely stochastic, influenced by many humoral factors
affecting the recipient pluripotent cell. Upon starting, the developmental program of a B-cell
switches on many events that end up in an irreversible change in the genome, caused by
rearrangement of V, D, J and C subgenes.
4
Figure 1: Human V-region genes shuffled by gene rearrangement to generate the single heavy
chain specificity characteristics of each B-cell. The VH genes can be grouped into seven
different families based upon sequence homology of 80%, with VH3 being by far the largest
family. Individual members of a family are interspersed throughout the locus, i.e. there is no
significant grouping together of VH family genes. The additional D segment minigenes are
present in the heavy chain locus (adopted from Essential Immunology, Roitt, I.M. et Delves,
PJ.)
In general, there are more than 50 V (variable), 25 D (diversity), 6 J (joining) and 9 C
(constant) subgenes, which present an array for very large combinatorial possibilities. Each
cell uses only one subgene from the many V, D, J and C subgenes.
The choice about the particular subgene seems to be completely random again. By excision
and ligation of the V, D, J and C genomic segments by specific protein machinery, the pre-B
lymphocyte’s genome is created. To put even more diversity into the immunoglobulin
rearrangement, at the boundaries between V and D, and D and J, completely random
nucleotides are added. This task is accomplished by the terminal deoxyribonucleotidyl
transferase (TdT), which is a unique enzyme capable of adding nucleotides to the nascent
5
DNA strand in a template- independent manner. In reality it means that at the boundary
between the V and the D segment, and the D and J segment, cell-unique DNA stretches
emerge. This non-template addition of nucleotides enlarges enormously the diversity of the
already vast family of immunoglobulin genes.
Figure 2: The joining of V, D and J segments. Joining is masterminded by the recombination
activating genes RAG-1 and RAG-2, the products of which cleave the DNA at the signal ends.
RAG-1 and RAG-2 together produce several thousand times more efficient VDJ
recombination than either alone. The introns adjoining the V, D and J gene segments contain
specialized recombination signal sequences (RSSs), which include conserved heptamers and
nonamers separated by spacers of either 12 of 23 base pairs. The two joining segments, in
this example VL and JL, are brought into proximity by interaction between their respective
RSSs mediated by the DNA bending and looping high mobility group-1 and –2 proteins
(HMG-1 and HMG-2). RAG-1 and RAG-2 cleave the DNA to produce double-strand breaks
at the border of the RSS. The excised signal sequences are ligated to form the signal joint
6
resulting in a piece of circular DNA containing the excised sequences. This is probably
maintained in the cell for a period of time before eventually being lost from the cell. The
double strands of each coding segment form “hairpin” ends. The enzyme Ku (a dimer of
Ku70 and Ku86) binds to the DNA ends and stimulates DNA-dependent protein kinase (DNAPK), which facilitates the opening of the hairpin. Terminal deoxynucleotidyl transferase
(TdT) adds nucleotides to the ends of the DNA strands in order to generate N-region
diversity. Unlike the precision of the signal joint, the coding joint is variable because it can
involve the addition of base pairs resulting from both the resolution of the hairpin loop (Pelements) and the TdT-mediated N-region diversity. Nucleases remove any excess nucleotides
and polymerases fill in any gaps before the DNA ligase IV and XRCC4 enzymes carry out
ligation of the two sequences. Since the coding elements are joined at random with respect to
the reading frames, two out of three events have the coding elements out of frame. Although
apparently wasteful, this is evolutionarily tolerated because it confers so much benefit in the
form of antigen receptor diversity. VDJ recombination products define the major antigenbinding domains. (Adopted from Essential Immunology, Roitt, I.M. et Delves, PJ.)
The B-lymphocyte, which has had successfully rearranged its V, D, J and C subgenes, at this
point resides in the bone marrow. Here, the first incomplete IgVH chain is produced and the
immunoglobulin is guided to the cell membrane, where it becomes a transmembrane protein.
This immature immunoglobulin reacts with a ligand (antigen), which is presented by an
antigen-presenting cell (APC). Upon a productive interaction between the immature
immunoglobulin and the ligand, the immunoglobulin is conformationally activated and can
convey positive downstream signals into the cell.
The cell reacts by methylation of the promoter sequences of the other, yet non-transcribed
allele of the immunoglobulin gene. As the result, under normal circumstances, one B-cell
7
produces only one type of immunoglobulin. This process is called “allelic exclusion” and is
possible to happen only if the first allele had been rearranged successfully, i.e. in frame, no
stop codons, no deletions.
After the other allele had been rendered non-functional, the B-cell starts to produce mature
immunoglobulin. Still in the bone marrow, by the APC cells, the cell is presented autoantigens, which are peptide fragments of proteins to be encountered in the body. For the Bcell to survive, non-reactivity with the body-self antigens is absolutely essential. If the B-cell
answers to the challenge by auto-antigens, it means it does not pass the “auto-immunity” test,
and it receives a strong negative signal urging the particular B-cell to die by apoptosis.
The survivors traverse to the secondary lymphatic organ (spleen, lymphatic node), where they
undergo a process of so called “affinity maturation”. During this process, APC cells present
the B-cells with specific antigens, but here the situation is different. The APC cells challenge
the B-cells with foreign antigens that should be cleared off the body. If a particular Blymphocyte interacts positively with the presented antigen, a process of so-called “somatic
hypermutation” is fired off, which means that some additional nucleotide substitutions are
created throughout the stretch of the immunoglobulin gene. The rationale behind this process
is to modulate the immunoglobulin response to the presented antigen to its highest level
possible. Somatic hypermutation is a very unique process in the nature; based on a proteinprotein interaction, nucleotide substitutions are embedded in the genome.
The somatic hypermutation affects preferentially the variable region of the immunoglobulin
gene heavy chain. The process is completely dependent on the activity and precise location of
promoter and enhancer regulatory sequences of the IgVH gene. It has been shown that shifts
or deletions within these regulatory sequences might prevent the somatic hypermutation from
occurring.
8
1.2. From the B-cell to chronic lymphocytic leukemia:
1.2.1. Disease description
Chronic lymphocytic leukemia (CLL), a malignant disorder of the B-lymphoid lineage, is the
most frequent type of leukemia in the Western world and affects mainly elderly individuals.
Nevertheless, about 30% of patients are less than 60 years at diagnosis[1]. CLL follows an
extremely variable clinical course with overall survival times ranging from months do
decades[2-4]. Some patients have no or minimal symptoms during their entire disease course
and have survival times similar to age-matched controls. Other patients experience rapidly
deteriorating blood counts and organomegaly and suffer from symptoms very soon, thus
necessitating therapy[5-7]. Novel therapeutic modalities, such as purine analogues,
monoclonal antibodies and autologous or allogeneic stem cell transplantation (SCT) are
highly effective and some of them potentially curative[8, 9]. Nevertheless, given the therapyrelated morbidity and mortality, it has become highly desirable to define those CLL patients
who might profit from an aggressive treatment. Thus, thorough stratification and precise riskfactor assessment within the heterogeneous group of CLL patients is one of the major goals in
CLL management[8, 10].
1.2.2. Staging in CLL
The standard clinical procedures to estimate prognosis are the clinical staging systems
developed by Rai at al. and Binet et al[11, 12]. These systems define early (Rai 0, Binet A),
intermediate (Rai I/II, Binet B) and advanced (Rai III/IV, Binet C) stage disease with median
estimated survival times of more than 10, 5-7, and 1-3 years, respectively. However, there is a
9
marked heterogeneity in the course of the disease among individual patients within a single
stage group. Importantly, the clinical staging systems do not allow to predict the probability
of disease progression in an individual patient. As more than 80% of patients are diagnosed
early, it is necessary to identify markers that may help to refine outcome prediction for these
individuals[8, 13].
1.2.3. Prognostic markers in CLL
There has been an intensive work on clinical and biological factors of potential prognostic
relevance that may add to the classic assessment provided by the staging system. Among
these are i) clinical patient characteristics such as age, gender and performance status ii)
laboratory parameters reflecting the tumor burden or disease activity such as lymphocyte
count, lactate dehydrogenase (LDH) elevation, bone marrow infiltration pattern or
lymphocyte doubling time (DLT)[14-16] iii) serum markers such as soluble CD23, 2microglobulin (2-MG) or thymidine kinase (TK)[17], and iv) genetic markers of tumor cells
such as genomic aberrations, gene abnormalities (p53 and ATM), mutation status of the
variable segments of immunoglobulin heavy chain genes (VH) or surrogate markers for these
factors (CD38, ZAP-70, LPL/ADAM19)[3, 14, 18-25]. Recent research has moved toward a
molecular genetics that may not only provide insight into the biology and the transforming
events but may also define mechanisms directly responsible for the clinical behavior of the
disease with regard to disease progression, response to treatment and overall survival.
10
1.2.3.1. Mutation status of IgVH genes
One of the most important molecular genetic parameters defining pathogenic and prognostic
subgroups of CLL is the hypermutation status of IgVH genes[3, 18]. According to the degree
of hypermutation, the heterogeneous B-CLL entity was separated into two distinct subgroups:
one with unmutated IgVH genes, assumed to originate from pregerminal center cells, and the
other with mutated VH genes, thought to originate from postgerminal center cells. However,
genome-wide gene expression profiling studies revealed a surprisingly homogeneous pattern
of gene expression in both subtypes of B-CLL, closely resembling postgerminal, memory
cells[26, 27], with only a limited set of genes being differentially expressed in the B-CLL
subgroups. Most importantly, it has been repeatedly shown that the VH mutation status is
clinically highly relevant[3, 18]. While CLL with unmutated VH shows an unfavorable course
with a rapid progression, CLL with mutated VH often showed slow progression and long
survival.
Byrd JC et al., Hematology 2004
11
Furthermore, and independent of the mutation status, the usage of specific VH genes such as
VH3-21 may be associated with an inferior outcome[28-30].
