Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cytokinesis wikipedia , lookup
Cell growth wikipedia , lookup
Extracellular matrix wikipedia , lookup
Tissue engineering wikipedia , lookup
Cell culture wikipedia , lookup
Cell encapsulation wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Cellular differentiation wikipedia , lookup
Article CRISPR/Cas9 Screens Reveal Requirements for Host Cell Sulfation and Fucosylation in Bacterial Type III Secretion System-Mediated Cytotoxicity Graphical Abstract Authors Carlos J. Blondel, Joseph S. Park, Troy P. Hubbard, ..., Benjamin E. Gewurz, John G. Doench, Matthew K. Waldor Correspondence [email protected] In Brief Type III secretion systems (T3SSs) underlie the virulence of many bacterial pathogens, but the required host factors remain largely undefined. Blondel et al. harness CRISPR/Cas9 technology to perform genome-wide screens and identify requirements for host cell sulfation and fucosylation in conferring susceptibility to T3SS-mediated killing by Vibrio parahaemolyticus. Highlights d Genome-wide CRISPR screens reveal host factors facilitating T3SS cytotoxicity d Distinct host pathways confer susceptibility to V. parahaemolyticus’s T3SS1 and T3SS2 d Sulfation promotes bacterial adhesion and downstream T3SS1-associated cytotoxicity d Fucosylated glycans promote insertion of the T3SS2 translocon into host membranes Blondel et al., 2016, Cell Host & Microbe 20, 226–237 August 10, 2016 ª 2016 Elsevier Inc. http://dx.doi.org/10.1016/j.chom.2016.06.010 Cell Host & Microbe Article CRISPR/Cas9 Screens Reveal Requirements for Host Cell Sulfation and Fucosylation in Bacterial Type III Secretion System-Mediated Cytotoxicity Carlos J. Blondel,1,2 Joseph S. Park,1,2,3,4 Troy P. Hubbard,1,2 Alline R. Pacheco,1,2 Carole J. Kuehl,1,2 Michael J. Walsh,1,2 Brigid M. Davis,1,2 Benjamin E. Gewurz,1,2 John G. Doench,5 and Matthew K. Waldor1,2,3,* 1Division of Infectious Diseases, Brigham and Women’s Hospital, Boston, MA 02115, USA of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115, USA 3Howard Hughes Medical Institute, Boston, MA 02115, USA 4Boston University School of Medicine, Boston, MA 02118, USA 5Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.chom.2016.06.010 2Department SUMMARY Type III secretion systems (T3SSs) inject bacterial effector proteins into host cells and underlie the virulence of many gram-negative pathogens. Studies have illuminated bacterial factors required for T3SS function, but the required host processes remain largely undefined. We coupled CRISPR/Cas9 genome editing technology with the cytotoxicity of two Vibrio parahaemolyticus T3SSs (T3SS1 and T3SS2) to identify human genome disruptions conferring resistance to T3SS-dependent cytotoxicity. We identity non-overlapping genes required for T3SS1and T3SS2-mediated cytotoxicity. Genetic ablation of cell surface sulfation reduces bacterial adhesion and thereby alters the kinetics of T3SS1-mediated cytotoxicity. Cell surface fucosylation is required for T3SS2-dependent killing, and genetic inhibition of fucosylation prevents membrane insertion of the T3SS2 translocon complex. These findings reveal the importance of ubiquitous surface modifications for T3SS function, potentially explaining the broad tropism of V. parahaemolyticus, and highlight the utility of genome-wide CRISPR/Cas9 screens to discover processes underlying host-pathogen interactions. INTRODUCTION The virulence of many human, animal, and plant pathogens depends on type III secretion systems (T3SSs). These multicomponent nanomachines enable gram-negative pathogens to inject a repertoire of effector proteins directly into the cytosol of eukaryotic host cells (reviewed in Portaliou et al., 2016). T3SSs are composed of a basal body found within the pathogen cell envelope, a needle that extends from the bacterial surface to the host cell, and a tip complex that creates a pore in the host cell membrane. This pore, termed the translocon, consists of several bac- terial proteins that form a conduit through which effectors are translocated into the host cytoplasm. T3SSs from different pathogens transfer distinct sets of effectors that can enable pathogen adhesion, internalization, or modulation of diverse host processes, often redundantly (Shames and Finlay, 2012). The Gram-negative marine bacterium Vibrio parahaemolyticus is a leading cause worldwide of gastroenteritis linked to the consumption of contaminated seafood and is a cause of major economic losses for the aquaculture industry (reviewed in Letchumanan et al., 2014). All V. parahaemolyticus strains harbor genes encoding a T3SS on their large chromosome, T3SS1. Nearly all clinical isolates produce a second, evolutionarily distinct T3SS, T3SS2 (Abby and Rocha, 2012; Hazen et al., 2015), which is encoded within a pathogenicity island on the small chromosome (Park et al., 2004; Sugiyama et al., 2008). The two V. parahaemolyticus T3SSs are functionally independent, and each translocates its own set of effector proteins (Park et al., 2004). Although T3SS1 activity causes marked cytotoxicity in a variety of cultured human cell lines, studies with animal models suggested that this secretion system plays at most a minor role in the pathogenesis of V. parahaemolyticus enteritis (Piñeyro et al., 2010; Ritchie et al., 2012). The universality of T3SS1 among V. parahaemolyticus isolates, and the absence of a virulence defect in T3SS1 mutants in orogastric animal models suggests that this secretion system may contribute to environmental fitness, perhaps through targeting of predatory marine eukaryotes. In contrast, studies in animal models demonstrate that T3SS2 is essential for V. parahaemolyticus to colonize the intestine and to cause enteritis (Piñeyro et al., 2010; Ritchie et al., 2012). T3SS2 also has cytotoxic activity against predatory protists and thus may promote V. parahaemolyticus survival in the environment (Matz et al., 2011). Decades of research have led to deep knowledge of T3SS structure, assembly, and function, as well as of the biochemical activities and eukaryotic targets of individual effector proteins (Dean, 2011; Galán et al., 2014). However, our understanding of host factors that enable the targeting of T3SSs to host cells is more rudimentary. To date, most attempts to identify such factors have relied on focused biochemical approaches (e.g., Lafont et al., 2002). Only two genetic screens—employing either small interfering RNA or haploid cell technology—have been carried 226 Cell Host & Microbe 20, 226–237, August 10, 2016 ª 2016 Elsevier Inc. (legend on next page) Cell Host & Microbe 20, 226–237, August 10, 2016 227 out to find host factors important for T3SS function (Russo et al., 2016; Sheahan and Isberg, 