Download CRISPR/Cas9 Screens Reveal Requirements for Host Cell Sulfation

Article
CRISPR/Cas9 Screens Reveal Requirements for Host
Cell Sulfation and Fucosylation in Bacterial Type III
Secretion System-Mediated Cytotoxicity
Graphical Abstract
Authors
Carlos J. Blondel, Joseph S. Park,
Troy P. Hubbard, ...,
Benjamin E. Gewurz, John G. Doench,
Matthew K. Waldor
Correspondence
[email protected]
In Brief
Type III secretion systems (T3SSs)
underlie the virulence of many bacterial
pathogens, but the required host factors
remain largely undefined. Blondel et al.
harness CRISPR/Cas9 technology to
perform genome-wide screens and
identify requirements for host cell
sulfation and fucosylation in conferring
susceptibility to T3SS-mediated killing by
Vibrio parahaemolyticus.
Highlights
d
Genome-wide CRISPR screens reveal host factors facilitating
T3SS cytotoxicity
d
Distinct host pathways confer susceptibility to
V. parahaemolyticus’s T3SS1 and T3SS2
d
Sulfation promotes bacterial adhesion and downstream
T3SS1-associated cytotoxicity
d
Fucosylated glycans promote insertion of the T3SS2
translocon into host membranes
Blondel et al., 2016, Cell Host & Microbe 20, 226–237
August 10, 2016 ª 2016 Elsevier Inc.
http://dx.doi.org/10.1016/j.chom.2016.06.010
Cell Host & Microbe
Article
CRISPR/Cas9 Screens Reveal Requirements for Host
Cell Sulfation and Fucosylation in Bacterial
Type III Secretion System-Mediated Cytotoxicity
Carlos J. Blondel,1,2 Joseph S. Park,1,2,3,4 Troy P. Hubbard,1,2 Alline R. Pacheco,1,2 Carole J. Kuehl,1,2 Michael J. Walsh,1,2
Brigid M. Davis,1,2 Benjamin E. Gewurz,1,2 John G. Doench,5 and Matthew K. Waldor1,2,3,*
1Division
of Infectious Diseases, Brigham and Women’s Hospital, Boston, MA 02115, USA
of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115, USA
3Howard Hughes Medical Institute, Boston, MA 02115, USA
4Boston University School of Medicine, Boston, MA 02118, USA
5Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA
*Correspondence: [email protected]
http://dx.doi.org/10.1016/j.chom.2016.06.010
2Department
SUMMARY
Type III secretion systems (T3SSs) inject bacterial
effector proteins into host cells and underlie the
virulence of many gram-negative pathogens. Studies
have illuminated bacterial factors required for
T3SS function, but the required host processes
remain largely undefined. We coupled CRISPR/Cas9
genome editing technology with the cytotoxicity of
two Vibrio parahaemolyticus T3SSs (T3SS1 and
T3SS2) to identify human genome disruptions conferring resistance to T3SS-dependent cytotoxicity. We
identity non-overlapping genes required for T3SS1and T3SS2-mediated cytotoxicity. Genetic ablation
of cell surface sulfation reduces bacterial adhesion
and thereby alters the kinetics of T3SS1-mediated
cytotoxicity. Cell surface fucosylation is required
for T3SS2-dependent killing, and genetic inhibition
of fucosylation prevents membrane insertion of
the T3SS2 translocon complex. These findings
reveal the importance of ubiquitous surface modifications for T3SS function, potentially explaining the
broad tropism of V. parahaemolyticus, and highlight
the utility of genome-wide CRISPR/Cas9 screens
to discover processes underlying host-pathogen
interactions.
INTRODUCTION
The virulence of many human, animal, and plant pathogens depends on type III secretion systems (T3SSs). These multicomponent nanomachines enable gram-negative pathogens to inject a
repertoire of effector proteins directly into the cytosol of eukaryotic host cells (reviewed in Portaliou et al., 2016). T3SSs are
composed of a basal body found within the pathogen cell envelope, a needle that extends from the bacterial surface to the host
cell, and a tip complex that creates a pore in the host cell membrane. This pore, termed the translocon, consists of several bac-
terial proteins that form a conduit through which effectors are
translocated into the host cytoplasm. T3SSs from different
pathogens transfer distinct sets of effectors that can enable
pathogen adhesion, internalization, or modulation of diverse
host processes, often redundantly (Shames and Finlay, 2012).
The Gram-negative marine bacterium Vibrio parahaemolyticus
is a leading cause worldwide of gastroenteritis linked to the
consumption of contaminated seafood and is a cause of major
economic losses for the aquaculture industry (reviewed in
Letchumanan et al., 2014). All V. parahaemolyticus strains
harbor genes encoding a T3SS on their large chromosome,
T3SS1. Nearly all clinical isolates produce a second, evolutionarily distinct T3SS, T3SS2 (Abby and Rocha, 2012; Hazen
et al., 2015), which is encoded within a pathogenicity island on
the small chromosome (Park et al., 2004; Sugiyama et al., 2008).
The two V. parahaemolyticus T3SSs are functionally independent, and each translocates its own set of effector proteins (Park
et al., 2004). Although T3SS1 activity causes marked cytotoxicity
in a variety of cultured human cell lines, studies with animal
models suggested that this secretion system plays at most a
minor role in the pathogenesis of V. parahaemolyticus enteritis
(Piñeyro et al., 2010; Ritchie et al., 2012). The universality of
T3SS1 among V. parahaemolyticus isolates, and the absence
of a virulence defect in T3SS1 mutants in orogastric animal
models suggests that this secretion system may contribute to
environmental fitness, perhaps through targeting of predatory
marine eukaryotes. In contrast, studies in animal models demonstrate that T3SS2 is essential for V. parahaemolyticus to colonize
the intestine and to cause enteritis (Piñeyro et al., 2010; Ritchie
et al., 2012). T3SS2 also has cytotoxic activity against predatory
protists and thus may promote V. parahaemolyticus survival in
the environment (Matz et al., 2011).
Decades of research have led to deep knowledge of T3SS
structure, assembly, and function, as well as of the biochemical
activities and eukaryotic targets of individual effector proteins
(Dean, 2011; Galán et al., 2014). However, our understanding
of host factors that enable the targeting of T3SSs to host cells
is more rudimentary. To date, most attempts to identify such factors have relied on focused biochemical approaches (e.g., Lafont
et al., 2002). Only two genetic screens—employing either small
interfering RNA or haploid cell technology—have been carried
226 Cell Host & Microbe 20, 226–237, August 10, 2016 ª 2016 Elsevier Inc.
(legend on next page)
Cell Host & Microbe 20, 226–237, August 10, 2016 227
out to find host factors important for T3SS function (Russo et al.,
2016; Sheahan and Isberg, 2015).
The development of CRISPR/Cas9 technology, which allows
generation of complete loss-of-function alleles in a variety of
cell types, is transforming functional genetic analyses in higher
eukaryotes (Shalem et al., 2014; Shi et al., 2015; Wang et al.,
2014; Douda and Charpentier, 2014). Here, we used CRISPR/
Cas9-based screening to identify disruptions in human protein
coding genes that confer resistance to the activity of evolutionarily divergent T3SSs. These screens revealed that distinct
host cell pathways confer susceptibility to T3SS1 and T3SS2
killing. Cell surface sulfation was important for bacterial adhesion
and T3SS1 killing but dispensable for T3SS2 killing. In contrast,
T3SS2 killing was dependent on cell surface fucosylation, which
was critical for T3SS2 translocon insertion into host cell membranes. Thus, there is significant heterogeneity in the host factors targeted by different T3SSs. Our study demonstrates the
utility and potency of CRISPR/Cas9-based genetic screens for
investigations of host-pathogen interactions.
RESULTS
CRISPR/Cas9 Screens Identify Host Factors Required
for T3SS1 or T3SS2 Cytotoxicity
V. parahaemolyticus producing either T3SS1 or T3SS2 induces
rapid cell death in human cells (Burdette et al., 2008; Kodama
et al., 2007) but with distinct kinetics. To identify phenotypes
attributable to an individual T3SS, we generated isogenic
V. parahaemolyticus strains with deletions in the ATPase-encoding component of either T3SS1 (DvscN1, T3SS2+) or T3SS2
(DvscN2, T3SS1+). While T3SS1 kills more than 80% of HT-29
intestinal epithelial cells within 1.5 hr of infection, T3SS2 reaches
the same levels after 2.5 hr (Figure 1A). We harnessed the robust
selection by V. parahaemolyticus’s two T3SSs to identify host
cell targets whose disruption confers resistance to T3SS-mediated cytotoxicity.
Using the Avana CRISPR human genome-wide library
(Doench et al., 2016), we targeted each protein-coding gene in
the human intestinal epithelial cell line HT-29 with four singleguide RNAs (sgRNAs) (for a total of 74,700 sgRNAs). Seven
days after introduction of the CRISPR library in independent biological replicates (replicates A and B) (Figures S1A and S1B),
cells were infected with V. parahaemolyticus producing either
T3SS1 or T3SS2. To standardize the magnitude of selection between the different screens, infections were carried out for 1.5 hr
(T3SS1 selections) or 2.5 hr (T3SS2 selections) based on the kinetics noted earlier. Survivor cells were outgrown, and the process was repeated for three total rounds of infection to enrich
for resistant cells (Figure 1B). Deep sequencing of integrated
sgRNAs before and after each round of infection revealed that
a small subset of sgRNAs became increasingly overrepresented
after each round of selection (Figure 1C; Figures S1 and S2).
We used the STARS algorithm, which integrates data from
independent guides targeting the same gene, to identify the
most enriched genotypes. In general, our data display a strong
concordance between independent guides within the same
library and between independent libraries (Figures 1D and 1E;
Table S3). For each T3SS screen, we observed enrichment of
sgRNAs targeting multiple genes that contribute to a single biological process. Based on a statistically significant enrichment
(p < 0.001) in both biological replicates, T3SS1 resistance
was associated with sgRNAs targeting multiple genes important
for cell surface sulfation, the SWI/SNF chromatin remodeling
complex, and collagen synthesis. T3SS2 resistance was largely
associated with sgRNAs targeting genes involved in fucosylation
of glycans exported to the cell surface, serine-threonine kinases,
and a spectrin subunit. The disparity between hits from T3SS1
and those from T3SS2 screens suggests that disruption of
distinct host factors confers resistance to these 2 T3SSs.
To validate the screening results, HT-29 cells containing
disruptions of individual genes were generated (Figure S3A).
Disruption of at least one gene from each pathway identified
was found to specifically augment resistance to either T3SS1or T3SS2-mediated death (Figures S3B and S3C). Maximal
resistance to T3SS1 and T3SS2 was observed with mutants
that disrupt cell surface sulfation and fucosylation, respectively
(Figures 1F and 1G), leading us to further investigate the role of
these host cell surface modifications in V. parahaemolyticusmediated cytotoxicity.
Host Cell Surface Sulfation Facilitates T3SS1 Killing via
V. parahaemolyticus Adherence
Human cell surface sulfation depends upon transport of a sulfate
donor, 30 -phosphoadenosine-50 -phosphosulfate (PAPS), into
the Golgi apparatus by antiporters encoded by the SLC35B2
and SLC35B3 genes (Kamiyama et al., 2011, 2003). Within the
Golgi, sulfotransferases (e.g., the heparan sulfate 6-O-sulfotransferase HS6ST1) catalyze transfer of a sulfate group from
PAPS to glycosaminoglycans (GAGs) (Figure 2A) (Habuchi
et al., 1995). SLC35B2 disruption reduces the total sulfation of
GAGs (e.g., heparan sulfate) and N-glycans in human cells (Kamiyama et al., 2011), while individual sulfotransferase mutations
are expected to have a more modest effect. In agreement with
this, the SLC35B2 mutant cells exhibited a more severe reduction in cell surface binding to a heparan sulfate-specific antibody
than did HS6ST1 mutant cells (Figure 2B).
Disruption of SLC35B2 protected against T3SS1-mediated
killing but not T3SS2-mediated killing (Figures 1F and 1G). Killing
Figure 1. CRISPR/Cas9 Screen Reveals Coherent and Distinct Pathways Involved in Resistance to T3SS Killing
(A) Kinetics of T3SS-dependent HT-29 cell death. The duration of infection for the T3SS1 (red) and T3SS2 (blue) screens is marked with dotted lines.
(B) Workflow and screening strategy for the CRISPR/Cas9 screens.
(C) Scatterplots showing enrichment of specific sgRNAs in the T3SS1 and T3SS2 screens after each round of infection. The sgRNAs targeting the same gene are
highlighted with the same color. The values correspond to log2 of normalized reads (see Table S2 for data).
(D and E) Statistical significance of the gene candidates from the T3SS1 (D) and T3SS2 (E) screens in both biological replicates analyzed by STARS. Candidates
for follow-up had p < 0.001 in both biological replicates. The colors of spheres indicate the associated biological process. See also Table S3.