1.2.3.2. Surrogate markers for IgVH status
To make the estimation of prognosis based on the VH status accessible to the routine
hematology laboratory, surrogate markers for the VH status were sought after. Originally, a
correlation was observed between the VH mutation status and CD38 expression of the CLL
cells pointing to CD38 expression as a prognostic marker[18]. Based on genome-wide gene
expression studies, other surrogate markers such as ZAP-70 expression were identified and
validated[22]. ZAP-70 expression appears to strongly correlate with the IgVH mutation status
and was therefore a strong prognostic marker in a pivotal study. However, for both CD38 and
ZAP-70, subsequent studies have yielded controversial results with regard to their validity as
surrogate marker for VH as a prognostic indicator[14, 22, 23, 31, 32].
1.2.3.3. Genomic aberrations in CLL
Genomic aberrations are the other genetic parameter shown to be of pathogenic and clinical
relevance in CLL. Genomic aberrations can be identified in about 80% of CLL cases by
fluorescence in situ hybridization (FISH)[19]. Genomic aberrations provide insight into the
pathogenesis of the disease since they point to loci of candidate genes (17p13: p53, 11q22q23: ATM) and identify subgroups of patients with distinct clinical features. Specific genomic
aberrations
have
been
associated
with
disease
characteristics
such
lymphadenopathy (11q deletion) and resistance to treatment (17p deletion)[19].
12
as
marked
The observation that the rate of disease progression is associated with genomic aberrations
and unmutated IgVH status indicates that these factors may determine the course of the
disease. The fact that overall survival was inferior for the subgroups with unmutated IgVH,
11q-, or 17p-, suggests that response to therapy may be different in genetic subgroups[19-21].
In particular, the deletion 17p- and -possibly- abnormalities of the p53 gene involved in this
aberration have been associated with the failure of treatment with alkylating agents, purine
analogs and rituximab[33, 34]. An interphase FISH study also showed that patients whose
leukemic cells showed a 17p- deletion had significantly shorter survival times than patients
without this aberration, and a relationship was found between the deletion and the response to
treatment. Similarly, the monoclonal anti-CD20 antibody rituximab did not show efficacy in
B-CLL with p53 deletion[35]. In contrast, it has been reported that durable therapeutic
success can be achieved in B-CLL with 17p- and/or p53 mutations using the monoclonal antiCD52 antibody alemtuzumab[36-38].
In order to further improve our understanding of molecular pathogenesis and clinical outcome
prediction in CLL, microarray platforms have been developed as tools to evaluate genome
wide parameters and defects. On the genomic level matrix CGH (comparative genomic
hybridization against the matrix of defined DNA fragments) is a sensitive test allowing the
detection of novel recurrent aberrations of potential pathogenic and prognostic
importance[39]. On the level of gene expression, comprehensive profiling studies of CLL
based on DNA chip technology have indicated that the global gene expression “signature” of
VH mutated and unmutated CLL is very similar (resembles experienced memory cells) and
that only the expression of a small number of genes discriminates between the two groups[26,
27, 40]. In addition to the characterization of expression signatures associated with the VH
mutation subgroups of CLL a study of 100 CLL samples characterized for VH status and
13
genomic aberrations described a significant number of differentially expressed genes
clustering in chromosomal regions affected by the respective genomic losses or gains[41].
Deletions affecting chromosome bands 11q22-q23 and 17p13 led to a reduced expression of
the genes in the corresponding genomic region, such as ATM and p53, while trisomy 12
resulted in the upregulation of genes mapping to chromosome arm 12q. The finding that the
most significantly differentially expressed genes were located in the corresponding aberrant
chromosomal regions suggests that a gene dosage effect may exert a pathogenic role in CLL.
esis and clinical outcome prediction in CLL, microarray platforms have been developed as
tools to evaluate genome wide parameters and defects. On the genomic level matrix CGH
(comparative genomic hybridization against the matrix of defined DNA fragments) is a
sensitive test allowing the detection of novel recurrent aberrations of potential pathogenic and
prognostic importance[39]. On the level of gene expression, comprehensive profiling studies
of CLL based on DNA chip technology have indicated that the global gene expression
“signature” of VH mutated and unmutated CLL is very similar (resembles experienced
memory cells) and that only the expression of a small number of genes discriminates between
the two groups[26, 27, 40]. In addition to the characterization of expression signatures
associated with the VH mutation subgroups of CLL a study of 100 CLL samples
characterized for VH status and genomic aberrations described a significant number of
differentially expressed genes clustering in chromosomal regions affected by the respective
genomic losses or gains[41]. Deletions affecting chromosome bands 11q22-q23 and 17p13
led to a reduced expression of the genes in the corresponding genomic region, such as ATM
and p53, while trisomy 12 resulted in the upregulation of genes mapping to chromosome arm
12q. The finding that the most significantly differentially expressed genes were located in the
corresponding aberrant chromosomal regions suggests that a gene dosage effect may exert a
pathogenic role in CLL.
14
sis and clinical outcome prediction in CLL, microarray platforms have been developed as
tools to evaluate genome wide parameters and defects. On the genomic level matrix CGH
(comparative genomic hybridization against the matrix of defined DNA fragments) is a
sensitive test allowing the detection of novel recurrent aberrations of potential pathogenic and
prognostic importance[39]. On the level of gene expression, comprehensive profiling studies
of CLL based on DNA chip technology have indicated that the global gene expression
“signature” of VH mutated and unmutated CLL is very similar (resembles experienced
memory cells) and that only the expression of a small number of genes discriminates between
the two groups[26, 27, 40]. In addition to the characterization of expression signatures
associated with the VH mutation subgroups of CLL a study of 100 CLL samples
characterized for VH status and genomic aberrations described a significant number of
differentially expressed genes clustering in chromosomal regions affected by the respective
genomic losses or gains[41]. Deletions affecting chromosome bands 11q22-q23 and 17p13
led to a reduced expression of the genes in the corresponding genomic region, such as ATM
and p53, while trisomy 12 resulted in the upregulation of genes mapping to chromosome arm
12q. The finding that the most significantly differentially expressed genes were located in the
corresponding aberrant chromosomal regions suggests that a gene dosage effect may exert a
pathogenic role in CLL.
Moreover, recently a novel group of differentially expressed miRNAs has been revealed by
microarray analysis. It has been shown that miRNAs might play a crucial role in CLL
pathogenesis and biological behavior of the disease[42, 43].
1.2.3.4. Aberrations of the p53 gene
15
The observation that the rate of disease progression is associated with genomic aberrations
and VH mutation status indicates that these factors may determine the course of the disease.
The fact that overall survival was inferior for the subgroups with unmutated VH, 11q-, or
17p-, suggests that response to therapy may be different in genetic subgroups.
In particular, the deletion 17p- and/or abnormalities of the p53 gene involved in this
aberration have been associated with the failure after treatment with alkylating agents, purine
analogs and rituximab[33-35]. An interphase–FISH study also showed that patients whose
leukemia cells showed a 17p- deletion had significantly shorter survival times than patients
without this aberration, and a relationship was found between the deletion and the response to
treatment[33]. Similarly, the monoclonal anti-CD20 antibody rituximab did not show efficacy
in CLL with p53 deletion[35]. In contrast, there are anecdotal pieces of evidence that durable
therapeutic success can be achieved in CLL with 17p-/p53 mutations using the monoclonal
anti-CD52 antibody alemtuzumab[36].
1.2.4. Therapeutical modalities in CLL
Autologous and allogeneic stem cell transplantation (SCT) are increasingly gaining more
importance as treatment options in patients with active CLL[8, 44]. These procedures may
confer therapeutic benefit but are also associated with considerable toxicity and cost. The
efficacy of autologous SCT relies solely on the cytotoxic therapy administered. Allogeneic
SCT offers the potential additional benefit of the immune-mediated graft-versus-leukemia
effect but also harbors the danger of a graft-versus-host disease. Hence, there is a need to
identify prognostic factors that may help to determine whether a patient is a candidate for
SCT and if an allogeneic SCT or autologous SCT should be considered.
16
Emerging data from prospective autologous SCT trials are demonstrating safety, improved
remission rates after transplant and long survival times. In the multicenter prospective
autologous SCT study of the GCLLSG3, the transplant-related mortality was 5% with a
2-year overall survival rate of 88% among 105 patients[44]. This result appears promising
considering the high-risk features present in the majority of patients. However, the continuing
clinical and molecular relapses observed in all series of autologous SCT in CLL are the
evidence against the curative potential of the procedure in the majority of patients[45].
As compared to autologous SCT the primary therapeutic advantage of allogeneic SCT after
dose-reduced conditioning is the graft-versus-leukemia effect, which may offer long-term
disease control and eventual cure[8]. Indeed, a recent comparative study of minimal residual
disease (MRD) as detected by consensus primer CDR3 PCR provided evidence that the graftversus-leukemia effect is operational in CLL with unmutated IgVH genes[46]. In this study
only a modest decrease in MRD levels was observed immediately after allogeneic SCT, but
MRD became undetectable in 7 of 9 (78%) CLL patients with unmutated VH after
discontinuing immunosuppression, chronic graft-versus-host disease or donor lymphocyte
infusions[46]. After a median of 25 months, these 7 patients remain in clinical and molecular
remission. In contrast, PCR negativity was achieved in only 6 of 26 (23%) control CLL cases
with unmutated VH after autologous SCT after dose-reduced conditioning and was not
durable[8, 46]. Therefore, allogeneic SCT appears to combine the favorable features of low
transplant-related mortality with the activity of the graft-versus-leukemia effect, making the
procedure a valid option when aiming at cure for high risk CLL[47].
The assessment of minimal residual disease (MRD) in CLL is becoming increasingly
important in the follow-up of patients undergoing intensive treatment[48-51]. There are
commonly used options for minimal residual disease evaluation, such as flow cytometry or
17
standard consensus PCR. Both methodologies are suitable for a routine laboratory practice,
but their detection limit is 1/103 up to 1/104 maximum[49].
The aim of our study described below, was to introduce the methodology of IgVH mutation
status detection in our CLL patients. A special emphasis was put to increase the sensitivity of
the available assays, as their overall rate of positively identified IgVH clones did not surpass
70-80%. Moreover, we extended our work to the detection of minimal residual disease in
CLL patients undergoing treatment, as there is increasing evidence that not only qualitative,
but rather quantitative information about the patients’ disease course might be of clinical
importance. Using clone-specific primers and real-time PCR technology it is feasible to
increase the specificity and sensitivity of MRD detection to that extent, that it is possible to
identify one malignant cell in one million of normal cells.