2015). The development of CRISPR/Cas9 technology, which allows generation of complete loss-of-function alleles in a variety of cell types, is transforming functional genetic analyses in higher eukaryotes (Shalem et al., 2014; Shi et al., 2015; Wang et al., 2014; Douda and Charpentier, 2014). Here, we used CRISPR/ Cas9-based screening to identify disruptions in human protein coding genes that confer resistance to the activity of evolutionarily divergent T3SSs. These screens revealed that distinct host cell pathways confer susceptibility to T3SS1 and T3SS2 killing. Cell surface sulfation was important for bacterial adhesion and T3SS1 killing but dispensable for T3SS2 killing. In contrast, T3SS2 killing was dependent on cell surface fucosylation, which was critical for T3SS2 translocon insertion into host cell membranes. Thus, there is significant heterogeneity in the host factors targeted by different T3SSs. Our study demonstrates the utility and potency of CRISPR/Cas9-based genetic screens for investigations of host-pathogen interactions. RESULTS CRISPR/Cas9 Screens Identify Host Factors Required for T3SS1 or T3SS2 Cytotoxicity V. parahaemolyticus producing either T3SS1 or T3SS2 induces rapid cell death in human cells (Burdette et al., 2008; Kodama et al., 2007) but with distinct kinetics. To identify phenotypes attributable to an individual T3SS, we generated isogenic V. parahaemolyticus strains with deletions in the ATPase-encoding component of either T3SS1 (DvscN1, T3SS2+) or T3SS2 (DvscN2, T3SS1+). While T3SS1 kills more than 80% of HT-29 intestinal epithelial cells within 1.5 hr of infection, T3SS2 reaches the same levels after 2.5 hr (Figure 1A). We harnessed the robust selection by V. parahaemolyticus’s two T3SSs to identify host cell targets whose disruption confers resistance to T3SS-mediated cytotoxicity. Using the Avana CRISPR human genome-wide library (Doench et al., 2016), we targeted each protein-coding gene in the human intestinal epithelial cell line HT-29 with four singleguide RNAs (sgRNAs) (for a total of 74,700 sgRNAs). Seven days after introduction of the CRISPR library in independent biological replicates (replicates A and B) (Figures S1A and S1B), cells were infected with V. parahaemolyticus producing either T3SS1 or T3SS2. To standardize the magnitude of selection between the different screens, infections were carried out for 1.5 hr (T3SS1 selections) or 2.5 hr (T3SS2 selections) based on the kinetics noted earlier. Survivor cells were outgrown, and the process was repeated for three total rounds of infection to enrich for resistant cells (Figure 1B). Deep sequencing of integrated sgRNAs before and after each round of infection revealed that a small subset of sgRNAs became increasingly overrepresented after each round of selection (Figure 1C; Figures S1 and S2). We used the STARS algorithm, which integrates data from independent guides targeting the same gene, to identify the most enriched genotypes. In general, our data display a strong concordance between independent guides within the same library and between independent libraries (Figures 1D and 1E; Table S3). For each T3SS screen, we observed enrichment of sgRNAs targeting multiple genes that contribute to a single biological process. Based on a statistically significant enrichment (p < 0.001) in both biological replicates, T3SS1 resistance was associated with sgRNAs targeting multiple genes important for cell surface sulfation, the SWI/SNF chromatin remodeling complex, and collagen synthesis. T3SS2 resistance was largely associated with sgRNAs targeting genes involved in fucosylation of glycans exported to the cell surface, serine-threonine kinases, and a spectrin subunit. The disparity between hits from T3SS1 and those from T3SS2 screens suggests that disruption of distinct host factors confers resistance to these 2 T3SSs. To validate the screening results, HT-29 cells containing disruptions of individual genes were generated (Figure S3A). Disruption of at least one gene from each pathway identified was found to specifically augment resistance to either T3SS1or T3SS2-mediated death (Figures S3B and S3C). Maximal resistance to T3SS1 and T3SS2 was observed with mutants that disrupt cell surface sulfation and fucosylation, respectively (Figures 1F and 1G), leading us to further investigate the role of these host cell surface modifications in V. parahaemolyticusmediated cytotoxicity. Host Cell Surface Sulfation Facilitates T3SS1 Killing via V. parahaemolyticus Adherence Human cell surface sulfation depends upon transport of a sulfate donor, 30 -phosphoadenosine-50 -phosphosulfate (PAPS), into the Golgi apparatus by antiporters encoded by the SLC35B2 and SLC35B3 genes (Kamiyama et al., 2011, 2003). Within the Golgi, sulfotransferases (e.g., the heparan sulfate 6-O-sulfotransferase HS6ST1) catalyze transfer of a sulfate group from PAPS to glycosaminoglycans (GAGs) (Figure 2A) (Habuchi et al., 1995). SLC35B2 disruption reduces the total sulfation of GAGs (e.g., heparan sulfate) and N-glycans in human cells (Kamiyama et al., 2011), while individual sulfotransferase mutations are expected to have a more modest effect. In agreement with this, the SLC35B2 mutant cells exhibited a more severe reduction in cell surface binding to a heparan sulfate-specific antibody than did HS6ST1 mutant cells (Figure 2B). Disruption of SLC35B2 protected against T3SS1-mediated killing but not T3SS2-mediated killing (Figures 1F and 1G). Killing Figure 1. CRISPR/Cas9 Screen Reveals Coherent and Distinct Pathways Involved in Resistance to T3SS Killing (A) Kinetics of T3SS-dependent HT-29 cell death. The duration of infection for the T3SS1 (red) and T3SS2 (blue) screens is marked with dotted lines. (B) Workflow and screening strategy for the CRISPR/Cas9 screens. (C) Scatterplots showing enrichment of specific sgRNAs in the T3SS1 and T3SS2 screens after each round of infection. The sgRNAs targeting the same gene are highlighted with the same color. The values correspond to log2 of normalized reads (see Table S2 for data). (D and E) Statistical significance of the gene candidates from the T3SS1 (D) and T3SS2 (E) screens in both biological replicates analyzed by STARS. Candidates for follow-up had p < 0.001 in both biological replicates. The colors of spheres indicate the associated biological process. See also Table S3. (F and G) Survival of HT-29 cells and mutant cells following infection with T3SS1+ or T3SS2+ bacteria for 1.5 or 2.5 hr, respectively. See also Figures S3B and S3C. Data are mean with SEM (n = 3). The p values (*p < 0.05, **p < 0.001) are based on one-way ANOVA with Dunnet post-test correction. 