(F and G) Survival of HT-29 cells and mutant cells following infection with T3SS1+ or T3SS2+ bacteria for 1.5 or 2.5 hr, respectively. See also Figures S3B and S3C.
Data are mean with SEM (n = 3). The p values (*p < 0.05, **p < 0.001) are based on one-way ANOVA with Dunnet post-test correction.
228 Cell Host & Microbe 20, 226–237, August 10, 2016
A
C
B
D
Figure 2. Cell Surface Sulfation Promotes T3SS1 Cytotoxicity
(A) Overview of sulfated proteoglycan synthesis, highlighting mutations conferring resistance to T3SS1 cytotoxicity.
(B) Flow cytometry profiles of HT-29 and mutant cells bound to a heparan sulfate-specific antibody (10E4-FITC). FITC, fluorescein isothiocyanate; GMFI,
geometric mean fluorescence intensity.
(C) Survival of HT-29 cells treated with the sulfation inhibitor sodium chlorate before T3SS1 and T3SS2 infection.
(D) T3SS1 killing and sulfation of SLC35B2 mutant cells expressing a sgRNA-resistant SLC35B2 cDNA.
Data are mean with SEM (n = 3). The p values (***p < 0.0001) are based on one-way ANOVA with Dunnet post-test correction.
and partial surface sulfation of the SLC35B2 mutant was
restored by introduction of a cDNA encoding a sgRNA-resistant
version of SLC35B2 (through a silent mutation at the protospacer
adjacent motif [PAM] site) (Figure 2D). Disruption of HS6ST1 also
had a significant, though less marked, effect on T3SS1-mediated
killing (Figures 1F and 1G), and treatment of HT-29 cells with sodium chlorate, an inhibitor of ATP sulfurylase (a key enzyme in
PAPS synthesis) (Safaiyan et al., 1999), resulted in dose-dependent and specific protection against T3SS1-mediated death
(Figure 2C). Thus, both genetic and pharmacological data indicate that host cell sulfation promotes T3SS1 cytotoxicity.
Sulfated GAGs (e.g., heparan, chondroitin, and dermatan) are
the principal sulfated molecules in host cells, and they exist as
membrane-bound or secreted proteoglycans (Sarrazin et al.,
2011). Our screen identified factors that contribute to GAG sulfation but did not yield genes for synthesis of specific proteoglycans, suggesting that sulfated GAGs in general, rather than
a particular proteoglycan, may confer susceptibility to T3SS1dependent killing by V. parahaemolyticus. Consistent with this
idea, we found that coating the sulfation-deficient SLC35B2
mutant with the sulfated GAGs heparin, dermatan sulfate, or
chondroitin sulfate increased the susceptibility of the SLC35B2
mutant to T3SS1 killing but that treatment with hyaluronic acid,
a non-sulfated GAG, did not (Figure 3A). Coating of HT-29 cells
with heparin did not increase susceptibility, suggesting that
endogenous levels of GAGs are not limiting for T3SS1-dependent cell death (Figure 3A). These data also indicate that structurally diverse sulfated GAGs associated with the surface of
host cells can promote V. parahaemolyticus T3SS1 toxicity
even in the absence of covalent linkages between GAGs and
specific cell surface proteins.
The dependence of T3SS1 cytotoxicity on host cell sulfation is
not restricted to HT-29 cells. Sodium chlorate treatment protected all four additional cell lines tested (including Chinese hamster ovary [CHO] cells) from T3SS1 killing (Figure S4A). Furthermore, a CHO cell derivative devoid of GAGs (CHO pgsA-745
cells) (Ludington and Ward, 2016) exhibited enhanced resistance
to T3SS1 killing (Figure S4B). In contrast, a CHO derivative that
does not synthesize heparan sulfate but produces high levels
of chondroitin sulfate (CHO pgsD-677) was as susceptible as
the parental cell line to T3SS1 killing, consistent with the observation that diverse sulfated GAGs can mediate cytotoxicity.
Because heparan sulfate proteoglycans mediate host attachment by a variety of bacterial and viral pathogens (Kamhi et al.,
2013), we speculated that sulfated GAGs might promote T3SS1dependent cytotoxicity by facilitating V. parahaemolyticus adhesion to host cells. Consistent with this hypothesis, we found that
V. parahaemolyticus adhesion to the SLC35B2 mutant cell line
was lower than it was to the HT-29 cells, based on enumeration
of bound colony-forming units (Figure 3B) or visualization of bound
Cell Host & Microbe 20, 226–237, August 10, 2016 229
A
B
C
D
E
F
bacteria (Figure S5). Furthermore, addition of sulfated GAGs to
culture media reduced V. parahaemolyticus adhesion and caused
dose-dependent reduction in T3SS1-mediated death (but not
T3SS2-mediated death), presumably by acting as decoy molecules, competing with endogenous GAGs in binding to adhesins
(Figures 3A–3C; Figure S4C). A non-sulfated GAG, hyaluronic
acid, had no effect on bacterial adhesion or T3SS1-mediated
cytotoxicity (Figures 3A–3C). Collectively, these findings are
consistent with the hypothesis that sulfated GAGs promote the
adhesion of V. parahaemolyticus to host cells and thereby facilitate
T3SS1 killing.
SLC35B2 mutant cells were not absolutely resistant to T3SS1
killing but instead were killed with delayed kinetics compared to
wild-type (WT) cells (Figure 3D; Figure S3D), suggesting that
230 Cell Host & Microbe 20, 226–237, August 10, 2016
Figure 3. Sulfated GAGs Facilitate T3SS1
Killing by Promoting Bacterial Adhesion
(A) T3SS1 cytotoxicity toward HT-29 and
SLC35B2 mutant cells without pretreatment
(PBS); preincubated then washed (coating) with
the GAGs (500 mg/ml) sulfated heparin (HS),
dermatan sulfate (DS), chondroitin sulfate (CSA),
or non-sulfated hyaluronic acid (HA); or infected
in the presence of heparin (500 mg/ml) (blocking).
(B) Adherence of T3SS V. parahaemolyticus to
HT-29 and SLC35B2 mutant cells in presence of
500 mg/ml sulfated or non-sulfated GAGs.
(C) Effect of GAGs on resistance of HT-29 cells to
T3SS1 and T3SS2 killing.
(D) Survival kinetics of host cells of varying genotypes following infection with T3SS1+ and T3SS
V. parahaemolyticus.
(E) Survival kinetics of HT-29 and SLC35B2 mutant
cells during infection with T3SS1+, with T3SS1+
V. parahaemolyticus expressing the Afa-I adhesin,
or with T3SS1+ following infection initiated with
centrifugation of V. parahaemolyticus onto host
cells (spin).
(F) Translocation of the T3SS1 effector VopQ
fused to CyA into different host cells by
V. parahaemolyticus after a 20 min infection.
Translocation into SLC35B2 cells was evaluated
with and without centrifugation (spin) to enhance
bacterial attachment.
Data are mean with SEM (n = 3). The p values
(*p < 0.01, **p < 0.001, ***p < 0.0001) are based on
one-way ANOVA with Dunnet post-test correction.
adhesion is a rate-limiting precursor
to T3SS1 cytotoxicity, rather than an
integral component. In support of this
idea, we found that survival of the
SLC35B2 mutant was markedly reduced
when adherence of the T3SS1+ strain
was augmented by expression of an
exogenous, sulfation-independent adhesin, Afa-1 (Labigne-Roussel et al., 1984),
or when centrifugation was used to force
contact between V. parahaemolyticus
and host cells (Figure 3E; Figure S4D).
Centrifugation also abrogated a deficiency in translocation of a T3SS1
effector protein, VopQ, into SLC35B2 cells (Figure 3F). Overall,
these data suggest that sulfated GAGs act upstream of T3SS1
to promote V. parahaemolyticus’s initial interaction with host
cells, rather than interacting directly with components of the
T3SS1 machinery.
We created mutants lacking one or more of the three previously described V. parahaemolyticus adhesin-encoding genes
(mam7, mshA1, and vpadF) (Boyd, 2014) that have been
implicated in T3SS1 killing to test whether they interact with
sulfated compounds and contribute to the sulfation-dependent
adhesion of the pathogen to host cells. MshA1 has been reported to bind both sulfated and non-sulfated glycans, while
MAM7 and VpadF are reported to bind fibrinogen and/or fibronectin. We found that deletion of vpadF resulted in a marked
A
B
C
Figure 4. MAM7, MshA1, and VpadF Promote Sulfation-Dependent Adhesion and T3SS1 Killing
(A) Flow cytometry profile of T3SS1+ V. parahaemolyticus and derivatives lacking MAM7, MshA1, VpadF, or all of them, bound to heparin-FITC. FITC, fluorescein
isothiocyanate; GMFI, geometric mean fluorescence intensity.
(B) Kinetics of T3SS1 killing in bacteria lacking the adhesins MAM7, MshA1, and/or VpadF.
(C) Survival of SLC35B2 cells infected with T3SS1+ and adhesin-deficient strains with or without heparin coating.
Data are mean with SEM (n = 3). The p values (*p < 0.01) are based on one-way ANOVA with Dunnet post-test correction.
reduction in heparin binding by V. parahaemolyticus, deletion
of mshA1 or mam7 had a less pronounced effect, and the effects
of these mutations were additive (Figure 4A). Thus, all three
adhesins could contribute to sulfation-dependent cytotoxicity.
To further explore the roles of these adhesins in T3SS1
activity, we measured the survival of HT-29 cells infected with
control and adhesin-deficient T3SS1+ strains. No single adhesin
mutation significantly reduced host cell killing; however, there
was a significant delay in T3SS1 killing kinetics with the mam7/
mshA1 double mutant and an even longer delay with the
mam7/mshA1/vpadF triple mutant (Figure 4B). Strikingly, the
cytotoxicity of the triple mutant toward SLC35B2 cells was not
increased by coating of host cells with heparin (Figure 4C).
Collectively, these data suggest that MAM7, MshA1, and VpadF
have partially redundant functions, consistent with the overlap
that we have demonstrated among their targets. In addition,
these observations provide compelling evidence that surface
sulfation is recognized by bacterial adhesins and critical for
V. parahaemolyticus’s interaction with host cells before T3SS1
cytotoxicity.
Cell Surface Fucosylation Enables T3SS2 Cytotoxicity
The sgRNAs targeting genes critical for fucosylation of host cell
surface proteins conferred the greatest degree of resistance to
V. parahaemolyticus T3SS2-dependent killing. These included
GMD, which encodes a cytosolic enzyme that generates the
charged fucose intermediate guanosine diphosphate (GDP)
fucose, and SLC35C1, which encodes the sole Golgi importer
of GDP fucose (Figures 1E and 5A) (Lühn et al., 2001). Within
the Golgi, a variety of fucosyltransferases (FUTs)—including
FUT4 (Figure 5A), encoded by another hit in the T3SS2
screen—transfer fucose to assembling glycan structures to
generate fucosylated glycans that are then exported to the cell
surface (Hadley et al., 2014). A uridine diphosphate galactose
(UDP)-galactose transporter encoded by SLC35A2, which enables synthesis of certain FUT substrates (Becker and Lowe,
2003), was also identified (Figure 5A). Thus, the T3SS2 screen
strongly suggests that fucosylated glycans created in the Golgi
are important for T3SS2-induced cytotoxicity. In addition, the
absence of hits in genes encoding particular fucosylated surface
proteins and/or lipids suggests that there may not be a specific
surface protein or lipid required for susceptibility to T3SS2 killing;
instead, the screen results suggest that multiple fucosylated cell
surface glycans could enable killing by T3SS2.
Using individual sgRNAs targeting SLC35C1, GMD, FUT4, or
SLC35A2, we confirmed that these factors contribute specifically to T3SS2 susceptibility (Figures 1F and 1G). Furthermore,
analyses of surface fucosylation, using a variety of fucose-specific lectins, revealed a strong correlation between the reduction
of glycan fucosylation and the extent of resistance to T3SS2
killing (Figures 5B and 5C). Little or no fucosylation was detected
in the SLC35C1 mutant, and these cells were fully resistant to
T3SS2 cytotoxicity even after extended infection. In contrast,
limited surface fucosylation in the GMD, FUT4, and SLC35A2
mutants was still apparent with a subset of fucose-specific lectins (Ulex europaeus and Aleuria aurantia but not Lotus tetragonolobus), and these mutants exhibited delayed killing following
infection. Pharmacological inhibition of glycan fucosylation
by the GDP-fucose mimetic compound 2-fluorofucose (2-FF)
likewise revealed a correlation between reduced fucosylation
and increased resistance to T3SS2 killing; 2-FF treatment was
protective for WT and GMD mutant HT-29 cells, as well as for
a variety of unrelated cell lines (Figures 5E and 5F; Figure S6A).