Using this molecular approach, we are able to monitor the clone-specific IgVH expression
with a far higher specificity and sensitivity, which provides the clinician with a valuable piece
of feedback information regarding the therapy response. Moreover, this methodology might
also allow for predicting a molecular relapse prior to an overt clinical manifestation.
At present, the knowledge on what level of MRD is clinically relevant in CLL is far from
being complete. As such, MRD investigation remains a great clinical and laboratory
challenge. A lot of experimental work and clinical data is needed to shed some light on this
definitely intriguing issue.
2. Results
18
Herein I present our paper that resulted from our work on the detection of IgVH mutation
status and minimal residual disease investigation in CLL. The paper has been accepted for
publication in the journal Molecular Diagnosis (impact factor 2.532).
Title of the article:
Touch-down RT-PCR detection of IgVH rearrangement and Sybr-Green-based real-time
RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic
leukemia
Soňa Peková1,2, Jana Marková1, Petr Pajer2, Michal Dvořák2, Petr Cetkovský1, Jiří
Schwarz1*
1
Institute of Hematology and Blood Transfusion, Prague, Czech Republic
2
Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague
19
Abstract
Background: Patients with chronic lymphocytic leukemia relapse even after aggressive
therapies and autografts. We assume that to prevent relapses, the level of minimal residual
disease (MRD) should be minimized as much as possible. To evaluate MRD, highly sensitive
quantitative assays are needed.
Methods: For diagnostic identification of IgVH rearrangement(s) (as a prerequisite for MRD
detection), touch-down RT-PCR using degenerate primers was used. For the quantitative
MRD detection in 18 patients, we have employed a real-time RT-PCR assay (RQ-PCR)
making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For
precise calibration of RQ-PCR, patient-specific IgVH sequences were cloned.
Results: Touch-down RT-PCR with degenerate primers allowed successful detection of IgVH
clonal rearrangement(s) in 252/257 (98.1%) diagnostic samples. Biallelic rearrangements
were found in 27/252 (10.7%) cases. Degenerate primers used for identification of clonal
expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQPCR assay using patient-specific primers and SG reached the sensitivity of 10-6. We
demonstrated MRD in each patient tested, including 4/4 patients in complete remission
following autologous hematopoietic stem cell transplantation (HSCT) and 3/3 following
allogeneic "mini"-HSCT. Increments in MRD might herald relapse. Aggressive chemotherapy
could induce molecular remission.
Conclusions: Our touch-down RT-PCR has higher efficiency to detect clonal IgVH
rearrangemets including the biallelic ones. MRD quantitation of IgVH expression using SGbased RQ-PCR represents a highly specific, sensitive and economical alternative to
quantitative methods known to date.
20
Introduction
Until recently, treatment of patients with chronic lymphocytic leukemia (CLL) has been
focused mainly on palliative management of various symptoms accompanying the disease.[1]
At present, novel therapeutic modalities, such as purine analog chemotherapy, monoclonal
antibodies and hematopoietic stem cell transplants (HSCT) allow more effective intervention,
leading to high percentages of obtaining complete remission and possibly even cure.[2-7] CLL
patients may experience quite divergent fates: CLL may present a smoldering disease not
affecting survival on the one hand, or it may take an aggressive course on the other.[2,8] To
distinguish between them, numerous prognostic tools in CLL have been employed.[2,3,9,10]
Chromosomal aberrations (detected by FISH analyses) and recently, mutational status of IgVH
genes (detected by PCR and sequencing), have been considered the most powerful
independent prognostic markers.[11,14-17] The hypermutation degree of IgVH genes (mutated vs
unmutated) divides the patients into favorable or unfavorable risk groups, respectively.[12,13,14]
Importantly, the above described prognostic tools are operative even at the initial clinical
stages of CLL,[11,15-17] such as Rai 0-1 or Binet A.[10,15] However, the widely used PCR
techniques to detect IgV gene rearrangements (carried out on DNA level) are sensitive enough
only to identify the leukemic B cell clone in 66 up to 90% of CLL patients.[18-20]
Younger patients with poor risk CLL may be candidates for more aggressive treatment
including HSCT.[5,6,21] The major pitfall of HSCT lies in the occurrence of clinical relapses.
This holds true especially for the autologous setting. In the study of Ritgen et al., virtually all
patients having unmutated IgVH genes relapsed clinically or molecularly within 4 years after
autologous HSCT.[23] Facing the problem of relapses[14,23], it may only be logical to consider
21
the following: 1. to treat efficiently the minimal residual disease (MRD), 2. to avoid
reinfusion of residual leukemic cells in the setting of autologous HSCT and to assess the
MRD status before collecting the autograft and then in the autograft itself. For both tasks,
precise detection of MRD seems to be mandatory. Thus, minimal residual tumor burden
estimation presents a great laboratory challenge in CLL. As mere qualitative information
about patient’s MRD status (positivity or negativity) might not be relevant and satisfying
anymore,[14,22,24,25] quantitative analyses are given prominence in the clinical follow-up of
CLL patients. Different laboratories use different approaches to this issue. The preferred
methodology for MRD evaluation in CLL makes use of fluorescently labeled hybridization
probes and quantitative real-time PCR technology (RQ-PCR).[24,25] Although hybridization
probes are of high convenience and reliability for MRD detection in leukemias distinguished
by characteristic chromosomal translocations,[26-28] they might be of limited use for MRD
detection in CLL due to the pronounced target sequence heterogeneity. Other approaches in
MRD detection in CLL are based on Genescan or immunophenotypic analyses.[29,30] Both of
them are relatively inexpensive, high-throughput, but in comparison to PCR-based
technologies, they are of limited sensitivity and specificity.[29]
Although the clinical value of quantitative MRD detection remains to be established in further
studies, a real effort is being devoted to the management of technical aspects concerning
MRD quantitative detection in CLL. As a prerequisite for further MRD detection, we have
employed a PCR strategy, which combines the touch-down RT-PCR with the usage of
degenerate primers. To improve the applicability and cost-effectiveness of the currently used
methods for MRD detection in CLL,[19,24,25] we have used an approach that is based on the
quantitative RQ-PCR detection of clone-specific IgVH transcripts using patient-specific
primers, molecular cloning of patient-specific IgVH sequences, and, importantly, on
22
employing Sybr-Green intercalating dye in the quantitative PCR reaction. Our method meets
all the above-mentioned criteria for a reasonable approach.
Materials and methods
Patients
We have studied 257 patients with CLL (96 females and 161 males) diagnosed according to
the NCI criteria.[31] Peripheral blood and/or bone marrow samples were taken after informed
consent was obtained. Patients at varying stages of the disease, both treated and untreated,
were included. For the MRD studies, 18 patients (all of them being candidates for aggressive
therapy and HSCT) were recruited. The cohort comprised 17 males and 1 female, median age
53.5 (43–66) yrs. Clinical data of patients with a longer follow-up are summarized in Table 1.
As normal controls, peripheral blood samples from healthy volunteers were employed.
1
2
VI/99 46 F
0 XI/01
2
3
XI/99 59 M
4
0
I/02
¤
normal
0
17p- (3%) 4.5 3-30
1
0.3 3-23
1
23
F, RTX
FC
CLB, COP
allo-HSCT
allo-HSCT
F, auto-HSCT at relapse
PR
PB F+Bu+ATG
51+
CR
PB
46+
CR
Cond
25+
Source of cells
Therapy following
time F‡
Therapy preceding to
time F‡
CD38+
IgVH subfamily
IgVH hypermutation (%)
1-69
13q-
0
Current status
1 VIII/01
Overall survival (mos)
as of IX/03
1 VIII/01 49 M
FISH†
Rai stage at time F*
Time F* (date)
Age at diagnosis (yrs)
Sex
Rai stage at diagnosis
Date of diagnosis
Patient Nr.
Table 1
none
F+Cy
4
II/02 50 M
1 IV/02 1 (bulky)
13q-
0
1-69
1
none
FC, FCR
19+
*Time F = time of molecular follow-up initiation. NT = not tested.
†
Chromosomes investigated by intephase FISH: #11 (employing the MLL gene and ATM gene probes), #12, 13, 17.
‡
2
Therapies given: CLB = chlorambucil; COP courses according to Catovsky [38]; F = fludarabine 25 mg/m iv x 5 days;
2
2
auto-HSCT = conditioning with F 25 mg/m x 5 days plus cyclophosphamide (CPA) 120 mg/m x 2 days plus autologous
2
peripheral blood stem cell infusion; RTX = rituximab 375 mg/m 1st course and then 500 mg/m2; FC = F 30 mg/m2 iv x 3
2
2
days plus CPA 250 mg/m iv x 3 days; FCR = as the latter plus RTX 375 mg/m day 1; allo-HSCT = the Slavin's "mini"conditioning with F, busulfan and anti-thymocyte globulin [32] and family HLA-identical donor peripheral blood HSCT
¤
With prolymphocytic transformation.
CR = complete remission; PR = partial remission.
Isolation of RNA
Mononuclear cells from CLL bone marrow or peripheral blood samples were separated using
Ficoll-Paque (Sigma) density gradient. 5x106 cells were lyzed in TriZol reagent (Gibco BRL).
Both RNA and DNA were isolated according to the manufacturer’s recommendations.
cDNA preparation
Reverse transcription was carried out as follows: 25 pmol of random hexamers (PerkinElmer) were incubated with 1 g of total RNA at 65 °C for 10 min. After denaturation, the
sample was cooled down to 4 °C and the master mix consisting of 200 M dNTPs (Promega),
10 mM dithiothreitol (Gibco BRL), 1x first strand buffer (Gibco BRL), 10 U RNasin
(Promega), 100 U Superscript II (Gibco BRL) and sterile water to a final volume of 10 l was
added. The reaction mixture was incubated for 1.5 hr at 42 °C. As the final step, reaction
mixture was heated to 94 °C for 2 min in order to terminate the reverse transcription. cDNA
samples were stored at –20 °C.