228 Cell Host & Microbe 20, 226–237, August 10, 2016 A C B D Figure 2. Cell Surface Sulfation Promotes T3SS1 Cytotoxicity (A) Overview of sulfated proteoglycan synthesis, highlighting mutations conferring resistance to T3SS1 cytotoxicity. (B) Flow cytometry profiles of HT-29 and mutant cells bound to a heparan sulfate-specific antibody (10E4-FITC). FITC, fluorescein isothiocyanate; GMFI, geometric mean fluorescence intensity. (C) Survival of HT-29 cells treated with the sulfation inhibitor sodium chlorate before T3SS1 and T3SS2 infection. (D) T3SS1 killing and sulfation of SLC35B2 mutant cells expressing a sgRNA-resistant SLC35B2 cDNA. Data are mean with SEM (n = 3). The p values (***p < 0.0001) are based on one-way ANOVA with Dunnet post-test correction. and partial surface sulfation of the SLC35B2 mutant was restored by introduction of a cDNA encoding a sgRNA-resistant version of SLC35B2 (through a silent mutation at the protospacer adjacent motif [PAM] site) (Figure 2D). Disruption of HS6ST1 also had a significant, though less marked, effect on T3SS1-mediated killing (Figures 1F and 1G), and treatment of HT-29 cells with sodium chlorate, an inhibitor of ATP sulfurylase (a key enzyme in PAPS synthesis) (Safaiyan et al., 1999), resulted in dose-dependent and specific protection against T3SS1-mediated death (Figure 2C). Thus, both genetic and pharmacological data indicate that host cell sulfation promotes T3SS1 cytotoxicity. Sulfated GAGs (e.g., heparan, chondroitin, and dermatan) are the principal sulfated molecules in host cells, and they exist as membrane-bound or secreted proteoglycans (Sarrazin et al., 2011). Our screen identified factors that contribute to GAG sulfation but did not yield genes for synthesis of specific proteoglycans, suggesting that sulfated GAGs in general, rather than a particular proteoglycan, may confer susceptibility to T3SS1dependent killing by V. parahaemolyticus. Consistent with this idea, we found that coating the sulfation-deficient SLC35B2 mutant with the sulfated GAGs heparin, dermatan sulfate, or chondroitin sulfate increased the susceptibility of the SLC35B2 mutant to T3SS1 killing but that treatment with hyaluronic acid, a non-sulfated GAG, did not (Figure 3A). Coating of HT-29 cells with heparin did not increase susceptibility, suggesting that endogenous levels of GAGs are not limiting for T3SS1-dependent cell death (Figure 3A). These data also indicate that structurally diverse sulfated GAGs associated with the surface of host cells can promote V. parahaemolyticus T3SS1 toxicity even in the absence of covalent linkages between GAGs and specific cell surface proteins. The dependence of T3SS1 cytotoxicity on host cell sulfation is not restricted to HT-29 cells. Sodium chlorate treatment protected all four additional cell lines tested (including Chinese hamster ovary [CHO] cells) from T3SS1 killing (Figure S4A). Furthermore, a CHO cell derivative devoid of GAGs (CHO pgsA-745 cells) (Ludington and Ward, 2016) exhibited enhanced resistance to T3SS1 killing (Figure S4B). In contrast, a CHO derivative that does not synthesize heparan sulfate but produces high levels of chondroitin sulfate (CHO pgsD-677) was as susceptible as the parental cell line to T3SS1 killing, consistent with the observation that diverse sulfated GAGs can mediate cytotoxicity. Because heparan sulfate proteoglycans mediate host attachment by a variety of bacterial and viral pathogens (Kamhi et al., 2013), we speculated that sulfated GAGs might promote T3SS1dependent cytotoxicity by facilitating V. parahaemolyticus adhesion to host cells. Consistent with this hypothesis, we found that V. parahaemolyticus adhesion to the SLC35B2 mutant cell line was lower than it was to the HT-29 cells, based on enumeration of bound colony-forming units (Figure 3B) or visualization of bound Cell Host & Microbe 20, 226–237, August 10, 2016 229 A B C D E F bacteria (Figure S5). Furthermore, addition of sulfated GAGs to culture media reduced V. parahaemolyticus adhesion and caused dose-dependent reduction in T3SS1-mediated death (but not T3SS2-mediated death), presumably by acting as decoy molecules, competing with endogenous GAGs in binding to adhesins (Figures 3A–3C; Figure S4C). A non-sulfated GAG, hyaluronic acid, had no effect on bacterial adhesion or T3SS1-mediated cytotoxicity (Figures 3A–3C). Collectively, these findings are consistent with the hypothesis that sulfated GAGs promote the adhesion of V. parahaemolyticus to host cells and thereby facilitate T3SS1 killing. SLC35B2 mutant cells were not absolutely resistant to T3SS1 killing but instead were killed with delayed kinetics compared to wild-type (WT) cells (Figure 3D; Figure S3D), suggesting that 230 Cell Host & Microbe 20, 226–237, August 10, 2016 Figure 3. Sulfated GAGs Facilitate T3SS1 Killing by Promoting Bacterial Adhesion (A) T3SS1 cytotoxicity toward HT-29 and SLC35B2 mutant cells without pretreatment (PBS); preincubated then washed (coating) with the GAGs (500 mg/ml) sulfated heparin (HS), dermatan sulfate (DS), chondroitin sulfate (CSA), or non-sulfated hyaluronic acid (HA); or infected in the presence of heparin (500 mg/ml) (blocking). (B) Adherence of T3SS V. parahaemolyticus to HT-29 and SLC35B2 mutant cells in presence of 500 mg/ml sulfated or non-sulfated GAGs. (C) Effect of GAGs on resistance of HT-29 cells to T3SS1 and T3SS2 killing. (D) Survival kinetics of host cells of varying genotypes following infection with T3SS1+ and T3SS V. parahaemolyticus. (E) Survival kinetics of HT-29 and SLC35B2 mutant cells during infection with T3SS1+, with T3SS1+ V. parahaemolyticus expressing the Afa-I adhesin, or with T3SS1+ following infection initiated with centrifugation of V. parahaemolyticus onto host cells (spin). (F) Translocation of the T3SS1 effector VopQ fused to CyA into different host cells by V. parahaemolyticus after a 20 min infection. Translocation into SLC35B2 cells was evaluated with and without centrifugation (spin) to enhance bacterial attachment. Data are mean with SEM (n = 3). The p values (*p < 0.01, **p < 0.001, ***p < 0.0001) are based on one-way ANOVA with Dunnet post-test correction. adhesion is a rate-limiting precursor to T3SS1 cytotoxicity, rather than an integral component. In support of this idea, we found that survival of the SLC35B2 mutant was markedly reduced when adherence of the T3SS1+ strain was augmented by expression of an exogenous, sulfation-independent adhesin, Afa-1 (Labigne-Roussel et al., 1984), or when centrifugation was used to force contact between V. parahaemolyticus and host cells (Figure 3E; Figure S4D). Centrifugation also abrogated a deficiency in translocation of a T3SS1 effector protein, VopQ, into SLC35B2 cells (Figure 3F). Overall, these data suggest that sulfated GAGs act upstream of T3SS1 to promote V. parahaemolyticus’s initial