Finally, fucosylation and T3SS2 susceptibility of the HT-29
Cell Host & Microbe 20, 226–237, August 10, 2016 231
SLC35C1 mutant were restored by expression of a cDNA encoding a sgRNA-resistant version of SLC35C1 (Figure 5D), confirming the genetic link between surface fucosylation and T3SS2
cytotoxicity.
The incomplete resistance of the FUT4-deficient cells, which
are thought to lack a subset of a-1,3 fucosylated glycans but
to maintain other linkages (e.g., a-1,2) (Figures 5B and 5C), suggested that more than one type of fucosylated glycan might
confer susceptibility to T3SS2 killing. We took advantage of
CHO cells, which are completely resistant to T3SS2 killing (Figure 5G), to more precisely define the link between surface fucosylation and T3SS2-mediated cytotoxicity. CHO cells only express one FUT, FUT8, which generates the a-1,6 core linkage
in N-glycans (Xu et al., 2011), leaving them devoid of terminally
fucosylated glycans (Figure 5H). Transduction of individual FUT
genes into CHO cells yielded cell lines with distinct a-terminal
a-fucose linkages, including a-1,2 linkages, such as found in
the blood group H antigen (produced by FUT1), and a-1,3 linkages, such as found in the Sialyl LewisX blood group (produced
by FUT7) and in the LewisX blood group (produced by FUT4 and
FUT9) (Figure 5H). Despite their diverse products, each of the
transduced FUTs rendered the corresponding CHO cell lines
susceptible to T3SS2 killing (Figure 5G). Thus, terminal fucosylation in a variety of forms and contexts can mediate susceptibility
to T3SS2 killing, and the specific identification of FUT4 in the
screen likely reflects the major contribution of this FUT to fucosylation in HT-29 cells (Giordano et al., 2015).
Host Cell Surface Fucosylation Facilitates T3SS2
Activity
The resistance of sulfation-deficient host cells to T3SS1
cytotoxicity was not absolute, and it reflected decreased
V. parahaemolyticus adhesion to resistant cells. In contrast,
SLC35C1 mutant cells were not susceptible to T3SS2 cytotoxicity even after an extended infection period (Figure 5C;
Figure S3E), suggesting that the absence of fucosylation
affects a process downstream of the initial adherence of
V. parahaemolyticus to host cells. Consistent with this hypothesis, we observed that adherence of T3SS-deficient (T3SS)
V. parahaemolyticus to SLC35C1 mutant cells and to 2-FF
treated HT-29 cells was indistinguishable from adherence to
WT HT-29 cells (Figure 6A). Furthermore, unlike our results
with the SLC35B2 mutant and T3SS1 cytotoxicity, death of the
SLC35C1 mutant in response to T3SS2 infection was not
augmented by expression of the exogenous adhesion Afa-I.
Instead, the SLC35C1 cells remained fully resistant to T3SS2
killing (Figure 6B). The presence or absence of bacterial adhesins
also did not affect T3SS2 cytotoxicity (Figure 6B), consistent with
our observation (Figure 1F) that their sulfated GAG targets are
not required for T3SS2-mediated cell death. Early in infection
(20 min), the absence of sulfation-mediated adhesion moderately reduced T3SS2 effector translocation (Figure S6B). However, T3SS2 has been shown to promote bacterial attachment
(Zhou et al., 2014), and our data suggest that the sulfationindependent translocation is sufficient to establish and maintain
an association between bacteria and host cell.
The resistance of the SLC35C1 mutant cells to T3SS2 cytotoxicity does not seem to reflect a failure of this strain to promote
T3SS2 expression, although host-derived fucose does regulate
232 Cell Host & Microbe 20, 226–237, August 10, 2016
expression of T3SS genes in enterohaemorrhagic Escherichia
coli (EHEC) (Pacheco et al., 2012). Culture media from HT-29
cells and SLC35C1 mutant cells infected with a T3SS2+ translocation reporter strain contained comparable amounts of an
epitope-tagged effector protein, VopV-adenylate cyclase (CyA)
(Figure S6C), demonstrating that functional T3SS2 is being produced during both infections. Furthermore, the addition of
fucose to the media during T3SS2+ infection of SLC35C1 mutant
cells did not render them susceptible to T3SS2 cytotoxicity (Figure 6B), nor did the induction of T3SS2 gene expression via
overexpression of the transcriptional activator VtrB (Figure 6B)
(Kodama et al., 2010). Collectively, these observations argue
against the idea that deficient expression of T3SS2 during infection of the SLC35C1 mutant accounts for the mutant’s resistance
to T3SS2 killing.
Because the resistance of the SLC35C1 mutant cell line did
not appear to be attributable to a general adhesion deficit or a
reduction in T3SS2 expression, we investigated whether the
extent of host cell surface fucosylation affected the translocation
of T3SS2 effectors. We observed a marked reduction in translocation of the T3SS2 effector VopT into SLC35C1-deficient cells
relative to HT-29 cells (Figure 6C). Translocation of VopT was
also lower for HT-29 cells treated with 2-FF compared to untreated cells. Finally, we observed that translocation of VopT
was markedly higher into CHO cells expressing FUT4 than into
the parental cell line. Collectively, these data provide strong
evidence that the extent of terminal glycan a-fucosylation correlates with T3SS2 activity against host cells.
The reduced translocation of T3SS2 effector proteins into cells
lacking terminally fucosylated glycans might reflect a requirement for fucosylation in host membrane insertion of the T3SS2
translocon complex. To test this hypothesis, we compared the
amounts of hydrophobic T3SS2 translocon components,
VopB2 and VopD2, in membranes of HT-29 and SLC35C1
mutant cells after V. parahaemolyticus (T3SS2+) infection. Both
translocon proteins were detected in the membranes of infected
HT-29 cells but not in SLC35C1 cells (Figure 6D), suggesting that
terminally fucosylated glycans are required for T3SS2 killing
because they facilitate translocon insertion into host cell membrane and thereby enable effector delivery. This requirement is
specific to the T3SS2 injectisome, because cells lacking fucosylation (e.g., SLC35C1-deficient cells and CHO cells) are highly
susceptible to T3SS1 killing. Thus, translocons from diverse
T3SSs may require distinct host factors to facilitate their capacity
to engage host cell membranes.
DISCUSSION
The advent of CRISPR/Cas9-based technology is revolutionizing
our capacity to comprehensively interrogate gene function in
higher eukaryotes (Hartenian and Doench, 2015; Shalem et al.,
2014; Doudna and Charpentier, 2014). We used genome-wide
CRISPR/Cas9 screens to identify host factors that sensitize human cells to V. parahaemolyticus T3SS-mediated killing. The
screens identified distinct host cell surface modifications that
enable each of V. parahaemolyticus’s two T3SSs to engage host
cells. Sulfation, which contributes to adhesion mediated by
several V. parahaemolyticus adhesins, promoted downstream
cytotoxicity caused by T3SS1 but not by T3SS2. In contrast,
(legend on next page)
Cell Host & Microbe 20, 226–237, August 10, 2016 233
A
B
Figure 6. Fucosylation Is Required for
T3SS2 Effector Translocation and Translocon Insertion but Not Bacterial Adhesion
(A) Adhesion of T3SS V. parahaemolyticus to
HT-29 cells alone, HT-29 cells treated with 50 mM
2-FF, or SLC35C1 mutant cells. The T3SS
Dmam7 DmshA1 DvpadF strain was included as a
negative control.
(B) Survival kinetics of HT-29 and SLC35C1 mutant
cells infected with T3SS2+ V. parahaemolyticus
expressing the T3SS2 regulator VtrB or the adhesin
Afa-I, infected in the presence of 10 mM fucose, or
C
D
infected with a V. parahaemolyticus strain lacking
MAM7, MshA1, and VpadF.
(C) Translocation of the T3SS2 effector VopT
fused to adenylate cyclase after a 45 min infection
of HT-29 cells ± 50 mM 2-FF, SLC35C1 mutant
cells, or CHO cells ± FUT4. See also Figure S6B.
(D) Immunoblot of T3SS2 translocon components
VopB2 and VopD2 in host cell membranes
after infection with T3SS2+ V. parahaemolyticus.
Blots were also probed with antibodies against
the host membrane protein calnexin (loading or
fractionation control) and bacterial RNA polymerase (RNAP), demonstrating absence of contaminating intact bacteria.
Data are mean with SEM (n = 3). The p values (**p < 0.001, ***p < 0.0001) are based on one-way ANOVA with Dunnet post-test correction.
cell surface fucosylation promotes T3SS2 translocon insertion,
effector translocation, and associated cytotoxicity but is not
required for T3SS1-mediated cytotoxicity. Thus, critical host factors required for T3SS function are not conserved between the
two phylogenetically distinct T3SSs of V. parahaemolyticus.
Sulfated proteoglycans, particularly those containing heparan
sulfate, are known to promote host cell recognition and binding
by a variety of viral, bacterial, and parasitic pathogens (Kamhi
et al., 2013). However, there has been little indication to date
that cell surface sulfation mediates V. parahaemolyticus interaction with host cells. We found that genetic or pharmacological
ablation of host cell sulfation reduces V. parahaemolyticus adhesion to HT-29 cells and delays T3SS1-associated cytotoxicity.
Sulfated GAGs promoted V. parahaemolyticus adhesion even
when GAGs were not covalently bound to host cells; however,
bacterial adhesion and associated cytotoxicity were blocked
by the presence of excess sulfated GAGs, which likely serve
as competitive inhibitors. The bacterial adhesins MAM7,
MshA1, and VpadF are known to promote cytotoxicity through
recognition of specific host proteins (Krachler and Orth, 2011;
Liu and Chen, 2015; O’Boyle et al., 2013). Our data suggest
that sulfated host GAGs potentiate bacterial adhesion by
promoting early stages of binding between partially redundant
adhesins and host cells before recognition of specific targets.
Adhesins, like sulfation, are not required for T3SS1 killing; however, cytotoxicity is reduced in their absence, apparently due to
delayed bacterial association with host cells. Thus, interactions
between sulfated host cell surface molecules and bacterial adhesins are upstream facilitators, rather than intrinsic determinants of T3SS1 activity.
Neither these adhesins nor host cell sulfation are required
for cytotoxicity associated with T3SS2. In part, this likely reflects
that T3SS2 cytotoxicity was assessed after a longer infection
(2.5 hr) than T3SS1 cytotoxicity (1.5 hr) and thus is less dependent upon a rapid establishment of bacterial-host cell contact.
Although translocation of T3SS2 effectors into sulfation-deficient
host cells was reduced early after infection, this reduction
did not affect T3SS2 killing assayed at 2.5 hr. T3SS2 cytotoxicity may not require accessory adhesins to stabilize interactions with host cells, because this system can promote
V. parahaemolyticus adhesion to host cells through translocation
of VopV (Zhou et al., 2014).
Fucosylation of surface glycans was required for T3SS2 killing.
Disruption of the Golgi fucose transporter gene SLC35C1, which
eliminated detectable surface fucosylation, protected against
T3SS2 but not T3SS1 killing. Selective expression of different
Figure 5. Terminal Fucosylation Is Required for T3SS2 Cytotoxicity
(A) Overview of the steps in the synthesis of fucosylated glycans, highlighting mutations conferring resistance to T3SS2 killing.
(B) Flow cytometry profiles of HT-29 and mutant cells bound to fucose-specific fluorescein isothiocyanate (FITC)-conjugated lectins that recognize distinct
fucosylation linkages. Charts below the graphs show geometric mean fluorescence intensity (GMFI). AAL, A. aurantia; LTL, L. tetragonolobus; UEA-1,
U. europaeus lectin.
(C) Kinetics of survival of HT-29 and mutant cells after infection with T3SS2+ or T3SS2 V. parahaemolyticus.
(D) T3SS2 killing (top) and fucosylation (bottom) of WT, SLC35C1 mutant cells, and SLC35C1 mutant cells expressing a sgRNA-resistant SLC35C1 cDNA.
(E) Impact of the fucosylation inhibitor 2-FF on T3SS1 and T3SS2 killing of HT-29 cells.
(F) Impact of 2-FF on survival of different cell lines infected with T3SS2+ V. parahaemolyticus.
(G) Kinetics of cell survival following T3SS2+ V. parahaemolyticus infection of CHO parental and mutant cells.
(H) Lectin binding profiles for CHO cells transduced with FUT genes that generate diverse terminal fucose linkages. Structures of the CHO cell N-glycan core and
various terminal fucosylated blood group antigens are shown on the right.
Data are mean with SEM (n = 3). The p values (*p % 0.01, **p < 0.001) are based on one-way ANOVA with Dunnet post-test correction.
234 Cell Host & Microbe 20, 226–237, August 10, 2016
FUTs revealed that diverse terminal fucosylation products, but
not core fucosylation, sensitize cells to T3SS2-mediated cytotoxicity. Our findings indicate that fucosylation plays a crucial
role in insertion of hydrophobic T3SS2 translocon proteins
into the host cell membrane, a process required for effector
protein translocation and subsequent cytotoxicity. Given
T3SS2’s essential role in virulence, our data suggest that the fucosylation status of the intestinal epithelium is a key determinant
of the organism’s pathogenicity.