24
CR
Identification of IgVH family expression using touch-down RT-PCR and degenerate primers
Seven IgVH families were identified using primers described elsewhere,[32] with the exception
for primer VH1. Its sequence has been slightly modified to match better its recognition site
(Table 2). The seven IgVH families were amplified in six individual PCRs, with VH1 and
VH7 families being amplified by the same set of primers. Using the PTC-200 thermal cycler
(MJ-Research), touchdown RT-PCR was carried out in a final volume of 25 l in the reaction
mixture consisting of 50 pmol of forward and reverse primer (Invitrogen), 200 M dNTPs, 1x
PCR reaction buffer (Perkin-Elmer), 2 mM MgCl2 and 1 U Ampli Taq Gold polymerase
(Perkin-Elmer). The touch-down PCR amplification program was designed as follows: initial
denaturation at 94 °C for 5 min and subsequent cycling: in each step, 15 sec denaturation at
94 °C and polymerization at 72 °C for 30 sec, with annealing steps in between, ramping down
from 65 °C to 50 °C, with a ramping rate 1 °C/1 step. At 50 °C, additional 30 cycles with
profile 94 °C, 15 sec; 50 °C, 30 sec; 72 °C 30 sec were added. PCR products were separated
on 2% agarose stained with ethidium bromide.
Table 2
Sequences of the primers and the abl hybridization probe
25
Name
Sequence 5´  3´
VH1
VH2
VH3
VH4
VH5
VH6
JH1-5
JH-6
5´ FAM- abl- BHQ 3´
CCTCAGTGAAGGTCTCCTGCAAGGC
GTCCTGCGCTGGTGAAASCCACACA
GGGGTCCCTGAGACTCTCCTGTGCAG
GACCCTGTCCCTCACCTGCRCTGTC
AAAAAGCCCGGGGAGTCTCTGARGA
ACCTGTGCCATCTCCGGGGACAGTG
GGTGACCAGCGTBCCYTGGCCCCAG
GGTGACCGTGGTCCCTTGCCCCCAG
CCAGTAGCATCTGACTTTGAGCCTCA
Adopted from Souto-Carneiro et al.,[28] except for primer VH1, the sequence of which was
slightly modified. The abl probe was designed according to Visani et al.[39]
Sequencing of the predominant IgVH clone(s) and establishing the mutational status of IgVH
genes
Bands of approximately 300 bp (obtained as described above) were cut out, phenol :
chloroform purified [33] and directly sequenced using the Big Dye Terminator kit v. 3 and ABI
Prism 310 Genetic Analyzer (Perkin-Elmer). Sequences were analyzed using the program
Chromas 1.5 (Technelysium) and aligned to the nearest IgVH germline sequences using the
IgVH BLAST program.[34] The percentage of hypermutation was calculated. As
recommended,[12,13] a threshold of 2% was set to distinguish between “mutated” and
“unmutated” IgVH sequences.
Design of patient-specific primers
For 18 patients, patient-specific primers were designed, based on the previous detection of
their IgVH sequences. The forward primers were designed to match precisely either the FWR1
26
or CDR1 regions of the patient’s particular IgVH gene, preferably the most diverse stretches
within these regions. The individual reverse primers were designed to be complementary to
the CDR3 unique sequences, with the nontemplated “fingerprint” nucleotides matching the
very 3’ end of the primer. The amplicons sized approximately 200 bp. All primers were
purchased from Invitrogen.
To check the suitability of patient-specific primers for SG-based assay, control PCR was
carried out. In those instances, when only one specific PCR product was observed, patientspecific primers were accepted for the SG-based assay.
Cloning of patient-specific IgVH sequences and abl gene
For RQ-PCR IgVH quantitation experiments, as external standards, patient-specific IgVH
sequences as well as a fragment of human abl gene were cloned. IgVH sequences were
amplified using patient-specific primers as described above. The sequences of primers used
for amplification of the abl gene are listed in Table 2. PCR products were gel-purified using
phenol : chloroform method.[33] Purified products were T/A ligated into pCR2.1 vector
(Invitrogen) according to the manufacturer’s recommendations. Competent cells DH5-
(Invitrogen) were transformed by ligation mixture and grown on LB-plates with ampicilin
overnight.
To detect positive clones harboring desired plasmid constructs, colony PCR was carried out,
with each single E. coli colony used as a template for PCR. For each construct, one positive
clone was selected and grown in LB medium with ampicilin at 37 °C overnight. Plasmids
were prepared using alkaline lysis followed by phenol : chloroform extraction. The
27
concentration and purity of plasmid preparations were determined using Beckman
spectrophotometer. The correctness of all constructs was verified by sequencing.
RQ-PCR quantitation of IgVH messages in CLL samples
The RQ-PCR assay: To quantify the amount of clone-specific IgVH transcription, cDNAs
from CLL patients were prepared as described above. Plasmids harboring individual patientspecific IgVH sequences were serially diluted by a factor of 10, starting from 1 ng/l and
ending at 1 pg/l. Using the Rotor-Gene 2000 RQ-PCR cycler (Corbett Research, Mortlake,
N.S.W., Australia) equipped with a software for PCR product quantitation, CLL cDNA
samples as well as diluted plasmids were subjected to PCR amplification with patient-specific
primers. To control the reproducibility of pipetting, sample handling and reaction chemistry
on its own, each reaction was run in duplicate. To enable measurement of the increasing
amount of PCR product, as a reporter dye, the dsDNA binding dye Sybr-Green (SG;
Biosearch Technologies) was added to the reaction mixture. PCR master mix for RQ-PCR
consisted of 5 pmol of forward and reverse patient-specific primer, 200 M dNTPs, 1 x PCR
reaction buffer, 2 mM MgCl2, 1 : 60 000 finally diluted SG and 2 U Ampli Taq Gold
Polymerase in a final volume of 20 l. PCR amplification program was as follows: 94 °C, 5
min; 45 x (94 °C, 15 sec; 60 °C, 30 sec; 72 °C, 30 sec, fluorescence acquisition). Emitted
fluorescence was measured using Rotor-Gene 2000 quantitation software.
The “threshold line” and calculation of Ct values: Using the Rotor-Gene 2000 quantitation
software, the so-called threshold line was set up. This line was positioned to cross the plasmid
amplification curves in their exponential phase, whereby each amplicon of the diluted plasmid
was assigned its Ct value. The Ct value was defined as the cycle number at which exponential
28
amplification started. The Ct value for each cDNA sample was calculated from the
intersection of the threshold line and the sample curve. By plotting the Ct values against
dilution factors of plasmids, a calibration curve was constructed. The software-generated
R-values of about 0.99 and more, characterizing the quality of plasmid calibration, were
accepted for further patient-specific IgVH transcript evaluation.
RQ-PCR for the abl housekeeping gene:
cDNA sample form each CLL patient was
quantitatively analyzed for abl gene expression, as a housekeeping gene. The calibration of
the assay was, in principle, carried out precisely the same as the calibration of the IgVH RQPCR assay described above, with the only exception that instead of SG dye a Taq-Man
hybridization probe (Table 2) was used to detect the PCR product.
Master mix for RQ-PCR consisted of 5 pmol of forward and reverse abl - specific primers,
200 M dNTPs, 1x PCR reaction buffer, 2 mM MgCl2, 8 pmol of 5’JOE- 3’BHQ1 labeled abl
hybridization probe (Biosearch Technologies) and 1 U Ampli Taq Gold polymerase in a final
volume of 20 l. PCR amplification program was: 94 °C, 5 min; 50x (94 °C, 15 sec; 60 °C,
30 sec, fluorescence acquisition; 72 °C, 30 sec).
By setting the threshold value, each
amplicon was assigned its Ct value and the calibration curve was constructed.
The “relative IgVH expression”:
The relative content of IgVH transcripts in the patient’s
sample assayed by RQ-PCR was given as the "relative IgVH expression." This parameter was
expressed as a ratio of the results of IgVH and the housekeeping abl gene quantitations. The
amount of the detected cDNA at the start of the assay inversely correlates with the Ct value
detected by the Rotor-Gene 2000 software. In the exponential phase of the assay, the number
of transcripts doubles during each cycle. Thus, the amount of the cDNA detected at the point
Ct+1 is double the amount of cDNA detected at the point Ct. Then, the relative IgVH : abl
29
expression is the ratio 2Ct abl : 2Ct IgVH , i.e. 2(Ct abl – Ct IgVH). In samples with no effective IgVH
amplification (the theoretical Ct value of which lies in infinity), the values of 0 are given.
Statistical analyzes
The relative frequencies of patients with mutated and unmutated IgVH genes in a particular
subfamily were analyzed using the two-tailed Fisher's exact test for contigency tables
(employing the GraphPad Prism 3.0 software).
Results
Predominant IgVH family detection in CLL patients
Using degenerate primers, all of the 7 IgVH families were amplified using 6 touch-down RTPCRs for each sample. For each IgVH family tested, healthy donors gave a smear-like pattern
of PCR products on the agarose gel (Figure 1a). This physiological type of expression was
regarded as polyclonal. On the other hand, CLL patients, though for some families still
polyclonal, were usually distinguished by a single, predominant band in one of the IgVH
families tested (Figure 1b). We were able to find a clonal expansion in 252 out of 257 (98.1%)
diagnostic CLL samples. In 27 out of 252 (10.7%) patients, two major bands were detected,
representing biallelic (or biclonal) cell population (Figure 1c).
Figure 1
30
PCR amplification of 7 IgVH families at the cDNA level using degenerate primers. In a
healthy donor (a), all IgVH families gave a smeared (polyclonal) pattern (emerging due to the
uneven length of CDR3 regions within the particular family). (b) In CLL patient No. 3., a
major sharp band was detected in IgVH3 family. Direct sequencing of this preponderant PCR
product revealed the IgVH3-23 clonal expansion. (c) CLL patient with a biallelic disease.
Sequence analysis confirmed clonality in IgVH subfamilies VH1-8 and VH4-59. 2% agarose
gel electrophoresis stained with ethidium bromide.