interaction with host cells, rather than interacting directly with components of the T3SS1 machinery. We created mutants lacking one or more of the three previously described V. parahaemolyticus adhesin-encoding genes (mam7, mshA1, and vpadF) (Boyd, 2014) that have been implicated in T3SS1 killing to test whether they interact with sulfated compounds and contribute to the sulfation-dependent adhesion of the pathogen to host cells. MshA1 has been reported to bind both sulfated and non-sulfated glycans, while MAM7 and VpadF are reported to bind fibrinogen and/or fibronectin. We found that deletion of vpadF resulted in a marked A B C Figure 4. MAM7, MshA1, and VpadF Promote Sulfation-Dependent Adhesion and T3SS1 Killing (A) Flow cytometry profile of T3SS1+ V. parahaemolyticus and derivatives lacking MAM7, MshA1, VpadF, or all of them, bound to heparin-FITC. FITC, fluorescein isothiocyanate; GMFI, geometric mean fluorescence intensity. (B) Kinetics of T3SS1 killing in bacteria lacking the adhesins MAM7, MshA1, and/or VpadF. (C) Survival of SLC35B2 cells infected with T3SS1+ and adhesin-deficient strains with or without heparin coating. Data are mean with SEM (n = 3). The p values (*p < 0.01) are based on one-way ANOVA with Dunnet post-test correction. reduction in heparin binding by V. parahaemolyticus, deletion of mshA1 or mam7 had a less pronounced effect, and the effects of these mutations were additive (Figure 4A). Thus, all three adhesins could contribute to sulfation-dependent cytotoxicity. To further explore the roles of these adhesins in T3SS1 activity, we measured the survival of HT-29 cells infected with control and adhesin-deficient T3SS1+ strains. No single adhesin mutation significantly reduced host cell killing; however, there was a significant delay in T3SS1 killing kinetics with the mam7/ mshA1 double mutant and an even longer delay with the mam7/mshA1/vpadF triple mutant (Figure 4B). Strikingly, the cytotoxicity of the triple mutant toward SLC35B2 cells was not increased by coating of host cells with heparin (Figure 4C). Collectively, these data suggest that MAM7, MshA1, and VpadF have partially redundant functions, consistent with the overlap that we have demonstrated among their targets. In addition, these observations provide compelling evidence that surface sulfation is recognized by bacterial adhesins and critical for V. parahaemolyticus’s interaction with host cells before T3SS1 cytotoxicity. Cell Surface Fucosylation Enables T3SS2 Cytotoxicity The sgRNAs targeting genes critical for fucosylation of host cell surface proteins conferred the greatest degree of resistance to V. parahaemolyticus T3SS2-dependent killing. These included GMD, which encodes a cytosolic enzyme that generates the charged fucose intermediate guanosine diphosphate (GDP) fucose, and SLC35C1, which encodes the sole Golgi importer of GDP fucose (Figures 1E and 5A) (Lühn et al., 2001). Within the Golgi, a variety of fucosyltransferases (FUTs)—including FUT4 (Figure 5A), encoded by another hit in the T3SS2 screen—transfer fucose to assembling glycan structures to generate fucosylated glycans that are then exported to the cell surface (Hadley et al., 2014). A uridine diphosphate galactose (UDP)-galactose transporter encoded by SLC35A2, which enables synthesis of certain FUT substrates (Becker and Lowe, 2003), was also identified (Figure 5A). Thus, the T3SS2 screen strongly suggests that fucosylated glycans created in the Golgi are important for T3SS2-induced cytotoxicity. In addition, the absence of hits in genes encoding particular fucosylated surface proteins and/or lipids suggests that there may not be a specific surface protein or lipid required for susceptibility to T3SS2 killing; instead, the screen results suggest that multiple fucosylated cell surface glycans could enable killing by T3SS2. Using individual sgRNAs targeting SLC35C1, GMD, FUT4, or SLC35A2, we confirmed that these factors contribute specifically to T3SS2 susceptibility (Figures 1F and 1G). Furthermore, analyses of surface fucosylation, using a variety of fucose-specific lectins, revealed a strong correlation between the reduction of glycan fucosylation and the extent of resistance to T3SS2 killing (Figures 5B and 5C). Little or no fucosylation was detected in the SLC35C1 mutant, and these cells were fully resistant to T3SS2 cytotoxicity even after extended infection. In contrast, limited surface fucosylation in the GMD, FUT4, and SLC35A2 mutants was still apparent with a subset of fucose-specific lectins (Ulex europaeus and Aleuria aurantia but not Lotus tetragonolobus), and these mutants exhibited delayed killing following infection. Pharmacological inhibition of glycan fucosylation by the GDP-fucose mimetic compound 2-fluorofucose (2-FF) likewise revealed a correlation between reduced fucosylation and increased resistance to T3SS2 killing; 2-FF treatment was protective for WT and GMD mutant HT-29 cells, as well as for a variety of unrelated cell lines (Figures 5E and 5F; Figure S6A). Finally, fucosylation and T3SS2 susceptibility of the HT-29 Cell Host & Microbe 20, 226–237, August 10, 2016 231 SLC35C1 mutant were restored by expression of a cDNA encoding a sgRNA-resistant version of SLC35C1 (Figure 5D), confirming the genetic link between surface fucosylation and T3SS2 cytotoxicity. The incomplete resistance of the FUT4-deficient cells, which are thought to lack a subset of a-1,3 fucosylated glycans but to maintain other linkages (e.g., a-1,2) (Figures 5B and 5C), suggested that more than one type of fucosylated glycan might confer susceptibility to T3SS2 killing. We took advantage of CHO cells, which are completely resistant to T3SS2 killing (Figure 5G), to more precisely define the link between surface fucosylation and T3SS2-mediated cytotoxicity. CHO cells only express one FUT, FUT8, which generates the a-1,6 core linkage in N-glycans (Xu et al., 2011), leaving them devoid of terminally fucosylated glycans (Figure 5H). Transduction of individual FUT genes into CHO cells yielded cell lines with distinct a-terminal a-fucose linkages, including a-1,2 linkages, such as found in the blood group H antigen (produced by FUT1), and a-1,3 linkages, such as found in the Sialyl LewisX blood group (produced by FUT7) and in the LewisX blood group (produced by FUT4 and FUT9) (Figure 5H). Despite their diverse products, each of the transduced FUTs rendered the corresponding CHO cell lines susceptible to T3SS2 killing (Figure 5G). Thus, terminal fucosylation in a variety of forms and contexts can mediate susceptibility to T3SS2 killing, and the specific identification of FUT4 in the screen likely reflects the major contribution of this FUT to fucosylation in HT-29 cells (Giordano et al., 2015). Host Cell