The means by which fucosylation contributes to T3SS2 translocon insertion requires further definition; however, parallels with
other biological systems are apparent. For example, interactions
between fucosylated glycans (e.g., blood group antigens) and
bacterial cholesterol-dependent pore forming toxins (e.g., pneumolysin and streptolysin O) promote insertion of these toxins
within the host cell membrane, and binding to fucosylated glycans
appears to promote host cell uptake of cholera toxin (Shewell
et al., 2014; Wands et al., 2015). Thus, fucosylated surface molecules may serve as receptors for T3SS2 translocon components,
whose binding may be an obligatory step in translocon insertion.
Alternatively, host molecules may stabilize translocon complexes
in the host membrane after insertion (Russo et al., 2016).
Fucosylated glycans are dispensable for the action of T3SS1;
thus, V. parahaemolyticus’s two T3SSs depend on distinct factors to engage host cells. Previous studies have also suggested
there is heterogeneity in host determinants of T3SS susceptibility; for example, Yersinia pestis T3SS activity was found to
depend on CCR5, a chemokine receptor (Sheahan and Isberg,
2015), and the Shigella flexneri translocon protein IpaB interacts
with the host receptor CD44 (Skoudy et al., 2000). Given the
apparent diversity in potential receptors for T3SSs, we speculate
that different T3SSs have evolved distinct adaptations within
their respective tip complexes—thought to sense the host cell
and enable contact-dependent translocon insertion—that are
fine-tuned to the diverse host cell types and environments in
which they function.
V. parahaemolyticus uses ubiquitous surface modifications,
rather than discrete target proteins, which may underlie its
T3SS activity in host organisms ranging from single-cell eukaryotes to humans. Our screen did not identify genes linked to lipid
rafts or intermediate filament formation, which were previously
shown to interact with translocon proteins by several enteric
pathogens (Hayward et al., 2005; Lafont et al., 2002; Russo
et al., 2016). It is possible that roles for these host factors were
masked by cell-type-specific functional redundancy or essentiality that prevented scoring as hits in our screens.
CRISPR/Cas9-based creation of comprehensive libraries of
host cells with null mutations provides an invaluable functional
genomics approach to the study of host-pathogen interactions.
Identification of host factors that mediate susceptibility or resistance to infection not only yields critical insight into the evolution,
emergence, and mechanisms of pathogenicity but also provides
useful information for the development of therapeutic interventions aimed at blocking the host processes exploited by microbial pathogens.
EXPERIMENTAL PROCEDURES
See Supplemental Experimental Procedures for additional information.
Construction of CRISPR/Cas9 Avana Libraries in HT-29 Cells
The Avana CRISPR sgRNA library contains four sgRNAs targeting each of
the annotated human protein coding genes (18,675 genes), as described
in (Doench et al., 2016). HT-29 cells constitutively expressing Cas9 (HT-29
Cas9) were transduced by lentiviral spin infection to generate two independent libraries. The following considerations were taken into account during
library construction. First, we aimed to achieve 5003 coverage (500 cells
per perturbation); with 74.700 sgRNAs in the library, this translates into
40 3 106 infected cells. Second, because an MOI of less than 1 is desired
to avoid insertions of multiple sgRNAs per cell, we titrated the Avana lentiviral library to obtain 30% infectivity on HT-29 Cas9 cells; therefore, a total
of 135 3 106 cells were transduced. Then, 100 ml of 1.35 3 106 trypsinized
HT-29 Cas9 cells/ml were prepared in DMEM 10% fetal bovine serum (FBS)
supplemented with polybrene (8 mg/ml), and aliquoted (2 ml/well) among
four 12-well format plates, along with concentrated virus. Lentiviral transduction was performed using spin infection conditions for 2 hr at
2,000 rpm. Plates were then incubated at 37 C with 5% CO2 for 6 hr,
followed by seeding of 3 3 106 trypsinized cells in each of 45 T225 flasks.
After 2 days of incubation, media were replaced with DMEM 10% FBS
supplemented with puromycin (1 mg/ml). Following an additional 5–7 days
of selection, transduced cells were trypsinized, counted, and seeded for
the positive selection screen. The procedure was performed in duplicate
to obtain two biological replicates of the HT-29 CRISPR/Cas9 library
(libraries A and B).
Positive Selection Screens Using the HT-29 CRISPR Avana Libraries
Ten T225 flasks seeded with 8 3 106 cells each were incubated for 48 hr.
HT-29 cells doubled every 48 hr, yielding 1.6 3 108 cells per experimental
condition (2,0003 coverage per perturbation in each library). Three
experimental conditions were seeded: (1) cells harvested as the library
input, (2) cells used for the T3SS1 screen, and (3) cells used for the
T3SS2 screen.
The V. parahaemolyticus strains used for the two screens were cultured
overnight and then diluted 1:100 into Luria-Bertani (LB) media and grown for
2.5 hr to optical density at 600 nm of 0.6. Expression of T3SS2 was induced
with 0.04% bile (Gotoh et al., 2010). HT-29 cells were infected at an MOI of
1 and incubated at 37 C with 5% CO2 for either 1.5 hr (T3SS1 screen) or
2.5 hr (T3SS2 screen). After infection, media were replaced with fresh media
supplemented with gentamicin (100 mg/ml). Fresh media with gentamicin
were added again after overnight incubation. Flasks were evaluated daily to
monitor recovery of survivor cells; when 50%–60% confluency was achieved,
cells were trypsinized and passaged. At least 8 3 107 passaged cells were
seeded to maintain a coverage of at least 1,0003. For the second and third
rounds of infection, cells were propagated until at least 2.4 3 108 cells were
obtained, allowing repetition of the infection procedure with ten T225 flasks
per experimental condition and 2,0003 coverage.
Genomic DNA Preparation, Sequencing, and Analyses of Screen
Results
Genomic DNA was obtained from 8 3 107 cells after each round of infection,
as well as from the input cells using the Blood and Cell Culture DNA Maxi
Kit from QIAGEN. PCR to amplify sgRNA sequences was performed as
described (Doench et al., 2016). The read counts were first normalized to
reads per million within each condition by the following formula: reads per
sgRNA / total reads per condition 3 106. Reads per million were then log2
transformed by first adding 1 to all values to take the log of sgRNAs with
zero reads (Table S2). For analyses, the log2 fold change of each sgRNA
was determined relative to the input sample for each biological replicate.
The STARS algorithm for CRISPR-based genetic perturbation screens
was used to evaluate the rank and statistical significance of the 10% of
perturbations from the ranked list, as described (Table S3) (Doench et al.,
2016).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
six figures, and four tables and can be found with this article online at http://
dx.doi.org/10.1016/j.chom.2016.06.010.
Cell Host & Microbe 20, 226–237, August 10, 2016 235
AUTHOR CONTRIBUTIONS
Hartenian, E., and Doench, J.G. (2015). Genetic screens and functional genomics using CRISPR/Cas9 technology. FEBS J. 282, 1383–1393.
C.J.B., B.E.G., J.G.D., and M.K.W. designed and conceived the study; C.J.B.,
J.S.P., A.R.P., T.P.H., C.J.K., and M.J.W. performed all experiments; and
C.J.B., J.S.P., T.P.H., B.E.G., J.G.D., B.M.D., and M.K.W. analyzed data and
wrote the manuscript.
Hayward, R.D., Cain, R.J., McGhie, E.J., Phillips, N., Garner, M.J., and
Koronakis, V. (2005). Cholesterol binding by the bacterial type III translocon
is essential for virulence effector delivery into mammalian cells. Mol.
Microbiol. 56, 590–603.
ACKNOWLEDGMENTS
We gratefully acknowledge Drs. Tetsuya Iida, Toshio Kodama, Marcia Goldberg, Judy Lieberman, and Honorine Ward for providing reagents and
Emma W. Vaimberg and Yijie Ma for technical assistance. We thank members
of the M.K.W. lab for helpful discussions. This work was supported by NIH
(R37 AI-042347 to M.K.W., F31 AI-120665 to T.P.H., and R01 CA085180 to
B.E.G.), and HHMI (M.K.W.). J.S.P. is supported by an HHMI medical research
fellowship; C.J.B. was supported by the Pew Latin American Fellows Program
in the Biomedical Sciences and a CONICYT BecasChile postdoctoral fellowship; J.G.D. is supported by the Next Generation Fund at the Broad Institute;
and B.E.G. is supported by a Burroughs Wellcome Career award.
Received: March 11, 2016
Revised: May 24, 2016
Accepted: June 17, 2016
Published: July 21, 2016
Hazen, T.H., Lafon, P.C., Garrett, N.M., Lowe, T.M., Silberger, D.J., Rowe,
L.A., Frace, M., Parsons, M.B., Bopp, C.A., Rasko, D.A., and Sobecky, P.A.
(2015). Insights into the environmental reservoir of pathogenic Vibrio parahaemolyticus using comparative genomics. Front Microbiol 6, 204.
Kamhi, E., Joo, E.J., Dordick, J.S., and Linhardt, R.J. (2013).
Glycosaminoglycans in infectious disease. Biol. Rev. Camb. Philos. Soc. 88,
928–943.
Kamiyama, S., Suda, T., Ueda, R., Suzuki, M., Okubo, R., Kikuchi, N., Chiba,
Y., Goto, S., Toyoda, H., Saigo, K., et al. (2003). Molecular cloning and identification of 30 -phosphoadenosine 50 -phosphosulfate transporter. J. Biol. Chem.
278, 25958–25963.
Kamiyama, S., Ichimiya, T., Ikehara, Y., Takase, T., Fujimoto, I., Suda, T.,
Nakamori, S., Nakamura, M., Nakayama, F., Irimura, T., et al. (2011).
Expression and the role of 30 -phosphoadenosine 50 -phosphosulfate transporters in human colorectal carcinoma. Glycobiology 21, 235–246.
REFERENCES
Kodama, T., Rokuda, M., Park, K.-S., Cantarelli, V.V., Matsuda, S., Iida, T., and
Honda, T. (2007). Identification and characterization of VopT, a novel ADPribosyltransferase effector protein secreted via the Vibrio parahaemolyticus
type III secretion system 2. Cell. Microbiol. 9, 2598–2609.
Abby, S.S., and Rocha, E.P.C. (2012). The non-flagellar type III secretion system evolved from the bacterial flagellum and diversified into host-cell adapted
systems. PLoS Genet. 8, e1002983.
Kodama, T., Gotoh, K., Hiyoshi, H., Morita, M., Izutsu, K., Akeda, Y., Park,
K.-S., Cantarelli, V.V., Dryselius, R., Iida, T., and Honda, T. (2010). Two regulators of Vibrio parahaemolyticus play important roles in enterotoxicity by controlling the expression of genes in the Vp-PAI region. PLoS ONE 5, e8678.
Becker, D.J., and Lowe, J.B. (2003). Fucose: biosynthesis and biological function in mammals. Glycobiology 13, 41R–53R.
Boyd, A. (2014). Manipulation of intestinal epithelial cell function by the cell
contact-dependent type III secretion systems of Vibrio parahaemolyticus.
Front. Cell Infect. Microbiol. 3, 114.
Burdette, D.L., Yarbrough, M.L., Orvedahl, A., Gilpin, C.J., and Orth, K. (2008).
Vibrio parahaemolyticus orchestrates a multifaceted host cell infection by
induction of autophagy, cell rounding, and then cell lysis. Proc. Natl. Acad.
Sci. USA 105, 12497–12502.
Dean, P. (2011). Functional domains and motifs of bacterial type III effector
proteins and their roles in infection. FEMS Microbiol. Rev. 35, 1100–1125.
Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan,
K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized
sgRNA design to maximize activity and minimize off-target effects of
CRISPR-Cas9. Nat. Biotechnol. 34, 184–191.
Doudna, J.A., and Charpentier, E. (2014). Genome editing. The new frontier of
genome engineering with CRISPR-Cas9. Science 346, 1258096.
Galán, J.E., Lara-Tejero, M., Marlovits, T.C., and Wagner, S. (2014). Bacterial
type III secretion systems: specialized nanomachines for protein delivery into
target cells. Annu. Rev. Microbiol. 68, 415–438.
Giordano, G., Febbraro, A., Tomaselli, E., Sarnicola, M.L., Parcesepe, P.,
Parente, D., Forte, N., Fabozzi, A., Remo, A., Bonetti, A., et al. (2015).
Cancer-related CD15/FUT4 overexpression decreases benefit to agents targeting EGFR or VEGF acting as a novel RAF-MEK-ERK kinase downstream
regulator in metastatic colorectal cancer. J. Exp. Clin. Cancer Res. 34, 108.