Bias of IgVH subfamilies to either mutated or unmutated status
Sequencing analysis of successfully identified clonal expansion(s) in 252 CLL patients
revealed that 116/252 (46%) of them had unmutated and 141/252 (56%) mutated IgVH genes.
Moreover, based on the sequencing data we have found out that the usage of some IgV H
subfamilies by CLL cell clones was uneven. The most preferred subfamilies found were VH434 (26 cases), VH3-30 (23 cases), VH1-69 (22 cases), VH3-23 (19 cases), VH5-51 (18 cases),
VH3-7 (13 cases) and VH3-21 (13 cases). Furthermore, sequencing analyses of patient’s IgVH
genes showed a remarkable tendency of certain IgVH subfamilies to either mutated or
unmutated IgVH gene status (Table 3). CLLs with a clonal expansion of VH3-7 subfamily
31
were usually distinguished by mutated IgVH gene status (P=0.0429), whereas the majority of
CLLs using IgVH subfamilies VH1-69 (P<0.0001) and VH5-51 (P=0.0247) had unmutated
genes.
Table 3
Tendency of certain IgVH subfamiliies to either mutated or unmutated IgVH gene status
Subfamily
Total
Mutated
Unmutated
%
P
1-18
1-2
1-3
1-46
1-58
1-69
1-8
2-5
2-7
3-11
3-13
3-15
3-20
3-21
3-23
3-30
3-33
3-43
3-48
3-49
3-53
3-64
3-66
3-7
3-72
3-74
3-9
4-28
4-31
4-34
4-39
4-4
5
6
8
6
1
22
6
6
3
6
1
8
2
13
19
23
6
2
10
2
4
2
1
13
3
7
6
1
4
26
10
1
4
4
5
1
0
2
4
5
2
5
1
5
1
9
14
11
5
0
4
0
2
1
1
11
2
4
2
1
3
18
4
1
1
2
3
5
1
20
2
1
1
1
0
3
1
4
5
12
1
2
6
2
2
1
0
2
1
3
4
0
1
8
6
0
80
67
63
17
0
9
67
83
67
83
100
63
50
69
74
48
83
0
40
0
50
50
100
85
67
57
33
100
75
69
40
100
ns
ns
ns
ns
ns
<0.0001
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.0429
ns
ns
ns
ns
ns
ns
ns
ns
32
4-59
4-61
5-51
6-1
7-81
Total
9
9
18
7
1
277
6
7
5
3
1
154
3
2
13
4
0
123
67
78
28
43
100
56
ns
ns
0.0247
ns
ns
P calculations using the two-tailed Fisher's exact test. ns - not
significant in 95% confidence interval.
Qualitative detection of minimal residual disease: comparison of patient-specific primers and
degenerate primers
We have designed patient-IgVH-specific primers for MRD detection in 18 CLL patients.
Using these primers, we were able to demonstrate MRD in each of them (data not shown) in
the course of their follow-up (see below). The PCR products gave single, specific, sharp band
on agarose gel (Figure 2a). In contrast, MRD detection was obscured, when degenerate
primers were used. The result was a smear-like product with no apparent specific band
(Figure 2b), mimicking thus a result of a healthy donor.
Figure 2
Comparison of PCR amplification of IgVH sequences using patient-specific
primers (a) and degenerate primers (b) for qualitative detection of MRD in a
CLL patient (No. 2). (a): lane 1 - IgVH PCR amplification on cDNA using
patient-specific primers; lane 2 - IgVH PCR amplification using patientspecific primers on a plasmid harboring patient-specific IgVH gene; lane 3 negative control. (b): IgVH PCR amplification on the same cDNA (as in
figure 2a – lane 1) using degenerate primers for IgVH3 family. 2% agarose
33 with ethidium bromide.
gel electrophoresis stained
Quantitative IgVH detection using RQ-PCR and Sybr-Green as the reporter dye – a model of
serial dilutions
To test the applicability and sensitivity of the Sybr-Green (SG)-based RQ-PCR technique in
MRD detection in CLL, we have designed a model, in which serially diluted cDNA from a
CLL patient was used as a template for quantitative RQ-PCR detection of the patients' clonespecific IgVH transcript. cDNA from patient No. 4 was serially diluted into cDNA from a
healthy donor by a factor of 10, starting at dilution of 100 and ending at dilution of 10-5(Figure
3). These diluted templates were subjected to quantitative RQ-PCR using patient-specific
primers, SG dye and reaction chemistry based on Ampli Taq Gold polymerase. For Ampli
Taq Gold polymerase, 1 : 60000 final SG dilution and 2 mM final Mg2+ concentration gave
the best results with steep curves in RQ-PCR and single bands on agarose gel electrophoresis
without any traces of non-specific products or primer dimers. In this patient with a mild
absolute lymphocytosis[35] (WBC 13.2 x 109/l with 62% of lymphocytes in peripheral blood),
the sensitivity of the SG-based RQ-PCR assay was only 10-4 (Figure 4). On the other hand,
the same dilution experiments performed on cDNA from a patient with leukemia with marked
lymphocytosis (his WBC was 153 x 109/l with 83% of lymphocytes in peripheral blood)
showed the limiting sensitivity of the assay being 10-6 (data not shown). Though from
34
practical purposes the dilution experiments were done on cDNA into cDNA diluted samples,
we verified the results using cells to cells dilution assay as well (data not shown). In our
hands, results obtained by both assays were precisely the same.
Figure 3
Sensitivity of the SG-based quantitative RQ-PCR assay for MRD detection in a CLL patient
(No. 4) using patient-specific primers. Patient’s cDNA was serially diluted into cDNA from a
healthy donor by a factor of 10 (100 down to 10-5) and PCR amplified using the patientspecific primers. The insertion depicts the same products on 2% agarose gel. cDNA dilutions:
Lane 1: 100; lane 2: no cDNA (negative control); lanes 3 and 4: 10-1; lanes 5 and 6: 10-2; lanes
7 and 8: 10-3; lanes 9 and 10: 10-4; lane 11:10-5. The final dilution of 10-5 gave no product.
Figure 4
35
Quantitation of IgVH transcripts in
serially diluted cDNA of patient No. 4,
given as the "relative IgVH expression".
Quantitative MRD detection in CLL samples using SG-based RQ-PCR assay and patientspecific primers
For 18 patients (including one with a biallelic rearrangement), we have cloned their patientspecific IgVH genes, designed their patient-specific primers and confirmed them to be suitable
for the SG-based quantitative RQ-PCR assay (see Materials and Methods). Since all 18
primer sets gave single, specific PCR products on agarose gel electrophoresis, they could be
used for longitudinal follow-up of MRD in these patients. All of the 18 patients were highrisk: all but one (patient No. 2) had unmutated IgVH genes. Patient No. 2 had a
prolymphocytic transformation of a previously typical CLL. Since the time-point when the
patient-specific primers were designed, complete or partial remissions (CR or PR) with
normalization of blood counts have been achieved (following various treatments) in 13 out of
the 18 patients. These patients were chosen for MRD monitoring. The remaining 5 of the 18
patients did not achieve CR or PR, so that MRD monitoring was considered useless (all these
patients eventually died). Using our RQ-PCR assay with patient-specific primers, we were
able to demonstrate MRD in each of the 13 patients followed up for MRD. Some clinically
interesting findings were noted. In 3/3 patients in CR after allogeneic "mini"-HSCT, MRD
36
was detected (days 43 to 1156 post-transplant). Despite this fact, they still remain in CR
(patient No. 2 even in molecular remission). In 4 out of 4 patients after auto-HSCT performed
393 to 551 days before starting the molecular follow-up, MRD persisted. Each of the 4
patients later relapsed (1 of whom died). Figure 5 depicts some typical shapes of IgVH
quantitation curves during the follow-up. More intensive treatments, such as FC or FCR (see
Table 1) in patients, who had not been heavily pretreated, produced relatively rapid declines
in MRD (Figures 5a and 5b), with a molecular remission in one case. On the other hand,
monotherapy with fludarabine or rituximab produced only mild decrease in MRD quantity
(Figure 5c). Figure 5d represents the typical situation in post-auto-HSCT patients: an ongoing
increase in MRD heralded a clinical relapse. Another important point is that negativity in our
sensitive RQ-PCR assay (10-6 as shown in Figure 5a) did not preclude the risk of an eventual
relapse. Figure 5b records the course of MRD that may be typical for allogeneic "mini"-HSCT
performed after a short but intensive pretreatment: the initial decrease in the relative IgVH
expression followed by MRD (irrespective of the 100% engraftment according to the
chimerism studies), which disappeared only after immunosuppression with cyclosporin A was
stopped.
Figure 5
37
Time-course follow-up of MRD detected using RQ-PCR with patient-specific primers and
SG. (a): Achievement of molecular remission in patient No. 4 following FC and FCR
chemotherapy, and a subsequent molecular relapse. (b): Decreases in the relative IgVH
expression following FC chemotherapy and allogeneic "mini"-transplant in patient No. 2.
Molecular
remission
was
achieved
only
after
discontinuing
cyclosporine
A
immunosuppression. (c): Relatively small decreases in the relative IgVH expression in patient
No. 1 following monotherapy with fludarabin, and later, after a severe hepatitis, decrease in
MRD following rituximab treatment. (d): Increase in the relative IgVH expression preceding
an overt relapse in a post-auto-HSCT patient No. 3.
Discussion
38
In the present study, we deal with the technical aspects concerning detection of IgVH gene
mutational status in CLL at diagnosis. Moreover, we introduce here a highly specific,
sensitive, widely applicable and economical RQ-PCR method as an alternative for
hybridization probes-based MRD detection in CLL.