Surface Fucosylation Facilitates T3SS2 Activity The resistance of sulfation-deficient host cells to T3SS1 cytotoxicity was not absolute, and it reflected decreased V. parahaemolyticus adhesion to resistant cells. In contrast, SLC35C1 mutant cells were not susceptible to T3SS2 cytotoxicity even after an extended infection period (Figure 5C; Figure S3E), suggesting that the absence of fucosylation affects a process downstream of the initial adherence of V. parahaemolyticus to host cells. Consistent with this hypothesis, we observed that adherence of T3SS-deficient (T3SS) V. parahaemolyticus to SLC35C1 mutant cells and to 2-FF treated HT-29 cells was indistinguishable from adherence to WT HT-29 cells (Figure 6A). Furthermore, unlike our results with the SLC35B2 mutant and T3SS1 cytotoxicity, death of the SLC35C1 mutant in response to T3SS2 infection was not augmented by expression of the exogenous adhesion Afa-I. Instead, the SLC35C1 cells remained fully resistant to T3SS2 killing (Figure 6B). The presence or absence of bacterial adhesins also did not affect T3SS2 cytotoxicity (Figure 6B), consistent with our observation (Figure 1F) that their sulfated GAG targets are not required for T3SS2-mediated cell death. Early in infection (20 min), the absence of sulfation-mediated adhesion moderately reduced T3SS2 effector translocation (Figure S6B). However, T3SS2 has been shown to promote bacterial attachment (Zhou et al., 2014), and our data suggest that the sulfationindependent translocation is sufficient to establish and maintain an association between bacteria and host cell. The resistance of the SLC35C1 mutant cells to T3SS2 cytotoxicity does not seem to reflect a failure of this strain to promote T3SS2 expression, although host-derived fucose does regulate 232 Cell Host & Microbe 20, 226–237, August 10, 2016 expression of T3SS genes in enterohaemorrhagic Escherichia coli (EHEC) (Pacheco et al., 2012). Culture media from HT-29 cells and SLC35C1 mutant cells infected with a T3SS2+ translocation reporter strain contained comparable amounts of an epitope-tagged effector protein, VopV-adenylate cyclase (CyA) (Figure S6C), demonstrating that functional T3SS2 is being produced during both infections. Furthermore, the addition of fucose to the media during T3SS2+ infection of SLC35C1 mutant cells did not render them susceptible to T3SS2 cytotoxicity (Figure 6B), nor did the induction of T3SS2 gene expression via overexpression of the transcriptional activator VtrB (Figure 6B) (Kodama et al., 2010). Collectively, these observations argue against the idea that deficient expression of T3SS2 during infection of the SLC35C1 mutant accounts for the mutant’s resistance to T3SS2 killing. Because the resistance of the SLC35C1 mutant cell line did not appear to be attributable to a general adhesion deficit or a reduction in T3SS2 expression, we investigated whether the extent of host cell surface fucosylation affected the translocation of T3SS2 effectors. We observed a marked reduction in translocation of the T3SS2 effector VopT into SLC35C1-deficient cells relative to HT-29 cells (Figure 6C). Translocation of VopT was also lower for HT-29 cells treated with 2-FF compared to untreated cells. Finally, we observed that translocation of VopT was markedly higher into CHO cells expressing FUT4 than into the parental cell line. Collectively, these data provide strong evidence that the extent of terminal glycan a-fucosylation correlates with T3SS2 activity against host cells. The reduced translocation of T3SS2 effector proteins into cells lacking terminally fucosylated glycans might reflect a requirement for fucosylation in host membrane insertion of the T3SS2 translocon complex. To test this hypothesis, we compared the amounts of hydrophobic T3SS2 translocon components, VopB2 and VopD2, in membranes of HT-29 and SLC35C1 mutant cells after V. parahaemolyticus (T3SS2+) infection. Both translocon proteins were detected in the membranes of infected HT-29 cells but not in SLC35C1 cells (Figure 6D), suggesting that terminally fucosylated glycans are required for T3SS2 killing because they facilitate translocon insertion into host cell membrane and thereby enable effector delivery. This requirement is specific to the T3SS2 injectisome, because cells lacking fucosylation (e.g., SLC35C1-deficient cells and CHO cells) are highly susceptible to T3SS1 killing. Thus, translocons from diverse T3SSs may require distinct host factors to facilitate their capacity to engage host cell membranes. DISCUSSION The advent of CRISPR/Cas9-based technology is revolutionizing our capacity to comprehensively interrogate gene function in higher eukaryotes (Hartenian and Doench, 2015; Shalem et al., 2014; Doudna and Charpentier, 2014). We used genome-wide CRISPR/Cas9 screens to identify host factors that sensitize human cells to V. parahaemolyticus T3SS-mediated killing. The screens identified distinct host cell surface modifications that enable each of V. parahaemolyticus’s two T3SSs to engage host cells. Sulfation, which contributes to adhesion mediated by several V. parahaemolyticus adhesins, promoted downstream cytotoxicity caused by T3SS1 but not by T3SS2. In contrast, (legend on next page) Cell Host & Microbe 20, 226–237, August 10, 2016 233 A B Figure 6. Fucosylation Is Required for T3SS2 Effector Translocation and Translocon Insertion but Not Bacterial Adhesion (A) Adhesion of T3SS V. parahaemolyticus to HT-29 cells alone, HT-29 cells treated with 50 mM 2-FF, or SLC35C1 mutant cells. The T3SS Dmam7 DmshA1 DvpadF strain was included as a negative control. (B) Survival kinetics of HT-29 and SLC35C1 mutant cells infected with T3SS2+ V. parahaemolyticus expressing the T3SS2 regulator VtrB or the adhesin Afa-I, infected in the presence of 10 mM fucose, or C D infected with a V. parahaemolyticus strain lacking MAM7, MshA1, and VpadF. (C) Translocation of the T3SS2 effector VopT fused to adenylate cyclase after a 45 min infection of HT-29 cells ± 50 mM 2-FF, SLC35C1 mutant cells, or CHO cells ± FUT4. See also Figure S6B. (D) Immunoblot of T3SS2 translocon components VopB2 and VopD2 in host cell membranes after infection with T3SS2+ V. parahaemolyticus. Blots were also probed with antibodies against the host membrane protein calnexin (loading or fractionation control) and bacterial RNA polymerase (RNAP), demonstrating absence of contaminating intact bacteria. Data are mean with SEM (n = 3). The p values (**p < 0.001, ***p < 0.0001) are based on one-way ANOVA with Dunnet post-test correction. cell surface fucosylation promotes T3SS2 translocon insertion, effector translocation, and associated cytotoxicity but is not required for T3SS1-mediated cytotoxicity. Thus, critical host factors required for T3SS