Gotoh, K., Kodama, T., Hiyoshi, H., Izutsu, K., Park, K.-S., Dryselius, R., Akeda,
Y., Honda, T., and Iida, T. (2010). Bile acid-induced virulence gene expression
of Vibrio parahaemolyticus reveals a novel therapeutic potential for bile acid
sequestrants. PLoS ONE 5, e13365.
Habuchi, H., Habuchi, O., and Kimata, K. (1995). Purification and characterization of heparan sulfate 6-sulfotransferase from the culture medium of Chinese
hamster ovary cells. J. Biol. Chem. 270, 4172–4179.
Hadley, B., Maggioni, A., Ashikov, A., Day, C.J., Haselhorst, T., and Tiralongo,
J. (2014). Comput. Struct. Biotechnol. J. 10, 23–32.
236 Cell Host & Microbe 20, 226–237, August 10, 2016
Krachler, A.M., and Orth, K. (2011). Functional characterization of the interaction between bacterial adhesin multivalent adhesion molecule 7 (MAM7) protein and its host cell ligands. J. Biol. Chem. 286, 38939–38947.
Labigne-Roussel, A.F., Lark, D., Schoolnik, G., and Falkow, S. (1984). Cloning
and expression of an afimbrial adhesin (AFA-I) responsible for P blood
group-independent, mannose-resistant hemagglutination from a pyelonephritic Escherichia coli strain. Infect. Immun. 46, 251–259.
Lafont, F., Tran Van Nhieu, G., Hanada, K., Sansonetti, P., and van der Goot,
F.G. (2002). Initial steps of Shigella infection depend on the cholesterol/sphingolipid raft-mediated CD44-IpaB interaction. EMBO J. 21, 4449–4457.
Letchumanan, V., Chan, K.-G., and Lee, L.-H. (2014). Vibrio parahaemolyticus:
a review on the pathogenesis, prevalence, and advance molecular identification techniques. Front Microbiol 5, 705.
Liu, M., and Chen, S. (2015). A novel adhesive factor contributing to the
virulence of Vibrio parahaemolyticus. Sci. Rep. 5, 14449.
Ludington, J.G., and Ward, H.D. (2016). The Cryptosporidium parvum C-type
lectin CpClec mediates infection of intestinal epithelial cells via interactions
with sulfated proteoglycans. Infect. Immun. 84, 1593–1602.
Lühn, K., Wild, M.K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber, D.
(2001). The gene defective in leukocyte adhesion deficiency II encodes a putative GDP-fucose transporter. Nat. Genet. 28, 69–72.
Matz, C., Nouri, B., McCarter, L., and Martinez-Urtaza, J. (2011). Acquired type
III secretion system determines environmental fitness of epidemic Vibrio
parahaemolyticus in the interaction with bacterivorous protists. PLoS ONE 6,
e20275.
O’Boyle, N., Houeix, B., Kilcoyne, M., Joshi, L., and Boyd, A. (2013). The MSHA
pilus of Vibrio parahaemolyticus has lectin functionality and enables TTSSmediated pathogenicity. Int. J. Med. Microbiol. 303, 563–573.
Pacheco, A.R., Curtis, M.M., Ritchie, J.M., Munera, D., Waldor, M.K., Moreira,
C.G., and Sperandio, V. (2012). Fucose sensing regulates bacterial intestinal
colonization. Nature 492, 113–117.
Park, K.-S., Ono, T., Rokuda, M., Jang, M.-H., Okada, K., Iida, T., and Honda,
T. (2004). Functional characterization of two type III secretion systems of Vibrio
parahaemolyticus. Infect. Immun. 72, 6659–6665.
Piñeyro, P., Zhou, X., Orfe, L.H., Friel, P.J., Lahmers, K., and Call, D.R. (2010).
Development of two animal models to study the function of Vibrio parahaemolyticus type III secretion systems. Infect. Immun. 78, 4551–4559.
Portaliou, A.G., Tsolis, K.C., Loos, M.S., Zorzini, V., and Economou, A. (2016).
Type III secretion: building and operating a remarkable nanomachine. Trends
Biochem. Sci. 41, 175–189.
Ritchie, J.M., Rui, H., Zhou, X., Iida, T., Kodoma, T., Ito, S., Davis, B.M.,
Bronson, R.T., and Waldor, M.K. (2012). Inflammation and disintegration of intestinal villi in an experimental model for Vibrio parahaemolyticus-induced diarrhea. PLoS Pathog. 8, e1002593.
Russo, B.C., Stamm, L.M., Raaben, M., Kim, C.M., Kahoud, E., Robinson,
L.R., Bose, S., Queiroz, A.L., Herrera, B.B., Baxt, L.A., et al. (2016).
Intermediate filaments enable pathogen docking to trigger type 3 effector
translocation. Nat. Microbiol. 1, 10625.
Safaiyan, F., Kolset, S.O., Prydz, K., Gottfridsson, E., Lindahl, U., and
Salmivirta, M. (1999). Selective effects of sodium chlorate treatment on the sulfation of heparan sulfate. J. Biol. Chem. 274, 36267–36273.
Sarrazin, S., Lamanna, W.C., and Esko, J.D. (2011). Heparan sulfate proteoglycans. Cold Spring Harb. Perspect. Biol. 3, 1–33.
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S.,
Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014).
Genome-scale CRISPR-Cas9 knockout screening in human cells. Science
343, 84–87.
Shames, S.R., and Finlay, B.B. (2012). Bacterial effector interplay: a new way
to view effector function. Trends Microbiol. 20, 214–219.
Sheahan, K.-L., and Isberg, R.R. (2015). Identification of mammalian proteins
that collaborate with type III secretion system function: involvement of a chemokine receptor in supporting translocon activity. MBio 6, 1–13.
Shewell, L.K., Harvey, R.M., Higgins, M.A., Day, C.J., Hartley-Tassell, L.E.,
Chen, A.Y., Gillen, C.M., James, D.B.A., Alonzo, F., 3rd, Torres, V.J., et al.
(2014). The cholesterol-dependent cytolysins pneumolysin and streptolysin
O require binding to red blood cell glycans for hemolytic activity. Proc. Natl.
Acad. Sci. USA 111, E5312–E5320.
Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y., Cai, T.,
Wang, F., and Shao, F. (2015). Cleavage of GSDMD by inflammatory caspases
determines pyroptotic cell death. Nature 526, 660–665.
Skoudy, A., Mounier, J., Aruffo, A., Ohayon, H., Gounon, P., Sansonetti, P.,
and Tran Van Nhieu, G. (2000). CD44 binds to the Shigella IpaB protein and
participates in bacterial invasion of epithelial cells. Cell. Microbiol. 2, 19–33.
Sugiyama, T., Iida, T., Izutsu, K., Park, K.-S., and Honda, T. (2008). Precise region and the character of the pathogenicity island in clinical Vibrio parahaemolyticus strains. J. Bacteriol. 190, 1835–1837.
Wands, A.M., Fujita, A., McCombs, J.E., Cervin, J., Dedic, B., Rodriguez, A.C.,
Nischan, N., Bond, M.R., Mettlen, M., Trudgian, D.C., et al. (2015).
Fucosylation and protein glycosylation create functional receptors for cholera
toxin. eLife 4, e09545.
Wang, T., Wei, J.J., Sabatini, D.M., and Lander, E.S. (2014). Genetic screens in
human cells using the CRISPR-Cas9 system. Science 343, 80–84.
Xu, X., Nagarajan, H., Lewis, N.E., Pan, S., Cai, Z., Liu, X., Chen, W., Xie, M.,
Wang, W., Hammond, S., et al. (2011). The genomic sequence of the
Chinese hamster ovary (CHO)-K1 cell line. Nat. Biotechnol. 29, 735–741.
Zhou, X., Massol, R.H., Nakamura, F., Chen, X., Gewurz, B.E., Davis, B.M.,
Lencer, W.I., and Waldor, M.K. (2014). Remodeling of the intestinal brush
border underlies adhesion and virulence of an enteric pathogen. MBio 5,
e01639-14.
Cell Host & Microbe 20, 226–237, August 10, 2016 237
Cell Host & Microbe, Volume 20
Supplemental Information
CRISPR/Cas9 Screens Reveal Requirements for Host
Cell Sulfation and Fucosylation in Bacterial
Type III Secretion System-Mediated Cytotoxicity
Carlos J. Blondel, Joseph S. Park, Troy P. Hubbard, Alline R. Pacheco, Carole J.
Kuehl, Michael J. Walsh, Brigid M. Davis, Benjamin E. Gewurz, John G.
Doench, and Matthew K. Waldor
FigureS1
A
Distribution of sgRNA in each replicate
B
sgRNA representation
(log2normalized sgRNA counts)
10
5
0
Replicate A
C
Replicate B
Replicate B
8
4
0
Input
Round 1 Round 2 Round 3
sgRNA representation
(log2normalized sgRNA counts)
sgRNA representation
(log2normalized sgRNA counts)
Replicate A
12
12
8
T3SS1 screen
4
0
Input
Replicate B
16
sgRNA representation
(log2normalized sgRNA counts)
sgRNA representation
(log2normalized sgRNA counts)
Replicate A
12
8
4
0
Input
Round 1 Round 2 Round 3
Round 1 Round 2 Round 3
16
12
T3SS2 screen
8
4
0
Input
Round 1 Round 2 Round 3
FigureS2
T3SS1screen
T3SS2screen
FigureS3
A
HT-29
ARID1A
245kDa
HT-29 TFAP4
αARID1A
39kDa
αTFAP4
α GAPDH
α CD71
HT-29 DPF2
44kDa
αDPF2
αCD71
HT-29 SPTBN1
274kDa
αSPTBN1
αGAPDH
HT-29 STK11
αSTK11
49kDa
αCD71
B
C
% Cell survival
(Trypan blue exclusion)
80
**
60
**
40
*
*
*
20
Infection with T3SS2+ V. parahaemolyticus
0
Candidates from
T3SS1 screen
***
100
80
60
**
*
40
Candidates from
T3SS1 screen
80
HT-29
SLC35B2
60
40
20
0
% Cell viability (ATP levels)
% Cell viability (ATP levels)
100
Candidates from
T3SS2 screen
120
100
80
0.5
1.0
1.5
2.5
Hours of infection
3.5
HT-29
SLC35C1
60
40
20
0
0.0
*
0
E
120
*
20
Candidates from
T3SS2 screen
D
*
H
SL TC 29
3
H 5B
S
C 6S 2
O T
L1 1
7A
SM TFA 1
AR P4
SM C
AR A4
C
B
D 1
AR PF
ID 2
1
P4 A
N H
C B
SL KA
C PI
35
C
1
SL GM
C D
35
A
FU 2
ST T4
SP K1
TB 1
M N1
AR
K2
H
SL TC3 29
H 5B
S
C 6S 2
O T
L1 1
7A
SM TFA 1
AR P4
SM C
AR A4
CB
D 1
AR PF
ID 2
1
P A
NC 4H
B
SL KA
C PI
35
C
1
SL GM
C3 D
5A
FU 2
ST T4
SP K1
TB 1
M N1
AR
K2
% Cell survival
(Trypan blue exclusion)
Infection with T3SS1+ V. parahaemolyticus
0.0
0.5
1.0
1.5
2.5
Hours of infection
3.5
FigureS4
A
B
PBS
40
NaClO3
30
20
10
0
HT-29
HeLa
Caco-2
293T
120
% Cell survival
(Trypan blue exclusion)
% Cell survival
(Trypan blue exclusion)
50
100
80
*
60
CHO
CHO pgsA-745
no HS and no CS
CHO pgsD-677
no HS and high CS
40
20
0
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
CHO
Hours of infection
D
200
100
50
SL
C3
5B
2
SL
C3
5B
2
29
0
T-
0
150
H
10
T3SST3SS- with Afa-1
29
T3SS1
T3SS2
T-
20
**
H
**
**
N
H He T
ep pa
a
H rin rin
ep 6
ar -O
in
2O
N
H He T
ep pa
H arin rin
ep 6
ar -O
in
2O
% Cell survival
(Trypan blue exclusion)
30
% of Adherence
C
GFP+ bacteria per 103 cells
FigureS5
1000
T3SST3SSΔmam7 ΔmshA1 ΔvpadF
800
600
400
200
0
PBS
HS
HT-29
HA
SLC35C1 SLC35B2
HT-29
SLC35B2
FigureS6
A
Binding to FITC conjugated lectins
50µg/ml
2-FF
50µg/ml
2-FF
50µg/ml
2-FF
10µg/ml
2-FF
10µg/ml
2-FF
10µg/ml
2-FF
Control
Control
B
177
cAMP (fmol/well)
8
24
1250
VopT-Cya
1000
*
241
177
24
C
T3SS2
αCyA
500
250
*
HT-29
SLC35C1
SLC35B2
10µg/ml 50µg/ml
GMFI Control HT-29
2FF
2FF
8
VopV-CyA
750
0
AAL-FITC
(α-1,2; α-1,3; α-1,4; α-1,6)
10µg/ml 50µg/ml
GMFI Control HT-29
2FF
2FF
10µg/ml 50µg/ml
GMFI Control HT-29
2FF
2FF
241
Control
UEA-I-FITC
(α-1,2)
LTL-FITC
(α-1,2; α-1,3)
8
HT-29
HT-29
HT-29
241
177
HT-29
SLC35C1
+-
+-
24
Supplemental Figure Legends
Figure S1. Representation of sgRNAs in HT-29 Cas9 libraries (related to Figure 1). (A) Box
plot showing the distribution of sgRNA frequencies in each library before infection (input). (B)
Scatter plot showing the correlation between the sgRNA frequencies in each HT-29 Cas9 library.