We have studied the hypermutational pattern of IgVH genes in 257 CLL patients. When
screening for the predominant IgVH expression at the time of diagnosis, the primers used for
the detection of the 7 IgVH families were to some extent degenerate.[32] The usage of
degenerate primers has one major advantage: although the primer site was variable, we were
able to amplify the majority of IgVH fragments. To boost the successful amplification of IgVH
families even more, we have employed the touch-down RT-PCR technique. This approach
allowed amplification of target sequences even in cases of low primer complementarity,
which might have been otherwise critical to a standard PCR. Moreover, when working with
cDNA instead of DNA, the chance of a successfull clonal detection is even more pronounced,
since the amount of IgVH mRNAs in a B-cell is abundant. As a rule of thumb, IgVH family
detection at genomic level is not so powerful; the number of successfully detected clones does
not exceed 90%.[20] In contrast, in our hands, using RT-PCR technique we were able to detect
clonal IgVH rearrangement in 98.1% of the patients tested. From these reasons, we strongly
recommend detection of IgVH genes at cDNA level, by employing the RT-PCR method.
Moreover, we would like to stress that for MRD detection in CLL, which is even more
demanding than screening for the expression of IgVH family at the time of CLL diagnosis, the
RT-PCR technique seems to be the methodology of choice.
39
Nevertheless, it might happen that even RT-PCR fails to amplify any specific IgVH product:
Five out of our 257 patients showed a polyclonal healthy donor-like pattern without any
preponderant PCR product. The explanation for this phenomenon might be that (i) the disease
was just at its beginning (or perhaps it was prevalently lymphomatous[35]), (ii) the patient
responded successively to chemotherapy and thus the clonal band was indistinguishable, or
(iii) the particular IgVH gene priming site had suboptimal primer complementarity. All of the
above mentioned pitfalls might have prevented effective PCR reaction from occurring.
In accord with other groups,[13,37] we came across several intriguing points. The first apparent
feature of CLL cells was the uneven usage of IgVH subfamilies. It seemed to be not random
that some IgVH subfamilies were found in CLL more often than others. Interestingly, some
IgVH families even showed a propensity to either mutated or unmutated IgVH status. Using
microarray technology, Klein et al.[38] showed that the expression profile of a CLL cell
resembles very closely the expression profile of a memory B cell. In the light of Klein’s data,
it is tempting to hypothesize that it might have been some inherent defect to the CLL cell that
allows it to traverse the germinal center without losing its naive IgVH gene configuration.
Another interesting point was the relatively high occurrence (10.7% of cases) of CLLs with
two detectable IgVH families. It is believed that biallelic CLLs emerge due to the lack of
allelic exclusion during the B-cell development.[39] Nevertheless, it cannot be ruled out that
some of the biallelic CLLs represent a truly biclonal disease. Further study is warranted to
clarify this issue.
To our knowledge, available data on MRD detection in CLL refer to either qualitative
analysis only (earlier papers[19,40]) or quantitative analysis using gene-specific hybridization
probes, which require absolute sequence complementarity (recent publications[24,25]). There
40
are reports on employing flow cytometry in CLL MRD detection as well, but this approach
may not allow to reach the sensitivity and specificity needed.[29,41] Since the sequence
variability of IgVH genes in CLL might be extremely vast, we find designing hybridization
probes for MRD detection by RQ-PCR in each individual patient with CLL cost consuming,
little versatile and hence ineffective. These obstacles inspired us to address MRD detection in
CLL in more economical and applicable way. Our assay is based on the fluorescent dye SG,
which is distinguished by its dsDNA binding activity. SG intercalates into any doublestranded DNA independently of the nucleotide sequence of the target molecule. This
promiscuous activity of SG gives ease to the RQ-PCR MRD detection in CLL, since this
feature allows the methodology to be applied on each CLL patient, irrespective of the
nucleotide sequence of their IgVH genes. However, it should be borne in mind that a PCR
reaction without non-specific products is essential, as SG tends to intercalate into any dsDNA
it encounters (primer dimers, non-specific products). These unwanted products are
responsible for false increase in the measured fluorescence. However, by careful primer
design and Mg2+ concentration optimization, this requirement is easy to meet.
In an RQ-PCR, there may be a great variability in the commencement of an effective PCR
amplification caused by priming hindrance, when degenerate, instead of the patient-specific
primers are used. Nevertheless, this serious obstacle in quantitative PCR technology is rather
easy to overcome. Based on sequence analysis of the particular patient’s IgVH gene, we have
designed patient-specific forward and reverse primers. The priming sites were preferably
situated within the hypermutation hot spots and/or those regions of the particular IgVH gene,
which were sequentially unique and could serve as the patient’s “fingerprint”. Using these
sets of primers, the PCR reaction turned to be very specific and sensitive (the sensitivity being
41
10-6), able to capture the specific product on a background of many other subfamilies of an
IgVH family.
Various investigators use different graphical outputs of RQ-PCR quantitation,[25,26,28] but
generally, they relate the exact copy number of the gene of interest (GOI) to the exact copy
number of a housekeeping gene (HG). As the ratio of the exact copy number of GOI and HG
is a figure without any unit of measurement, we did not bother with calculations of exact copy
numbers of plasmids used for calibrations of our RQ-PCR assays. Instead, we used
nanograms down to picograms of plasmids to calibrate the assay. This approach is not only
more practical, but it is very precise as well, as the concentration of each of the constructs was
measured spectrophotometricaly.
In our study, we used the so-called “relative IgVH expression”, showing the ratio of Ct IgVH
and the housekeeping abl gene. There is a common consent that quantifying the amount of
GOI without quantitation of HG might be misleading. Moreover, when detecting IgV H
transcript at cDNA level, there is no clear relationship between transcript copy number and
the cell number. Thus, we suggest that it is the dynamics of the quantitatively detected MRD
level (the trend of MRD) that might provide the clinician with relevant information.
From the clinical point of view, our study using a highly sensitive test for MRD detection has
revealed several interesting observations: 1. Following auto-HSCT, MRD could be
consistently demonstrated in each patient (in spite of being considered "negative" in another
laboratory, which employed the same primers for IgVH family identification at diagnosis as
well as for MRD detection). All these 4 patients had an unmutated IgVH gene status, and have
already relapsed – similar to the observations of Ritgen et al.[23] 2. MRD apparent after the
nonmyeloablative allo-HSCT[36] in one CLL patient disappeared only after cessation of
42
immunosuppression. 3. The combination of fludarabine-cyclophosphamide-rituximab may
induce a molecular remission even at a high sensitivity MRD detection level. 4. Increments in
the relative IgVH expression may herald clinical relapse.
Due to the rapid development of molecular biology, we have all the tools necessary for MRD
detection and quantitation in CLL. However, the clinical impact of the precise estimation of
MRD is yet to be established in larger studies. We believe, anyway, that in the future, precise
MRD detection and quantitative evaluation in CLL patients will lead to tailored treatment[5] of
the disease.
References
1.
Rai KR, Sawitsky A, Jagathambal K, Gartenhaus W, Phillips E. Chronic lymphocytic
leukemia. Med Clin North Am 1984; 68:697-711.
2.
Dighiero G, Travade P, Chevret S, Fenaux P, Chastang C, Binet J-L. B-cell chronic
lymphocytic leukemia: present status and future directions. Blood 1991; 78:1901-1914.
3.
Molica S, De Rossi G, Luciani M, Levato D. Prognostic features and therapeutical
approaches in B-cell chronic lymphocytic leukemia: an update. Haematologica 1995; 80:176193.
4.
Byrd JC, Waselenko JK, Keating M, Rai K, Grever MR. Novel therapies for chronic
lymphocytic leukemia in the 21st century. Semin Oncol 2000; 27:587-597.
5.
Hossfeld DK. Chronic lymphocytic leukaemia: risk-adapted therapy. Ann Oncol 2000;
11:197-198.
6.
Dreger P, Montserrat E. Autologous and allogeneic stem cell transplantation for
chronic lymphocytic leukemia. Leukemia 2002; 16:985-992.
43
7.
Rizouli V, Gribben Jg J. The role of stem cell transplantation in chronic lymphocytic
leukemia. Semin Hematol 2004; 41: 246-253.
8.
Ferrarini M, Chiorazzi N. Recent advances in the molecular biology and
immunobiology of chronic lymphocytic leukemia. Semin Hematol 2004; 41:207-223.
9.
Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical
staging of chronic lymphocytic leukemia. Blood 1975; 46:219-234.
10.
Binet J-L, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, et al. A new
prognostic classification of chronic lymphocytic leukemia derived from a multivariate
survival analysis. Cancer 1981; 48:198-206.
11.
Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, et al.
Genomic aberrations and survival in chronic lymphocytic leukemia. New Engl J Med 2000;
343:1910-1906.
12.
Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, et al. Ig V gene mutation
status and CD38 expression As novel prognostic indicators in chronic lymphocytic leukemia.
Blood 1999; 94:1840-1847.
13.
Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig VH genes
are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999;
94:1848-1854.
14.
Ritgen M, Stilgenbauer S, Von Neuhoff N, Humpe A, Bruggemann M, Pott C et al.
Graft-versus-leukemia activity may overcome therapeutic resistance of chronic lymphocytic
leukemia with unmutated immunoglobulin variable heavy chain gene status: implication of
minimal residual disease measurement with quantitative PCR. Blood 2004; Epub ahead of
print.
15.
Rai KR, Döhner H, Keating MJ, Montserrat E. Chronic lymphocytic leukemia: case-
based session. Hematology (Am Soc Hematol Educ Program) 2001:140-156.
44
16.
Stilgenbauer S, Bullinger L, Lichter P, Döhner H, the German CLL Study Group
(GCLLSG). Genetics of chronic lymphocytic leukemia: genomic aberrations and VH gene
mutation status in pathogenesis and clinical course. Leukemia 2002; 16:993-1007.
17.
Kröber A, Seiler T, Benner A, Bullinger L, Brückle E, Lichter P, et al. VH mutation
status, CD38 expression level, genomic aberrations, and survival in chronic lymphocytic
leukemia. Blood 2002; 100:1410-1416.
18.
Brisco MJ, Tan LW, Orsborn AM, Morley AA. Development of a highly sensitive
assay, based on the polymerase chain reaction, for rare B-lymphocyte clones in a polyclonal
population. Br J Haematol 1990; 75:163-167.
19.
Voena C, Ladetto M, Astolfi M, Provan D, Gribben JG, Boccadoro M, et al. A novel
nested-PCR strategy for the detection of rearranged immunoglobulin heavy-chain genes in B
cell tumors. Leukemia 1997; 11:1793-1798.