function are not conserved between the two phylogenetically distinct T3SSs of V. parahaemolyticus. Sulfated proteoglycans, particularly those containing heparan sulfate, are known to promote host cell recognition and binding by a variety of viral, bacterial, and parasitic pathogens (Kamhi et al., 2013). However, there has been little indication to date that cell surface sulfation mediates V. parahaemolyticus interaction with host cells. We found that genetic or pharmacological ablation of host cell sulfation reduces V. parahaemolyticus adhesion to HT-29 cells and delays T3SS1-associated cytotoxicity. Sulfated GAGs promoted V. parahaemolyticus adhesion even when GAGs were not covalently bound to host cells; however, bacterial adhesion and associated cytotoxicity were blocked by the presence of excess sulfated GAGs, which likely serve as competitive inhibitors. The bacterial adhesins MAM7, MshA1, and VpadF are known to promote cytotoxicity through recognition of specific host proteins (Krachler and Orth, 2011; Liu and Chen, 2015; O’Boyle et al., 2013). Our data suggest that sulfated host GAGs potentiate bacterial adhesion by promoting early stages of binding between partially redundant adhesins and host cells before recognition of specific targets. Adhesins, like sulfation, are not required for T3SS1 killing; however, cytotoxicity is reduced in their absence, apparently due to delayed bacterial association with host cells. Thus, interactions between sulfated host cell surface molecules and bacterial adhesins are upstream facilitators, rather than intrinsic determinants of T3SS1 activity. Neither these adhesins nor host cell sulfation are required for cytotoxicity associated with T3SS2. In part, this likely reflects that T3SS2 cytotoxicity was assessed after a longer infection (2.5 hr) than T3SS1 cytotoxicity (1.5 hr) and thus is less dependent upon a rapid establishment of bacterial-host cell contact. Although translocation of T3SS2 effectors into sulfation-deficient host cells was reduced early after infection, this reduction did not affect T3SS2 killing assayed at 2.5 hr. T3SS2 cytotoxicity may not require accessory adhesins to stabilize interactions with host cells, because this system can promote V. parahaemolyticus adhesion to host cells through translocation of VopV (Zhou et al., 2014). Fucosylation of surface glycans was required for T3SS2 killing. Disruption of the Golgi fucose transporter gene SLC35C1, which eliminated detectable surface fucosylation, protected against T3SS2 but not T3SS1 killing. Selective expression of different Figure 5. Terminal Fucosylation Is Required for T3SS2 Cytotoxicity (A) Overview of the steps in the synthesis of fucosylated glycans, highlighting mutations conferring resistance to T3SS2 killing. (B) Flow cytometry profiles of HT-29 and mutant cells bound to fucose-specific fluorescein isothiocyanate (FITC)-conjugated lectins that recognize distinct fucosylation linkages. Charts below the graphs show geometric mean fluorescence intensity (GMFI). AAL, A. aurantia; LTL, L. tetragonolobus; UEA-1, U. europaeus lectin. (C) Kinetics of survival of HT-29 and mutant cells after infection with T3SS2+ or T3SS2 V. parahaemolyticus. (D) T3SS2 killing (top) and fucosylation (bottom) of WT, SLC35C1 mutant cells, and SLC35C1 mutant cells expressing a sgRNA-resistant SLC35C1 cDNA. (E) Impact of the fucosylation inhibitor 2-FF on T3SS1 and T3SS2 killing of HT-29 cells. (F) Impact of 2-FF on survival of different cell lines infected with T3SS2+ V. parahaemolyticus. (G) Kinetics of cell survival following T3SS2+ V. parahaemolyticus infection of CHO parental and mutant cells. (H) Lectin binding profiles for CHO cells transduced with FUT genes that generate diverse terminal fucose linkages. Structures of the CHO cell N-glycan core and various terminal fucosylated blood group antigens are shown on the right. Data are mean with SEM (n = 3). The p values (*p % 0.01, **p < 0.001) are based on one-way ANOVA with Dunnet post-test correction. 234 Cell Host & Microbe 20, 226–237, August 10, 2016 FUTs revealed that diverse terminal fucosylation products, but not core fucosylation, sensitize cells to T3SS2-mediated cytotoxicity. Our findings indicate that fucosylation plays a crucial role in insertion of hydrophobic T3SS2 translocon proteins into the host cell membrane, a process required for effector protein translocation and subsequent cytotoxicity. Given T3SS2’s essential role in virulence, our data suggest that the fucosylation status of the intestinal epithelium is a key determinant of the organism’s pathogenicity. The means by which fucosylation contributes to T3SS2 translocon insertion requires further definition; however, parallels with other biological systems are apparent. For example, interactions between fucosylated glycans (e.g., blood group antigens) and bacterial cholesterol-dependent pore forming toxins (e.g., pneumolysin and streptolysin O) promote insertion of these toxins within the host cell membrane, and binding to fucosylated glycans appears to promote host cell uptake of cholera toxin (Shewell et al., 2014; Wands et al., 2015). Thus, fucosylated surface molecules may serve as receptors for T3SS2 translocon components, whose binding may be an obligatory step in translocon insertion. Alternatively, host molecules may stabilize translocon complexes in the host membrane after insertion (Russo et al., 2016). Fucosylated glycans are dispensable for the action of T3SS1; thus, V. parahaemolyticus’s two T3SSs depend on distinct factors to engage host cells. Previous studies have also suggested there is heterogeneity in host determinants of T3SS susceptibility; for example, Yersinia pestis T3SS activity was found to depend on CCR5, a chemokine receptor (Sheahan and Isberg, 2015), and the Shigella flexneri translocon protein IpaB interacts with the host receptor CD44 (Skoudy et al., 2000). Given the apparent diversity in potential receptors for T3SSs, we speculate that different T3SSs have evolved distinct adaptations within their respective tip complexes—thought to sense the host cell and enable contact-dependent translocon insertion—that are fine-tuned to the diverse host cell types and environments in which they function. V. parahaemolyticus uses ubiquitous surface modifications, rather than discrete target proteins, which may underlie its T3SS activity in host organisms ranging from single-cell eukaryotes to humans. Our screen did not identify genes linked to lipid rafts or intermediate filament formation, which were previously shown to interact with translocon proteins by several enteric pathogens (Hayward et al., 2005; Lafont et al., 2002; Russo et al., 2016). It is possible that roles for these host factors were masked by