(C) Box plots showing the change in the distribution of sgRNA frequencies after each round of
infection for T3SS1 and T3SS2 screens and for both biological replicates (replicate A and
replicate B). The line in the middle of the box corresponds to the median and the whiskers are
drawn at the 5th percentile and at the 95th.
Figure S2. Scatter plots showing enrichment of specific sgRNAs in the T3SS1 and T3SS2
screens (related to Figure 1). The plots show the enrichment after each round of infection and
sgRNAs targeting the same gene are highlighted with the same color. The values correspond to l
og2 of normalized reads (see Table S2 for data).
Figure S3. Validation of sgRNA disruptions and specificity of T3SS1 and T3SS2 hits.
(related to Figure 1) (A) Immunoblotting to validate disruption of the targeted genes (related to
Figure 1D, F). SDS/PAGE and immunoblot analysis of whole cell lysates of HT-29 and
CRISPR-targeted cells. Arrows highlight the molecular weight of the corresponding protein.
GAPDH and CD71 were used as loading controls. (B-C) Validation of candidate genes identified
in T3SS1 and T3SS2 screens (related to Figure 1). HT-29 Cas9 cell lines with sgRNA
disruptions of indicated genes were generated and tested for their relative resistance to T3SS1
and T3SS2 cytotoxicity at either 1.5 or 2.5 hours after V. parahaemolyticus infection,
respectively. Cell survival, assessed by Trypan Blue exclusion analysis, is expressed as a
percentage of the non-infected cells. Data are mean +/- SEM (n=3). P value *<0.001; **<0.0001
by one-way Anova with Dunnet post test correction. (D-E) Dynamics of T3SS1 killing of HT-29
and SLC35B2 cells (D) and of T3SS2 killing of HT-29 and SLC35C1 cells (E); in both cases,
cell viability assayed by Cell Titer Glow method.
Figure S4. Validation of candidate genes and additional characterization of sulfation and
fucosylation in T3SS1 and T3SS2 cytotoxicity (related to Figures 1, 2 and 3).
(A) Effect of sodium chlorate treatment on susceptibility to T3SS1 killing for a variety of cell
lines. Cell survival was assessed by Trypan Blue exclusion analysis and is expressed as a
percentage of the non-infected cells. (B) Dynamics of T3SS1 killing of CHO cells defective in
GAG biosynthesis; pgsA-745 is defective in both heparan sulfate and chondroitin sulfate
synthesis whereas, pgsD-677 is defective in heparan sulfate synthesis but produces high amounts
of chondroitin sulfate. Cell death was evaluated by trypan blue exclusion. Statistical significance
is shown for the 1.0 hr time point in comparison to the parental CHO cell line. (C) Effect of
desulfated heparin on T3SS1 and T3SS2 cytotoxicity (related to Figure 2 and Figure 3). HT-29
cells were infected with V. parahaemolyticus strains expressing either T3SS1 or T3SS2 and cell
survival was evaluated at either 1.5 or 2.5 hours, respectively. The infections were performed in
the presence of 500µg/ml of the indicated proteoglycan. (D) Modulation of V. parahaemolyticus
(T3SS-) adherence to HT-29 or SLC35B2 mutant cells by the Afa-I adhesin. Values are
expressed as % of adherence versus the parental HT-29 cell line. Data are mean +/- SEM (n=3).
P value *<0.001; **<0.0001 by one-way Anova with Dunnet post test correction.
Figure S5. V. parahaemolyticus adherence assayed with fluorescent microscopy (related to
Figure 2 and 5). Adherence of T3SS- V. parahaemolyticus expressing GFP to HT-29, SLC35C1
and SLC35B2 mutant cells is expressed as GFP+ bacteria per 1,000 cells. Between 5 -10, 40X
fields were analyzed per sample. HS, heparan sulfate; HA, hyaluronic acid.
Figure S6. Surface fucosylation does not modulate secretion of T3SS2 effectors. (Related to
Figure 4, 5). (A) Reduction in cell surface fucosylation after treatment with 2-FF. Lectin binding
profile of HT-29 cells treated with 2 different concentrations of 2-FF and stained with FITCconjugated lectins. GMFI, geometric mean fluorescence intensity. AAL, Aleuria aurantia; LTL,
Lotus tetragonolobus; UEA-1, Ulex europaeus Iectin. Control cells were not stained with the
lectins. (B) Immunodetection of the T3SS2 effector protein VopV-Cya in the culture media of
HT-29 and SLC35C1 cells infected either with T3SS2+ or T3SS2- V. parahaemolyticus strains;
T3SS2- serves as a negative control. (C) Translocation of the T3SS2 effector protein VopT fused
to adenylate cyclase into HT-29, SLC35C1 and SLC35B2 cells after 20 minutes of infection. P
value *<0.01 by one-way Anova with Dunnet post test correction.
Table S1.
Supplemental Table 1, Related to Figures 1-6. Strains and plasmids used in this
study.
Table S2.
Supplemental Table 2, Related to Figure 1. Screening Data both T3SSs screens.
Table S3.
Supplemental Table 3, Related to Figure 1. Gene Ranking for both T3SSs screen
in each biological replicate.
Table S4.
Supplemental Table 4, Related to Figure 1, 2 and 5. sgRNA sequences for followup experiments.
Gene ID
SLC35C1
GMD
FUT4
SLC35A2
SPTBN1
STK11
SLC35B2
HS6ST1
COL17A1
TFAP4
SMARCA4
SMARCB1
DPF2
ARID1A
P4HB
MARK2
NCKAP1
Construct ID
0004M
7917
FUT40001
8009
1761
2870
8039
3400
468
6212
9311
9339
6950
5555
8193
5263
1070
sgRNA sequence
CAGTCCTGTCACGTAGCCGA
GATTGTGGTGAACTTCCGTG
AGTAGCGGCGATAGACCGCG
GCACCAGGACAGCCTCATGG
ACATCAAGCGCATCACAGCG
GGCACTGCACCCGTTCGCGG
GCCTGAAGTACTGCACCAGG
AGAAGAGCCAAGTCTCGCGG
TTTCTTGCAGGAAATCTCCG
ACGCATGCAGAGCATCAACG
CTAGGTATGAAGTAGCTCCG
TGTGACCCTGTTAAAAGCCT
TGGATGGAAAAGCGACACCG
GTGTGTATCTGTCCTCCGGA
TTCTGCCTTCAGCTTCCCAG
GCTGCCCCAGAACTCTTCCA
ATAGGCATGTGGAGACCCCA
Supplemental Experimental Procedures
Bacterial strains, plasmids and growth conditions
All bacterial strains and plasmids used in this study are listed in Table S1. Primers used in strain
construction are shown in the Primers Table. Bacterial strains were routinely cultured in LB medium or on
LB agar plates at 37°C unless otherwise specified. Culture media was supplemented with the following
chemicals and antibiotics at the following concentrations: 0.04% bovine and ovine bile (Sigma Cat No.
B8381); 50µg/ml carbenicillin, 5µg/ml and 20µg/ml chloramphenicol for V. parahemolyticus and E. coli,
respectively; 1ug/ml IPTG; 50µg/ml kanamycin and 200µg/ml streptomycin. V. parahaemolyticus deletion
mutants were constructed by allelic exchange using the pDM4 suicide vector carrying DNA sequences
flanking the gene targeted for deletion (Zhou, X. et al., 2013).
Eukaryotic cell lines and growth conditions
293T, HeLa, Caco-2, HT-29 and HCTC116 cells were cultured in high glucose DMEM (Thermo
Fisher Cat No. 11965126) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Cat No.
16140089). CHO cells were cultured in Ham’s F12-K Media (Thermo Fisher Cat No. 21127030)
supplemented with 10% FBS. Cells were grown at 37°C with 5% CO2 and routinely passaged at 70-80%
confluency; media was replenished every 48h.
Lentiviral transductions
Lentiviral particles were packaged in 293T cells using the TransIT-LT1 transfection reagent
(Mirus Bio Cat No. MIR 2300) and lentiviral packaging plasmids psPAX2 and pVSVG and the
corresponding cargo plasmid according to the manufacturer's protocol. 48h following transfection, 293T
culture supernatant was harvested, passed through a 0.22µm pore filter, and added to target cells that were
grown to 70-80% confluency in 6-well plates. 8µg/ml polybrene was added and the 6-well plates were spun
at 1600g for 2h at 30°C. Cells were returned to 37°C and this spin infection process was repeated the next
day with supernatant from 72h post transfection. Drug selection for positive transductants was initiated the
following day.
Construction of HT-29 Cas9 cells with targeted gene disruptions
The sgRNA sequences used for construction of HT-29 Cas 9 mutant cells are shown in Table S4.
All sgRNA oligo sequences were obtained from Integrated DNA Technologies (IDT, Inc) and cloned into
the pLentiGuide-Puro plasmid (Addgene plasmid #52963) according to protocols from Dr. Feng Zhang’s
website (genome-engineering.org). Briefly, 5µg of plasmid pLentiGuide-Puro was digested with BmsBI
(Fermentas Cat No. ER0451) and purified using the QIAquick Gel extraction kit. Each pair of oligos was
annealed and phosphorylated with T4 PNK (NEB Cat No. M0201S) in the presence of 10X T4 DNA ligase
buffer in a thermocycler with the following parameters: i) incubation for 30 minutes at 37°C, ii) incubation
at 95°C for 5 min with a ramp down to 25°C at 5°C per minute. Oligos were then diluted 1:200 and 1µl of
the diluted oligo mixture was ligated with 50ng of BsmBI digested plasmid. Ligations were transformed
into STBL3 bacteria (Thermo Fisher Cat No. C7373-03) and transformed clones were checked by PCR and
DNA sequencing. Lentiviral transduction of sgRNAs cloned into pLentiGuide-Puro into HT-29 Cas9 cells
was performed as described above, and after 10 days of selection with Puromycin 1µg/ml the extent of
disruption of the targeted gene was analyzed by immunoblotting for the corresponding gene product
(Figure S3) and/or by Flow cytometry analysis of the targeted protein or its products. For the SLC35C1,
GMD, FUT4 and SLC35A2 transductant populations, most subsequent analyses were performed with FACS
sorted cells that were not bound by lectins recognizing surface fucosylation (see below), in order to
eliminate analysis of transductants in which disruptions had not occurred at both alleles. Analysis by
immunoblotting and FACS corroborated the correct disruption of 10 of the 16 gene candidates (Figure S3);
disruptions in COL17A1, P4HB, SMARCB1 and SMARCA4, MARK2, NCKAP1 were not isolated.
Construction of FUT expressing CHO cells
CHO-K1 cells were obtained from the Harvard Digestive Diseases Center (HDDC) and were
transduced with lentiviral particles (as described above) packaged with lentiviral plasmids harboring either
FUT1 (Orfome collection Broad Institute ccsbBroad304_00597), FUT4 (Origene Cat. No. RCS223829),
FUT7 (Orfome collection Broad Institute ccsbBroad304_00599) or FUT9 (PlasmID repository Harvard
Medical School HsCD00420422). Blasticidin drug selection was carried out at 10ug/ml for 5 days and the
fucosylation status of the cells was analyzed with FITC-conjugated lectins as described below.
T3SS-dependent cell death
For cell survival assays, 6*104 HT-29 cells were seeded into 6-well plates and grown for 48 hours
in complete media. V. parahaemolyticus strains were cultured overnight and the next day diluted 1:100 into
LB liquid media and grown for 2.5 hours to reach OD600nm=0.6. To induce T3SS2 expression, bacterial
cultures were grown in the presence of 0.04% bile. HT-29 cells were infected at an MOI=1 and incubated
at 37°C with 5% CO2. At each time point assayed, the media was replaced with fresh complete DMEM
media supplemented with 100ug/ml of gentamicin. Cells were incubated overnight and surviving cells were
quantified either by trypan blue exclusion (0.4% trypan blue) and counted on a Countess II Automated Cell
Counter (Thermo Fisher Scientific), or alternatively cells were analyzed by the CellTiter-Glo Luminescent
Cell Viability Assay (Promega). For infection of CHO cells 6*104 were seeded into 6-well plates and
incubated for 24 hours before performing the infection with V. parahaemolyticus strains.