20.
Diss TC, Peng H, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality
in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer
selection and lymphoma type. J Pathol 1993; 169:291-295.
21.
Rozman C, Montserrat E. Chronic lymphocytic leukemia. New Engl J Med 1995;
333:1052-1057.
22.
Bruggemann M, Pott C, Ritgen M. Kneba M. Acta Haematol 2004; 112:111-119.
23.
Ritgen M, Lange A, Stilgenbauer S, Döhner H, Bretscher C, Bosse H, et al.
Unmutated immunoglobulin variable heavy-chain gene status remains an adverse prognostic
factor after autologous stem cell transplantation for chronic lymphocytic leukemia. Blood
2003; 101:2049-2053.
24.
Pfitzner T, Engert A, Wittor H, Schinköthe T, Oberhäuser F, Schulz H, et al. A real-
time PCR assay for the quantification of residual malignant cells in B cell chronic lymphatic
leukemia. Leukemia 2000; 14:754-766.
45
25.
Pfitzner T, Reiser M, Barth S, Borchmann P, Schulz H, Schinköthe T, et al.
Quantitative molecular monitoring of residual tumor cells in chronic lymphocytic leukemia.
Ann Hematol 2002; 81:258-266.
26.
Barragan E, Bolufer P, Moreno I, Martin G, Nomdedeu J, Brunet S, et al. Quantitative
detection of AML1-ETO rearrangement by real-time RT-PCR using fluorescently labeled
probes. Leuk Lymphoma 2001; 42:747-756.
27.
Cassinat B, Zassadowski F, Balitrand N, Barbey C, Rain JD, Fenaux P, et al.
Quantitation of minimal residual disease in acute promyelocytic leukemia patients with
t(15;17) translocation using real-time RT-PCR. Leukemia 2000; 14:324-328.
28.
Marcucci G, Caligiuri MA, Dohner H, Archer KJ, Schlenk RF, Dohner K, et al.
Quantification of CBF/MYH11 fusion transcript by real time RT-PCR in patients with
INV(16) acute myeloid leukemia. Leukemia 2001; 15:1072-1080.
29.
Noy A, Verma R, Glenn M, Maslak P, Rahman ZU, Keenan JR, et al. Clonotypic
polymerase chain reaction confirms minimal residual disease in CLL nodular PR: results from
a sequential treatment CLL protocol. Blood 2001; 97:1929-1936.
30.
Rawstron AC, Green MJ, Kuzmicki A, Kennedy B, Fenton JA, Evans PA, et al.
Monoclonal B lymphocytes with the characteristics of "indolent" chronic lymphocytic
leukemia are present in 3.5% of adults with normal blood counts. Blood 2002; 100:635-639.
31.
Cheson BD, Bennett JM, Grever M, Kay N, Keating MJ, O'Brien S, et al. National
Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia:
revised guidelines for diagnosis and treatment. Blood 1996; 87:4990-4997.
32.
Souto-Carneiro MM, Krenn V, Hermann R, Konig A, Muller-Hermelink HK. IgVH
genes from different anatomical regions, with different histopathological patterns, of a
rheumatoid arthritis patient suggest cyclic re-entry of mature synovial B-cells in the
hypermutation process. Arthritis Res 2000; 2:303-314.
46
33.
Sambrook J, Fritsh EF, Maniatis T. Molecular Cloning. A Laboratory Manual, 2nd
Edn. Cold Spring Harbor, New York 1989.
34.
http://www.ncbi.nlm.nih.gov/igblast/.
35.
Jaksic O, Vrhovac R, Kusec R, Kardum MM, Pandzic-Jaksic V, Kardum-Skelin I, et
al. Clinical tumor cell distribution pattern is a prognostically relevant parameter in patients
with B-cell chronic lymphocytic leukemia. Haematologica 2001; 86:827-836.
36.
Slavin S, Nagler A, Naparstek E, Kapelushnik Y, Aker M, Cividalli G, et al.
Nonmyeloablative stem cell transplantation and cell therapy as an alternative to conventional
bone marrow transplantation with lethal cytoreduction for the treatment of malignant and
nonmalignant hematologic diseases. Blood 1998; 91:756-763.
37.
Fais F, Ghiotto F, Hashimoto S, Sellars B, Valetto A, Allen SL, et al. Chronic
lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen
receptors. J Clin Invest 1998; 102:1515-1525.
38.
Klein U, Tu Y, Stolovitzky GA, Mattioli M, Cattoretti G, Husson H, et al. Gene
expression profiling of B cell chronic lymphocytic leukemia reveals a homogeneous
phenotype related to memory B cells. J Exp Med 2001; 194:1625-1638.
39.
Rassenti LZ, Kipps TJ. Lack of allelic exclusion in B cell chronic lymphocytic
leukemia. J Exp Med 1997; 185:1435-1445.
40.
Magnac C, Sutton L, Cazin B, Laurent C, Binet J-L, Merle-Béral H, et al. Detection of
minimal residual disease in B chronic lymphocytic leukemia (CLL). Hematol Cell Ther 1999;
41:13-18.
41.
Cabezudo E, Matutes E, Ramrattan M, Morilla R, Catovsky D. Analysis of residual
disease in chronic lymphocytic leukemia by flow cytometry. Leukemia 1997; 11:1909-1914.
47
3. Conclusion
The thesis contains four publications. The results described here in the most detail deal with
the project aimed at the detection of hypermutation status of IgVH genes in chronic
lymphocytic leukemia and molecular monitoring of minimal residual disease.
The methodology presented here has been successfully launched into a routine clinical
practice and to our greatest pleasure the number of CLL patients investigated using our
methods is still growing.
4. References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Zwiebel, J.A. and B.D. Cheson, Chronic lymphocytic leukemia: staging and
prognostic factors. Semin Oncol, 1998. 25(1): p. 42-59.
Rai, K.R. and N. Chiorazzi, Determining the clinical course and outcome in chronic
lymphocytic leukemia. N Engl J Med, 2003. 348(18): p. 1797-9.
Hamblin, T.J., et al., Unmutated Ig V(H) genes are associated with a more aggressive
form of chronic lymphocytic leukemia. Blood, 1999. 94(6): p. 1848-54.
Montserrat, E., Prognosis in chronic lymphocytic leukemia: let's have a look!
Haematologica, 2002. 87(6): p. 561-2.
Rai, K.R., Chronic lymphocytic leukaemia. Current strategy and new perspectives of
treatment. Haematologica, 1999. 84 Suppl EHA-4: p. 94-5.
Montserrat, E., F. Bosch, and C. Rozman, Treatment of B-cell chronic lymphocytic
leukaemia: current status and future perspectives. J Intern Med Suppl, 1997. 740: p.
63-7.
Dighiero, G., [Chronic lymphoid leukemia: a single disease or 2 distinct diseases?].
Bull Acad Natl Med, 2002. 186(7): p. 1251-66; discussion 1266-8.
Byrd, J.C., S. Stilgenbauer, and I.W. Flinn, Chronic lymphocytic leukemia.
Hematology (Am Soc Hematol Educ Program), 2004: p. 163-83.
Byrd, J.C., et al., Novel therapies for chronic lymphocytic leukemia in the 21st
century. Semin Oncol, 2000. 27(5): p. 587-97.
Stilgenbauer, S., et al., Genetics of chronic lymphocytic leukemia: genomic
aberrations and V(H) gene mutation status in pathogenesis and clinical course.
Leukemia, 2002. 16(6): p. 993-1007.
Binet, J.L., et al., A new prognostic classification of chronic lymphocytic leukemia
derived from a multivariate survival analysis. Cancer, 1981. 48(1): p. 198-206.
Rai, K.R., et al., Clinical staging and prognostic markers in chronic lymphocytic
leukemia. Hematol Oncol Clin North Am, 2004. 18(4): p. 795-805, vii.
Catovsky, D., The search for genetic clues in chronic lymphocytic leukemia. Hematol
Cell Ther, 1997. 39 Suppl 1: p. S5-11.
48
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
Krober, A., et al., V(H) mutation status, CD38 expression level, genomic aberrations,
and survival in chronic lymphocytic leukemia. Blood, 2002. 100(4): p. 1410-6.
Montserrat, E., et al., Lymphocyte doubling time in chronic lymphocytic leukaemia:
analysis of its prognostic significance. Br J Haematol, 1986. 62(3): p. 567-75.
Rozman, C., et al., Bone marrow histologic pattern--the best single prognostic
parameter in chronic lymphocytic leukemia: a multivariate survival analysis of 329
cases. Blood, 1984. 64(3): p. 642-8.
Hallek, M., et al., Serum beta(2)-microglobulin and serum thymidine kinase are
independent predictors of progression-free survival in chronic lymphocytic leukemia
and immunocytoma. Leuk Lymphoma, 1996. 22(5-6): p. 439-47.
Damle, R.N., et al., Ig V gene mutation status and CD38 expression as novel
prognostic indicators in chronic lymphocytic leukemia. Blood, 1999. 94(6): p. 1840-7.
Dohner, H., et al., Genomic aberrations and survival in chronic lymphocytic leukemia.
N Engl J Med, 2000. 343(26): p. 1910-6.
Oscier, D.G., et al., Multivariate analysis of prognostic factors in CLL: clinical stage,
IGVH gene mutational status, and loss or mutation of the p53 gene are independent
prognostic factors. Blood, 2002. 100(4): p. 1177-84.
Lin, K., et al., Relationship between p53 dysfunction, CD38 expression, and IgV(H)
mutation in chronic lymphocytic leukemia. Blood, 2002. 100(4): p. 1404-9.
Crespo, M., et al., ZAP-70 expression as a surrogate for immunoglobulin-variableregion mutations in chronic lymphocytic leukemia. N Engl J Med, 2003. 348(18): p.
1764-75.
Orchard, J.A., et al., ZAP-70 expression and prognosis in chronic lymphocytic
leukaemia. Lancet, 2004. 363(9403): p. 105-11.