cell-type-specific functional redundancy or essentiality that prevented scoring as hits in our screens. CRISPR/Cas9-based creation of comprehensive libraries of host cells with null mutations provides an invaluable functional genomics approach to the study of host-pathogen interactions. Identification of host factors that mediate susceptibility or resistance to infection not only yields critical insight into the evolution, emergence, and mechanisms of pathogenicity but also provides useful information for the development of therapeutic interventions aimed at blocking the host processes exploited by microbial pathogens. EXPERIMENTAL PROCEDURES See Supplemental Experimental Procedures for additional information. Construction of CRISPR/Cas9 Avana Libraries in HT-29 Cells The Avana CRISPR sgRNA library contains four sgRNAs targeting each of the annotated human protein coding genes (18,675 genes), as described in (Doench et al., 2016). HT-29 cells constitutively expressing Cas9 (HT-29 Cas9) were transduced by lentiviral spin infection to generate two independent libraries. The following considerations were taken into account during library construction. First, we aimed to achieve 5003 coverage (500 cells per perturbation); with 74.700 sgRNAs in the library, this translates into 40 3 106 infected cells. Second, because an MOI of less than 1 is desired to avoid insertions of multiple sgRNAs per cell, we titrated the Avana lentiviral library to obtain 30% infectivity on HT-29 Cas9 cells; therefore, a total of 135 3 106 cells were transduced. Then, 100 ml of 1.35 3 106 trypsinized HT-29 Cas9 cells/ml were prepared in DMEM 10% fetal bovine serum (FBS) supplemented with polybrene (8 mg/ml), and aliquoted (2 ml/well) among four 12-well format plates, along with concentrated virus. Lentiviral transduction was performed using spin infection conditions for 2 hr at 2,000 rpm. Plates were then incubated at 37 C with 5% CO2 for 6 hr, followed by seeding of 3 3 106 trypsinized cells in each of 45 T225 flasks. After 2 days of incubation, media were replaced with DMEM 10% FBS supplemented with puromycin (1 mg/ml). Following an additional 5–7 days of selection, transduced cells were trypsinized, counted, and seeded for the positive selection screen. The procedure was performed in duplicate to obtain two biological replicates of the HT-29 CRISPR/Cas9 library (libraries A and B). Positive Selection Screens Using the HT-29 CRISPR Avana Libraries Ten T225 flasks seeded with 8 3 106 cells each were incubated for 48 hr. HT-29 cells doubled every 48 hr, yielding 1.6 3 108 cells per experimental condition (2,0003 coverage per perturbation in each library). Three experimental conditions were seeded: (1) cells harvested as the library input, (2) cells used for the T3SS1 screen, and (3) cells used for the T3SS2 screen. The V. parahaemolyticus strains used for the two screens were cultured overnight and then diluted 1:100 into Luria-Bertani (LB) media and grown for 2.5 hr to optical density at 600 nm of 0.6. Expression of T3SS2 was induced with 0.04% bile (Gotoh et al., 2010). HT-29 cells were infected at an MOI of 1 and incubated at 37 C with 5% CO2 for either 1.5 hr (T3SS1 screen) or 2.5 hr (T3SS2 screen). After infection, media were replaced with fresh media supplemented with gentamicin (100 mg/ml). Fresh media with gentamicin were added again after overnight incubation. Flasks were evaluated daily to monitor recovery of survivor cells; when 50%–60% confluency was achieved, cells were trypsinized and passaged. At least 8 3 107 passaged cells were seeded to maintain a coverage of at least 1,0003. For the second and third rounds of infection, cells were propagated until at least 2.4 3 108 cells were obtained, allowing repetition of the infection procedure with ten T225 flasks per experimental condition and 2,0003 coverage. Genomic DNA Preparation, Sequencing, and Analyses of Screen Results Genomic DNA was obtained from 8 3 107 cells after each round of infection, as well as from the input cells using the Blood and Cell Culture DNA Maxi Kit from QIAGEN. PCR to amplify sgRNA sequences was performed as described (Doench et al., 2016). The read counts were first normalized to reads per million within each condition by the following formula: reads per sgRNA / total reads per condition 3 106. Reads per million were then log2 transformed by first adding 1 to all values to take the log of sgRNAs with zero reads (Table S2). For analyses, the log2 fold change of each sgRNA was determined relative to the input sample for each biological replicate. The STARS algorithm for CRISPR-based genetic perturbation screens was used to evaluate the rank and statistical significance of the 10% of perturbations from the ranked list, as described (Table S3) (Doench et al., 2016). SUPPLEMENTAL INFORMATION Supplemental Information includes Supplemental Experimental Procedures, six figures, and four tables and can be found with this article online at http:// dx.doi.org/10.1016/j.chom.2016.06.010. Cell Host & Microbe 20, 226–237, August 10, 2016 235 AUTHOR CONTRIBUTIONS Hartenian, E., and Doench, J.G. (2015). Genetic screens and functional genomics using CRISPR/Cas9 technology. FEBS J. 282, 1383–1393. C.J.B., B.E.G., J.G.D., and M.K.W. designed and conceived the study; C.J.B., J.S.P., A.R.P., T.P.H., C.J.K., and M.J.W. performed all experiments; and C.J.B., J.S.P., T.P.H., B.E.G., J.G.D., B.M.D., and M.K.W. analyzed data and wrote the manuscript. Hayward, R.D., Cain, R.J., McGhie, E.J., Phillips, N., Garner, M.J., and Koronakis, V. (2005). Cholesterol binding by the bacterial type III translocon is essential for virulence effector delivery into mammalian cells. Mol. Microbiol. 56, 590–603. ACKNOWLEDGMENTS We gratefully acknowledge Drs. Tetsuya Iida, Toshio Kodama, Marcia Goldberg, Judy Lieberman, and Honorine Ward for providing reagents and Emma W. Vaimberg and Yijie Ma for technical assistance. We thank members of the M.K.W. lab for helpful discussions. This work was supported by NIH (R37 AI-042347 to M.K.W., F31 AI-120665 to T.P.H., and R01 CA085180 to B.E.G.), and HHMI (M.K.W.). J.S.P. is supported by an HHMI medical research fellowship; C.J.B. was supported by the Pew Latin American Fellows Program in the Biomedical Sciences and a CONICYT BecasChile postdoctoral fellowship; J.G.D. is supported by the Next Generation Fund at the Broad Institute; and B.E.G. is supported by a Burroughs Wellcome Career award. Received: March 11, 2016 Revised: May 24, 2016 Accepted: June 17, 2016 Published: July 21, 2016 Hazen, T.H., Lafon, P.C., Garrett, N.M., Lowe, T.M., Silberger, D.J., Rowe, L.A., Frace, M., Parsons, M.B., Bopp, C.A., Rasko, D.A., and Sobecky, P.A. (2015). Insights into the environmental reservoir of pathogenic Vibrio parahaemolyticus using comparative genomics. Front Microbiol 6, 204. Kamhi, E., Joo, E.J., Dordick, J.S., and Linhardt, R.J. (2013). Glycosaminoglycans in infectious disease. Biol. Rev. Camb. Philos. Soc. 88, 928–943. Kamiyama, S., Suda, T., Ueda, R., Suzuki, M., Okubo, R., Kikuchi, N., Chiba, Y., Goto, S., Toyoda, H., Saigo, K., et al. (2003). Molecular cloning and identification of 30 -phosphoadenosine 50 -phosphosulfate transporter. J. Biol. Chem. 278, 25958–25963. Kamiyama, S., Ichimiya, T., Ikehara, Y., Takase, T., Fujimoto, I., Suda, T., Nakamori, S., Nakamura, M., Nakayama, F., Irimura, T., et al. (2011). Expression and the role of 30 -phosphoadenosine 50 -phosphosulfate transporters in human colorectal carcinoma. Glycobiology 21, 235–246. REFERENCES Kodama, T., Rokuda, M., Park, K.