Pharmacologic inhibitors
To inhibit cellular sulfation, sodium chlorate (Sigma Cat No. 403016) a specific inhibitor of PAPS
synthetase, was used. To inhibit fucosylation at the level of fucosyltransferases in the Golgi, the fluorinated
fucose derivative 2-fluoro-peracetyl-fucose (2-FF) was used (Merck Millipore Cat No. 344827). For cell
death experiments, 3*105 HT-29 cells were seeded in 6-well plates and incubated for 48 hours in the
presence of different concentrations of the inhibitors.
Flow cytometry and fluorescence-activated cell sorting (FACS) of CRISPR/Cas9 knockout cells
For analysis of cell surface markers, monolayers of HT-29 cells were trypsinized with the TrypLE
Express reagent (Thermo Fisher Cat No. 12604013) and 1×106 cells were used for each staining procedure.
For staining with fluorescein-labeled (FITC) lectins, cells were first washed and resuspended in 1X CarboFree blocking solution (Vector Labs Cat No. SP-5040), incubated for 20 minutes at room temperature, then
washed and stained with 15 µg/ml FITC-conjugated lectins for 30 minutes at 4°C with shaking. Finally,
cells were washed twice in cold blocking solution and a final wash in DPBS+ calcium and magnesium
(Thermo Fisher Cat No. 14040-133) and analyzed immediately or fixed with 3.7% paraformaldehyde. The
FITC conjugated lectins included UEA-1-FITC (Cat No. FL-1061), LTL-FITC (Cat No. FL-1321) or AALFITC (Cat No. FL-1391) from Vector Labs, USA. For detection of cell surface heparin sulfate, 1×106 cells
were incubated in 500ul of staining solution containing 1% BSA and 15 µl of anti-heparan sulfate 10E4
antibody conjugated with FITC (USBiological Cat No. H1890-10). Cells were incubated for 30 minutes at
4°C with shaking, washed 3 times with PBS and then analyzed immediately or fixed with 3.7%
paraformaldehyde. Flow cytometry was carried out on a BD FACSCalibur instrument (BD Biosciences)
and the data analysed with FlowJo software, LLC. FACS was used to enrich for the SLC35C1, GMD,
FUT4 and SLC35A2 CRISPR/Cas9 mutant cells from a complex population after puromycin selection;
20*106 cells were stained with the LTL-FITC conjugated lectin and sorted in a FACSaria instrument (Flow
Cytometry Core Facility, Harvard Medical School).
Immunoblot analyses
Protein samples were prepared in NuPAGE LDS sample buffer (Invitrogen) with 50mM DTT,
separated by NuPAGE Bis-Tris gel electrophoresis and transferred to nitrocellulose membranes. The Pierce
Coomassie Plus (Bradford) Assay Kit (Thermo Fisher Cat No. 23236) was used for determination of
protein concentration. Antibodies were used at the following dilutions: anti-VopB2 (rabbit polyclonal,
1:2,500), anti-VopD2 (rabbit polyclonal, 1:2,500), anti-RNA polymerase (mouse monoclonal, 1:2,000;
Santa Cruz Biotechnology Cat. No. Sc-101597), anti-calnexin (rabbit monoclonal, 1µg/ml; Abcam) and
with horseradish peroxidase-conjugated secondary antibody against mouse (goat monoclonal, 1:2,500;
Santa Cruz Biotechnology Cat No. sc-2031) or rabbit (goat monoclonal, 1:40,000; Thermo Fisher Cat No.
31460). The blots were developed with either the SuperSignal West Pico or the Femto ECL substrate
(Thermo Fisher Cat No. 35060 and 35086) and imaging was performed on the Chemidoc Touch Imaging
System (Biorad). All blots are representative of at least 3 biological replicates. The VopB2 and VopD2
antibodies were a kind gift from Drs. Iida and Kodama (Research Institute for Microbial Diseases, Osaka
University).
Bacterial adhesion assay
For bacterial adhesion assays, 300,000 cells were seeded in 24-well plates and incubated for ~5
days to achieve a full monolayer. Full monolayers were required to avoid non-specific binding of V.
parahaemolyticus to the plastic tissue culture plates. Monolayers were infected at an MOI=1 for 45 minutes
and then washed 5 times with PBS to remove non-adherent bacteria. To lyse eukaryotic cells, 1% Triton-X
was added and incubated for 10 minutes to ensure full lysis. The lysate was serially diluted and plated on
LB agar plates to determine the numbers of CFUs of adherent bacteria. Bacterial adhesion was also
evaluated by fluorescence microscopy. For this full HT-29, SLC35B2 and SLC35C1 cell monolayers were
prepared in 4-well slide chambers. Cells were infected in the same conditions as the CFU adhesion
experiments but with V. parahaemolyticus strains harboring plasmid pGFP which allows constitutive
expression of GFP. After infection, cells were washed 5 times with PBS to remove non-adherent bacteria
and monolayers were fixed in 4% PFA. Actin was stained with Alexa 647 Phalloidin and bacteria and cell
nuclei were stained with propidium iodide. Slides were mounted using Prolong Diamond Anti-fade solution
and analyzed using confocal microscopy. Analysis was done in 40X resolution and adherent bacteria were
quantified using an in-house script and normalized by the total number of cells in the field.
Blocking and coating with proteoglycans
Cells were seeded as described for cell death or adhesion assays. For ‘blocking’ experiments, V.
parahaemolyticus infection of host cells was carried out in complete media supplemented with different
concentrations of GAGs. For ‘coating’ experiments, prior to addition of V. parahaemolyticus, host cells
were washed once in PBS, then incubated with different concentrations of GAGs for 1 hour in PBS at room
temperature with shaking, and then washed 3 times with PBS before fresh media was added and infection
was performed as described above.
T3SS1 and T3SS2 effector protein translocation assay
Translocation of the T3SS2 effector VopT was measured with an adenylate cyclase reporter assay
as previously described (Zhou, X. et al., 2012) but with slight modifications. Briefly, 2*104 HT-29 cells
were seeded in 96-well plates and incubated for 48 hours. Overnight V. parahaemolyticus cultures were
diluted 1:100 and grown for 2.5 hours to OD600nm=0.6. HT-29 cells were infected with V. parahaemolyticus
strains harboring a plasmid encoding a VopT-CyA fusion (pVopT-Cya) or only adenylate cyclase (pCyA,
negative control) at an MOI=50 for 45min. After infection, cyclic AMP levels in infected cells were
determined using the cAMP Direct Biotrak enzyme immunoassay kit (GE Healthcare Life Sciences Cat No.
RPN225) according to the manufacturer's instructions. For the T3SS1 effector VopQ, the first 150
aminoacids of VopQ were fused to the adenylate cyclase reporter; translocation experiments for VopQ
were carried out for only 20 minutes, to avoid T3SS1-dependent cell toxicity.
Heparin binding to V. parahaemolyticus strains
To test bacterial binding to heparin, 100 µl of bacterial cultures (OD600nm=0.6) were washed once
with PBS and then incubated with PBS with 500 µg/ml of heparin-FITC (Thermo Fisher H-7482). The
bacteria were then incubated at 4°C for 30 minutes in the dark, washed twice with PBS, fixed with 3.7%
paraformaldehyde and analyzed by flow cytometry.
Fractionation of infected cells
Fractionation of infected host cells was performed as described previously (Gauthier et al., 2000)
with slight modifications. 10*106 HT-29 cells were seeded in T-225 flasks in DMEM 10% FBS and
incubated for 48 hours. Overnight bacterial cultures were diluted 1:100 into LB liquid media supplemented
with 0.04% bile and grown for 2.5 hours to reach OD600nm=0.6. HT-29 cells were infected for 1.5 h at an
MOI of 100. After infection, cells were washed 5 times with ice-cold PBS and then suspended in 1ml
homogenization buffer (3 mM imidazole, 250 mM sucrose, 0.5 mM EDTA, pH 7.4) supplemented with
Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Cat. No. 78440) and mechanically
disrupted by vigorous passage through a 27-gauge needle. The homogenates were centrifuged at 11000 rpm
for 15 minutes to pellet unbroken cells, bacteria, nuclei and cytoskeletal components. The supernatants
were centrifuged once again at 11000 rpm to remove any residual contaminants and then the supernatant
fractions were subjected to ultracentrifugation at 41,000 g for 20 min to isolate the host cell membranes
(pellet). Fractions were analyzed by immunoblotting as described above.
Introduction of sgRNA resistant versions of SLC35C1 and SLC35B2 genes in HT-29 mutant cells
lines.
SLC35C1 and SLC35B2 mutant cell lines harbor both Cas9 and the corresponding targeting
sgRNAs in their genomes; therefore to efficiently restore these genes we introduced sgRNA resistant
cDNA versions of the genes to the respective cell lines. sgRNA resistant variants of the SLC35C1 and
SLC35B2 genes were generated by gene synthesis of the corresponding genes (GenScript) but with an
alteration in the PAM sequence (NGG) targeted by the each of the sgRNAs. Lentiviral particles were
produced and SLC35C1- and SLC35B2-expressing cells were selected by growth on Hygromycin (600
ug/ml) for 2 weeks along with an empty-vector control. Restoration of fucosylation and sulfation was
assessed by cell surface staining and FACS analysis as described below. The complete DNA sequences of
sgRNA resistant genes and the sequence alignment of the sgRNA and mutated PAM sequence are shown
below:
SLC35C1
sgRNA targeting site
PAM
NGG
SLC35C1_native
1 CAGTCCTGTCACGTAGCCGATGG
cDNA
S L C 3 5 C 1 _ s g R N A _ rcDNA
e s i ssgRNA
t a n t resistant
1 CAGTCCTGTCACGTAGCCGATTG
consensus
1 ********************* *
SLC35B2
sgRNA targeting site
PAM
NGG
AG
CC C
AG A
GT
AG G
ScLDCN3A5_CS1L_Cn3a5tBi2v_en a t i v e
11 CGACGCTTCGCATAGGTTCAACCTGGTCA
cDNA
AG
CC C
AG A
GT
AT
GG
A
SSLLCC3355CB12__ssggRRNNAA__rr
eessiisssgRNA
ttaanntt resistant
11 CGACGCTTCGCATAGGTTCAACCTGGTCA
cDNA
**
** * * * * * *
.
ccoonnsseennssuuss
11 *****************************
Statistical Methods
Statistical analyses were carried out using GraphPad Prism5. The statistical methods used and
sample sizes are listed in the figure legends.
Supplemental References
•
Zhou X, Gewurz BE, Ritchie JM, Takasaki K, Greenfeld H, Kieff E, Davis BM, Waldor MK. (2013)
A Vibrio parahaemolyticus T3SS effector mediates pathogenesis by independently enabling
intestinal colonization and inhibiting TAK1 activation. Cell Rep. 3(5):1690-702.
•
Zhou X, Ritchie JM, Hiyoshi H, Iida T, Davis BM, Waldor MK, Kodama T. (2013) The hydrophilic
translocator for Vibrio parahaemolyticus, T3SS2, is also translocated. Infect Immun. 80(8):2940-7.
•
Gauthier A, de Grado M, Finlay BB. (2000) Mechanical fractionation reveals structural
requirements for enteropathogenic Escherichia coli Tir insertion into host membranes. Infect
Immun. 68(7):4344-8.
•
Labigne-Roussel, A.F., Lark, D., Schoolnik, G., and Falkow, S. (1984) Cloning and expression of
an afimbrial adhesin (AFA-I) responsible for P blood group-independent, mannose-resistant
hemagglutination from a pyelonephritic Escherichia coli strain. Infect Immun 46: 251–259.
•
Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K, Iijima Y, Najima M,
Nakano M, Yamashita A, Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, Hattori M,
Iida T. (2003) Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from
that of V cholerae. Lancet. 361(9359):743-9.
Table Primers. Oligonucleotide sequences used in this study.