Dewald, G.W., et al., Chromosome anomalies detected by interphase fluorescence in
situ hybridization: correlation with significant biological features of B-cell chronic
lymphocytic leukaemia. Br J Haematol, 2003. 121(2): p. 287-95.
Vasconcelos, Y., et al., Binet's staging system and VH genes are independent but
complementary prognostic indicators in chronic lymphocytic leukemia. J Clin Oncol,
2003. 21(21): p. 3928-32.
Klein, U., et al., Gene expression profiling of B cell chronic lymphocytic leukemia
reveals a homogeneous phenotype related to memory B cells. J Exp Med, 2001.
194(11): p. 1625-38.
Rosenwald, A., et al., Relation of gene expression phenotype to immunoglobulin
mutation genotype in B cell chronic lymphocytic leukemia. J Exp Med, 2001. 194(11):
p. 1639-47.
Tobin, G., et al., V(H)3-21 gene usage in chronic lymphocytic leukemia-characterization of a new subgroup with distinct molecular features and poor
survival. Leuk Lymphoma, 2004. 45(2): p. 221-8.
Tobin, G., et al., Chronic lymphocytic leukemias utilizing the VH3-21 gene display
highly restricted Vlambda2-14 gene use and homologous CDR3s: implicating
recognition of a common antigen epitope. Blood, 2003. 101(12): p. 4952-7.
Tobin, G., et al., Somatically mutated Ig V(H)3-21 genes characterize a new subset of
chronic lymphocytic leukemia. Blood, 2002. 99(6): p. 2262-4.
Hamblin, T.J., et al., CD38 expression and immunoglobulin variable region mutations
are independent prognostic variables in chronic lymphocytic leukemia, but CD38
expression may vary during the course of the disease. Blood, 2002. 99(3): p. 1023-9.
Ghia, P., et al., The pattern of CD38 expression defines a distinct subset of chronic
lymphocytic leukemia (CLL) patients at risk of disease progression. Blood, 2003.
101(4): p. 1262-9.
49
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Dohner, H., et al., p53 gene deletion predicts for poor survival and non-response to
therapy with purine analogs in chronic B-cell leukemias. Blood, 1995. 85(6): p. 15809.
Geisler, C.H., et al., In B-cell chronic lymphocytic leukaemia chromosome 17
abnormalities and not trisomy 12 are the single most important cytogenetic
abnormalities for the prognosis: a cytogenetic and immunophenotypic study of 480
unselected newly diagnosed patients. Leuk Res, 1997. 21(11-12): p. 1011-23.
Byrd, J.C., et al., Interphase cytogenetic abnormalities in chronic lymphocytic
leukemia may predict response to rituximab. Cancer Res, 2003. 63(1): p. 36-8.
Stilgenbauer, S. and H. Dohner, Campath-1H-induced complete remission of chronic
lymphocytic leukemia despite p53 gene mutation and resistance to chemotherapy. N
Engl J Med, 2002. 347(6): p. 452-3.
Lozanski, G., et al., Alemtuzumab is an effective therapy for chronic lymphocytic
leukemia with p53 mutations and deletions. Blood, 2004. 103(9): p. 3278-81.
Rawstron, A.C., et al., Early prediction of outcome and response to alemtuzumab
therapy in chronic lymphocytic leukemia. Blood, 2004. 103(6): p. 2027-31.
Schwaenen, C., et al., Automated array-based genomic profiling in chronic
lymphocytic leukemia: development of a clinical tool and discovery of recurrent
genomic alterations. Proc Natl Acad Sci U S A, 2004. 101(4): p. 1039-44.
Rosenwald, A., DNA microarrays in lymphoid malignancies. Oncology (Huntingt),
2003. 17(12): p. 1743-8; discussion 1750, 1755, 1758-9 passim.
Haslinger, C., et al., Microarray gene expression profiling of B-cell chronic
lymphocytic leukemia subgroups defined by genomic aberrations and VH mutation
status. J Clin Oncol, 2004. 22(19): p. 3937-49.
Calin, G.A., et al., Human microRNA genes are frequently located at fragile sites and
genomic regions involved in cancers. Proc Natl Acad Sci U S A, 2004. 101(9): p.
2999-3004.
Calin, G.A., et al., MicroRNA profiling reveals distinct signatures in B cell chronic
lymphocytic leukemias. Proc Natl Acad Sci U S A, 2004. 101(32): p. 11755-60.
Dreger, P. and E. Montserrat, Autologous and allogeneic stem cell transplantation for
chronic lymphocytic leukemia. Leukemia, 2002. 16(6): p. 985-92.
Ritgen, M., et al., Unmutated immunoglobulin variable heavy-chain gene status
remains an adverse prognostic factor after autologous stem cell transplantation for
chronic lymphocytic leukemia. Blood, 2003. 101(5): p. 2049-53.
Ritgen, M., et al., Graft-versus-leukemia activity may overcome therapeutic resistance
of chronic lymphocytic leukemia with unmutated immunoglobulin variable heavychain gene status: implications of minimal residual disease measurement with
quantitative PCR. Blood, 2004. 104(8): p. 2600-2.
Schetelig, J., et al., Evidence of a graft-versus-leukemia effect in chronic lymphocytic
leukemia after reduced-intensity conditioning and allogeneic stem-cell
transplantation: the Cooperative German Transplant Study Group. J Clin Oncol,
2003. 21(14): p. 2747-53.
Pfitzner, T., et al., Quantitative molecular monitoring of residual tumor cells in
chronic lymphocytic leukemia. Ann Hematol, 2002. 81(5): p. 258-66.
Rawstron, A.C., et al., Quantitation of minimal disease levels in chronic lymphocytic
leukemia using a sensitive flow cytometric assay improves the prediction of outcome
and can be used to optimize therapy. Blood, 2001. 98(1): p. 29-35.
Milligan, D.W., et al., Results of the MRC pilot study show autografting for younger
patients with chronic lymphocytic leukemia is safe and achieves a high percentage of
molecular responses. Blood, 2005. 105(1): p. 397-404.
50
51.
Bottcher, S., et al., Comparative analysis of minimal residual disease detection using
four-color flow cytometry, consensus IgH-PCR, and quantitative IgH PCR in CLL
after allogeneic and autologous stem cell transplantation. Leukemia, 2004. 18(10): p.
1637-45.
5. List of author’s publications
Schwarz J., Peková S., Protivánková M., Žák P., Haškovec C., Michalová K.: FLT3 gene
internal tandem duplications in APL: correlation with leukocytosis and outcome. Joint
International Congress on APL and Differentiation Therapy, Abstr. P2.4, p. 30, Rome 2001
Peková S., Dvořák M,. Schwarz J.: FLT3/ITD in patients with acute myeloid leukemia
(Abstr.). 7th International Union of Biochemistry and Molecular Biology Conference:
Receptor-Ligand Interactions, Bergen 2002
Schwarz J., Peková S., Čermák J., Michalová K., Marková J., Cetkovský P.: Prognosis in
AML and APL: the role of FLT3 gene internal tandem duplications (ITDs) and other
prognostic markers. Leukemia 2002 – Towards the Cure, Abstr. 1.8, p. 77, Miami 2002
Schwarz J., Peková S., Čermák J., Vítek A., Klamová H., Šponerová D., Sala P., Michalová
K., Marková J., Sajdová J., Haškovec C., Cetkovský P.: Prognosis in AML and APL: The
role of internal tandem duplications (ITD´s) of the FLT3 gene and of other prognostic
markers. [In Czech.] The XIIIth Czech and Slovak Hematological and Transfusiological
Congress, Abstr. O/11, Prague 2002
Haškovec C., Polák J., Hradcová M., Peková S., Stöckbauer P., Schwarz J., Kozák T.:
Expression of cyclins D1 and P21 CIP in leukemic patients. [In Czech.] The XIIIth Czech
and Slovak Hematological and Transfusiological Congress, Abstr. O/14, Prague 2002
Peková S., Starostka D., Marková J., Pajer P., Dvořák M., Schwarz J.: Analysis of the
mutational status of IgVH genes in patients with CLL. [In Czech.] The XIIIth Czech and
Slovak Hematological and Transfusiological Congress, Abstr. P/37, Prague 2002
Peková S., Marková J., Schwarz J.: FLT3/ITD in patients with acute myeloid
leukemiaFLT3/ITD. [In Czech.] VIIth day on acute leukemias, MEFA Congress, Abstr. p.
25, Brno 2002
Schwarz J., Trnková Z., Peková S., Marková J., Čermák J., Cetkovský P.: FLT3/ITD and the
expression of the MDR1 gene and of the Pgp protein in AML. VIIth day on acute
leukemias, MEFA Congress, Abstr. p. 26, Brno 2002
Polák J., Peková S., Schwarz J., Kozák T., Haškovec C.: Expression of inhibitors of cyclindependent kinases in leukemia. [In Czech.] Čas. Lék. Čes. 142, (1), 25-28, 2003
Trnková Z., Peková S., Bedrlíková R., Žáková D., Zemanová Z., Polák J., Michalová K.,
Čermák J., Schwarz J.: Type J CBFβ/MYH11 transcript in the M4Eo subtype of acute
myeloid leukemia. Hematology, 2003 Apr;8(2):115-7
Schwarz J., Marková J., Peková S., Trnková Z., Šponerová D., Cetkovský P.: A single
administration of gemtuzumab ozogamicin for molecular relapse of acute promyelocytic
leukemia. Hematol J, 2004; 5(3):279-80
51
Šindelářová L., Michalová K., Zemanová Z., Ransdorfová S., Březinová J., Peková S.,
Schwarz J., Karban J., Cmunt E.: Incidence of chromosomal anomalies detected with FISH
and their clinical correlations in B-chronic lymphocytic leukemia. Cancer Genet
Cytogenet, 2005 Jul 1; 160(1):27-34
Peková S., Marková J., Pajer P., Dvořák M., Cetkovský P., Schwarz J.: Touch-down RT-PCR
detection of IgVH rearrangement and Sybr-Green-based real-time RT-PCR quantitation of
minimal residual disease in patients with chronic lymphocytic leukemia. Mol Diagn.
2005;9(1):23-34.
52