Primer
Sequence
F5_VP2698_DM4
agtacgcgtcactagtggggcccttctagaGGTTAGCTGTTCA
TTACCCGCAACG
R5_VP2698_DM4
F3_VP2698_DM4
R3_VP2698_DM4
F5_VP1611_DM4
R5_VP1611_DM4
F3_VP1611_DM4
R3_VP1611_DM4
F5_VP1767_DM4
Comments
Creation of MshA1
allele exchange
vector
CCAGTATCTGTTACAGCAGTTGTagatctGATAA
GGGTGAAACCACCTTGTC
GACAAGGTGGTTTCACCCTTATCagatctACAAC
TGCTGTAACAGATACTGG
taacaatttgtggaattcccgggagagctcACTAGGATCAGCT
CCATTAATG
agtacgcgtcactagtggggcccttctagaggccactatcgcgatttttcct
gct
Creation of MAM7
allele exchange
vector
GCTTAGGAATTGGCGTTCTCCATTGagatctCGA
TGTTTGAGAATTGTTCTGATC
GATCAGAACAATTCTCAAACATCGagatctCAA
TGGAGAACGCCAATTCCTAAGC
taacaatttgtggaattcccgggagagctcCGTCATTCATGAA
TAGGGCAGATAC
agtacgcgtcactagtggggcccttctagaTTTCTTGCCTATT
GTTTACC
Creation of VpadF
allele exchange
vector
F_xbaI_VopQ150
AGAGGAACGCCAGGCGCGTCAGAagatctAGTA
TTTTTGCTTATCATAGAGTCA
TGACTCTATGATAAGCAAAAATACTagatctTCT
GACGCGCCTGGCGTTCCTCT
taacaatttgtggaattcccgggagagctcCTGAATGTTTGCA
AATTTTTGC
gctctagaatggtgaatacaacgcaaaaaatc
Creation of VopQ
R_xhoI_VopQ150
ccgctcgagctggttttccaaactgacct
CyA fusion
Fwd-Check-VP1767
agcggtattgctgagttgtttg
Rev-Check-VP1767
ctcccgaaggagcctattcac
Fwd-Check-VP2698
ccaagcgtggttagtgcaagg
Rev-Check-VP2698
catgcgattaacctgcacttgg
Fwd-Check-VP1611
gcagtaaagtggatcggtaaatgg
Rev-Check-VP1611
tacgaaagcgacgcagaaac
DM4_Fwd
aaagcaccgccggacatcag
R5_VP1767_DM4
F3_VP1767_DM4
R3_VP1767_DM4
DM4_Rev
ggatgtaacgcactgagaagc
For the DM4 primers, capital letters highlight the region of the oligonucleotide that anneals with the
corresponding gene and lowercase letters with the nucleotides that anneal with the pDM4 plasmid.
ThecompletecDNAsequenceofnativeandsgRNAresistantversionisasfollows(inyellowis
thesgRNAsequenceandingreenthePAMsequence):
>cDNA_SLC35C1_native
ATGAATAGGGCCCCTCTGAAGCGGTCCAGGATCCTGCACATGGCGCTGACCGGGGCCTCAGACCCCTCTGCA
GAGGCAGAGGCCAACGGGGAGAAGCCCTTTCTGCTGCGGGCATTGCAGATCGCGCTGGTGGTCTCCCTCTAC
TCGGTCACCTCCATCTCCATGGTGTTCCTTAATAAGTACCTGCTGGACAGCCCCTCCCTGCGGCTGGACACCC
CCATCTTCGTCACCTTCTACCAGTGCCTGGTGACCACGCTGCTGTGCAAAGGCCTCAGCGCTCTGGCCGCCTG
CTGCCCTGGTGCCGTGGACTTCCCCAGCTTGCGCCTGGACCTCAGGGTGGCCCGCAGCGTCCTGCCCCTGTCG
GTGGTCTTCATCGGCATGATCACCTTCAATAACCTCTGCCTCAAGTACGTCGGTGTGGCCTTCTACAATGTG
GGCCGCTCACTCACCACCGTCTTCAACGTGCTGCTCTCCTACCTGCTGCTCAAGCAGACCACCTCCTTCTATG
CCCTGCTCACCTGCGGTATCATCATCGGGGGCTTCTGGCTTGGTGTGGACCAGGAGGGGGCAGAAGGCACCC
TGTCGTGGCTGGGCACCGTCTTCGGCGTGCTGGCTAGCCTCTGTGTCTCGCTCAACGCCATCTACACCACGAA
GGTGCTCCCGGCGGTGGACGGCAGCATCTGGCGCCTGACTTTCTACAACAACGTCAACGCCTGCATCCTCTTC
CTGCCCCTGCTCCTGCTGCTCGGGGAGCTTCAGGCCCTGCGTGACTTTGCCCAGCTGGGCAGTGCCCACTTCT
GGGGGATGATGACGCTGGGCGGCCTGTTTGGCTTTGCCATCGGCTACGTGACAGGACTGCAGATCAAGTTCA
CCAGTCCGCTGACCCACAATGTGTCGGGCACGGCCAAGGCCTGTGCCCAGACAGTGCTGGCCGTGCTCTACT
ACGAGGAGACCAAGAGCTTCCTCTGGTGGACGAGCAACATGATGGTGCTGGGCGGCTCCTCCGCCTACACCT
GGGTCAGGGGCTGGGAGATGAAGAAGACTCCGGAGGAGCCCAGCCCCAAAGACAGCGAGAAGAGCGCCATG
GGGGTG
>SLC35C1_sgRNA_resistant
ATGAATAGGGCCCCTCTGAAGCGGTCCAGGATCCTGCACATGGCGCTGACCGGGGCCTCAGACCCCTCTGCA
GAGGCAGAGGCCAACGGGGAGAAGCCCTTTCTGCTGCGGGCATTGCAGATCGCGCTGGTGGTCTCCCTCTAC
TCGGTCACCTCCATCTCCATGGTGTTCCTTAATAAGTACCTGCTGGACAGCCCCTCCCTGCGGCTGGACACCC
CCATCTTCGTCACCTTCTACCAGTGCCTGGTGACCACGCTGCTGTGCAAAGGCCTCAGCGCTCTGGCCGCCTG
CTGCCCTGGTGCCGTGGACTTCCCCAGCTTGCGCCTGGACCTCAGGGTGGCCCGCAGCGTCCTGCCCCTGTCG
GTGGTCTTCATCGGCATGATCACCTTCAATAACCTCTGCCTCAAGTACGTCGGTGTGGCCTTCTACAATGTG
GGCCGCTCACTCACCACCGTCTTCAACGTGCTGCTCTCCTACCTGCTGCTCAAGCAGACCACCTCCTTCTATG
CCCTGCTCACCTGCGGTATCATCATCGGGGGCTTCTGGCTTGGTGTGGACCAGGAGGGGGCAGAAGGCACCC
TGTCGTGGCTGGGCACCGTCTTCGGCGTGCTGGCTAGCCTCTGTGTCTCGCTCAACGCCATCTACACCACGAA
GGTGCTCCCGGCGGTGGACGGCAGCATCTGGCGCCTGACTTTCTACAACAACGTCAACGCCTGCATCCTCTTC
CTGCCCCTGCTCCTGCTGCTCGGGGAGCTTCAGGCCCTGCGTGACTTTGCCCAGCTGGGCAGTGCCCACTTCT
GGGGGATGATGACGCTGGGCGGCCTGTTTGGCTTTGCAATCGGCTACGTGACAGGACTGCAGATCAAGTTCA
CCAGTCCGCTGACCCACAATGTGTCGGGCACGGCCAAGGCCTGTGCCCAGACAGTGCTGGCCGTGCTCTACT
ACGAGGAGACCAAGAGCTTCCTCTGGTGGACGAGCAACATGATGGTGCTGGGCGGCTCCTCCGCCTACACCT
GGGTCAGGGGCTGGGAGATGAAGAAGACTCCGGAGGAGCCCAGCCCCAAAGACAGCGAGAAGAGCGCCATG
GGGGTG
>cDNA_SLC35B2_native
ATGGACGCCAGATGGTGGGCAGTGGTGGTGCTGGCTGCGTTCCCCTCCCTAGGGGCAGGTGGGGAGACTCCC
GAAGCCCCTCCGGAGTCATGGACCCAGCTATGGTTCTTCCGATTTGTGGTGAATGCTGCTGGCTATGCCAGC
TTTATGGTACCTGGCTACCTCCTGGTGCAGTACTTCAGGCGGAAGAACTACCTGGAGACCGGTAGGGGCCTC
TGCTTTCCCCTGGTGAAAGCTTGTGTGTTTGGCAATGAGCCCAAGGCCTCTGATGAGGTTCCCCTGGCGCCC
CGAACAGAGGCGGCAGAGACCACCCCGATGTGGCAGGCCCTGAAACTGCTCTTCTGTGCCACAGGGCTCCAG
GTGTCTTATCTGACTTGGGGTGTGCTGCAGGAAAGAGTGATGACCCGCAGCTATGGGGCCACAGCCACATCA
CCGGGTGAGCGCTTTACGGACTCGCAGTTCCTGGTGCTAATGAACCGAGTGCTGGCACTGATTGTGGCTGGC
CTCTCCTGTGTTCTCTGCAAGCAGCCCCGGCATGGGGCACCCATGTACCGGTACTCCTTTGCCAGCCTGTCCA
ATGTGCTTAGCAGCTGGTGCCAATACGAAGCTCTTAAGTTCGTCAGCTTCCCCACCCAGGTGCTGGCCAAGG
CCTCTAAGGTGATCCCTGTCATGCTGATGGGAAAGCTTGTGTCTCGGCGCAGCTACGAACACTGGGAGTACC
TGACAGCCACCCTCATCTCCATTGGGGTCAGCATGTTTCTGCTATCCAGCGGACCAGAGCCCCGCAGCTCCCC
AGCCACCACACTCTCAGGCCTCATCTTACTGGCAGGTTATATTGCTTTTGACAGCTTCACCTCAAACTGGCA
GGATGCCCTGTTTGCCTATAAGATGTCATCGGTGCAGATGATGTTTGGGGTCAATTTCTTCTCCTGCCTCTT
CACAGTGGGCTCACTGCTAGAACAGGGGGCCCTACTGGAGGGAACCCGCTTCATGGGGCGACACAGTGAGTT
TGCTGCCCATGCCCTGCTACTCTCCATCTGCTCCGCATGTGGCCAGCTCTTCATCTTTTACACCATTGGGCAG
TTTGGGGCTGCCGTCTTCACCATCATCATGACCCTCCGCCAGGCCTTTGCCATCCTTCTTTCCTGCCTTCTCT
ATGGCCACACTGTCACTGTGGTGGGAGGGCTGGGGGTGGCTGTGGTCTTTGCTGCCCTCCTGCTCAGAGTCT
ACGCGCGGGGCCGTCTAAAGCAACGGGGAAAGAAGGCTGTGCCTGTTGAGTCTCCTGTGCAGAAGGTT
>SLC35B2_sgRNA_resistant
ATGGACGCCAGATGGTGGGCAGTGGTGGTGCTGGCTGCGTTCCCCTCCCTAGGGGCAGGTGGGGAGACTCCC
GAAGCCCCTCCGGAGTCATGGACCCAGCTATGGTTCTTCCGATTTGTGGTGAATGCTGCTGGCTATGCCAGC
TTTATGGTACCTGGCTATCTCCTGGTGCAGTACTTCAGGCGGAAGAACTACCTGGAGACCGGTAGGGGCCTC
TGCTTTCCCCTGGTGAAAGCTTGTGTGTTTGGCAATGAGCCCAAGGCCTCTGATGAGGTTCCCCTGGCGCCC
CGAACAGAGGCGGCAGAGACCACCCCGATGTGGCAGGCCCTGAAACTGCTCTTCTGTGCCACAGGGCTCCAG
GTGTCTTATCTGACTTGGGGTGTGCTGCAGGAAAGAGTGATGACCCGCAGCTATGGGGCCACAGCCACATCA
CCGGGTGAGCGCTTTACGGACTCGCAGTTCCTGGTGCTAATGAACCGAGTGCTGGCACTGATTGTGGCTGGC
CTCTCCTGTGTTCTCTGCAAGCAGCCCCGGCATGGGGCACCCATGTACCGGTACTCCTTTGCCAGCCTGTCCA
ATGTGCTTAGCAGCTGGTGCCAATACGAAGCTCTTAAGTTCGTCAGCTTCCCCACCCAGGTGCTGGCCAAGG
CCTCTAAGGTGATCCCTGTCATGCTGATGGGAAAGCTTGTGTCTCGGCGCAGCTACGAACACTGGGAGTACC
TGACAGCCACCCTCATCTCCATTGGGGTCAGCATGTTTCTGCTATCCAGCGGACCAGAGCCCCGCAGCTCCCC
AGCCACCACACTCTCAGGCCTCATCTTACTGGCAGGTTATATTGCTTTTGACAGCTTCACCTCAAACTGGCA
GGATGCCCTGTTTGCCTATAAGATGTCATCGGTGCAGATGATGTTTGGGGTCAATTTCTTCTCCTGCCTCTT
CACAGTGGGCTCACTGCTAGAACAGGGGGCCCTACTGGAGGGAACCCGCTTCATGGGGCGACACAGTGAGTT
TGCTGCCCATGCCCTGCTACTCTCCATCTGCTCCGCATGTGGCCAGCTCTTCATCTTTTACACCATTGGGCAG
TTTGGGGCTGCCGTCTTCACCATCATCATGACCCTCCGCCAGGCCTTTGCCATCCTTCTTTCCTGCCTTCTCT
ATGGCCACACTGTCACTGTGGTGGGAGGGCTGGGGGTGGCTGTGGTCTTTGCTGCCCTCCTGCTCAGAGTCT
ACGCGCGGGGCCGTCTAAAGCAACGGGGAAAGAAGGCTGTGCCTGTTGAGTCTCCTGTGCAGAAGGTT