-S., Cantarelli, V.V., Matsuda, S., Iida, T., and Honda, T. (2007). Identification and characterization of VopT, a novel ADPribosyltransferase effector protein secreted via the Vibrio parahaemolyticus type III secretion system 2. Cell. Microbiol. 9, 2598–2609. Abby, S.S., and Rocha, E.P.C. (2012). The non-flagellar type III secretion system evolved from the bacterial flagellum and diversified into host-cell adapted systems. PLoS Genet. 8, e1002983. Kodama, T., Gotoh, K., Hiyoshi, H., Morita, M., Izutsu, K., Akeda, Y., Park, K.-S., Cantarelli, V.V., Dryselius, R., Iida, T., and Honda, T. (2010). Two regulators of Vibrio parahaemolyticus play important roles in enterotoxicity by controlling the expression of genes in the Vp-PAI region. PLoS ONE 5, e8678. Becker, D.J., and Lowe, J.B. (2003). Fucose: biosynthesis and biological function in mammals. Glycobiology 13, 41R–53R. Boyd, A. (2014). Manipulation of intestinal epithelial cell function by the cell contact-dependent type III secretion systems of Vibrio parahaemolyticus. Front. Cell Infect. Microbiol. 3, 114. Burdette, D.L., Yarbrough, M.L., Orvedahl, A., Gilpin, C.J., and Orth, K. (2008). Vibrio parahaemolyticus orchestrates a multifaceted host cell infection by induction of autophagy, cell rounding, and then cell lysis. Proc. Natl. Acad. Sci. USA 105, 12497–12502. Dean, P. (2011). Functional domains and motifs of bacterial type III effector proteins and their roles in infection. FEMS Microbiol. Rev. 35, 1100–1125. Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191. Doudna, J.A., and Charpentier, E. (2014). Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096. Galán, J.E., Lara-Tejero, M., Marlovits, T.C., and Wagner, S. (2014). Bacterial type III secretion systems: specialized nanomachines for protein delivery into target cells. Annu. Rev. Microbiol. 68, 415–438. Giordano, G., Febbraro, A., Tomaselli, E., Sarnicola, M.L., Parcesepe, P., Parente, D., Forte, N., Fabozzi, A., Remo, A., Bonetti, A., et al. (2015). Cancer-related CD15/FUT4 overexpression decreases benefit to agents targeting EGFR or VEGF acting as a novel RAF-MEK-ERK kinase downstream regulator in metastatic colorectal cancer. J. Exp. Clin. Cancer Res. 34, 108. Gotoh, K., Kodama, T., Hiyoshi, H., Izutsu, K., Park, K.-S., Dryselius, R., Akeda, Y., Honda, T., and Iida, T. (2010). Bile acid-induced virulence gene expression of Vibrio parahaemolyticus reveals a novel therapeutic potential for bile acid sequestrants. PLoS ONE 5, e13365. Habuchi, H., Habuchi, O., and Kimata, K. (1995). Purification and characterization of heparan sulfate 6-sulfotransferase from the culture medium of Chinese hamster ovary cells. J. Biol. Chem. 270, 4172–4179. Hadley, B., Maggioni, A., Ashikov, A., Day, C.J., Haselhorst, T., and Tiralongo, J. (2014). Comput. Struct. Biotechnol. J. 10, 23–32. 236 Cell Host & Microbe 20, 226–237, August 10, 2016 Krachler, A.M., and Orth, K. (2011). Functional characterization of the interaction between bacterial adhesin multivalent adhesion molecule 7 (MAM7) protein and its host cell ligands. J. Biol. Chem. 286, 38939–38947. Labigne-Roussel, A.F., Lark, D., Schoolnik, G., and Falkow, S. (1984). Cloning and expression of an afimbrial adhesin (AFA-I) responsible for P blood group-independent, mannose-resistant hemagglutination from a pyelonephritic Escherichia coli strain. Infect. Immun. 46, 251–259. Lafont, F., Tran Van Nhieu, G., Hanada, K., Sansonetti, P., and van der Goot, F.G. (2002). Initial steps of Shigella infection depend on the cholesterol/sphingolipid raft-mediated CD44-IpaB interaction. EMBO J. 21, 4449–4457. Letchumanan, V., Chan, K.-G., and Lee, L.-H. (2014). Vibrio parahaemolyticus: a review on the pathogenesis, prevalence, and advance molecular identification techniques. Front Microbiol 5, 705. Liu, M., and Chen, S. (2015). A novel adhesive factor contributing to the virulence of Vibrio parahaemolyticus. Sci. Rep. 5, 14449. Ludington, J.G., and Ward, H.D. (2016). The Cryptosporidium parvum C-type lectin CpClec mediates infection of intestinal epithelial cells via interactions with sulfated proteoglycans. Infect. Immun. 84, 1593–1602. Lühn, K., Wild, M.K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber, D. (2001). The gene defective in leukocyte adhesion deficiency II encodes a putative GDP-fucose transporter. Nat. Genet. 28, 69–72. Matz, C., Nouri, B., McCarter, L., and Martinez-Urtaza, J. (2011). Acquired type III secretion system determines environmental fitness of epidemic Vibrio parahaemolyticus in the interaction with bacterivorous protists. PLoS ONE 6, e20275. O’Boyle, N., Houeix, B., Kilcoyne, M., Joshi, L., and Boyd, A. (2013). The MSHA pilus of Vibrio parahaemolyticus has lectin functionality and enables TTSSmediated pathogenicity. Int. J. Med. Microbiol. 303, 563–573. Pacheco, A.R., Curtis, M.M., Ritchie, J.M., Munera, D., Waldor, M.K., Moreira, C.G., and Sperandio, V. (2012). Fucose sensing regulates bacterial intestinal colonization. Nature 492, 113–117. Park, K.-S., Ono, T., Rokuda, M., Jang, M.-H., Okada, K., Iida, T., and Honda, T. (2004). Functional characterization of two type III secretion systems of Vibrio parahaemolyticus. Infect. Immun. 72, 6659–6665. Piñeyro, P., Zhou, X., Orfe, L.H., Friel, P.J., Lahmers, K., and Call, D.R. (2010). Development of two animal models to study the function of Vibrio parahaemolyticus type III secretion systems. Infect. Immun. 78, 4551–4559. Portaliou, A.G., Tsolis, K.C., Loos, M.S., Zorzini, V., and Economou, A. (2016). Type III secretion: building and operating a remarkable nanomachine. Trends Biochem. Sci. 41, 175–189. Ritchie, J.M., Rui, H., Zhou, X., Iida, T., Kodoma, T., Ito, S., Davis, B.M., Bronson, R.T., and Waldor, M.K. (2012). Inflammation and disintegration of intestinal villi in an experimental model for Vibrio parahaemolyticus-induced diarrhea. PLoS Pathog. 8, e1002593. Russo, B.C., Stamm, L.M., Raaben, M., Kim, C.M., Kahoud, E., Robinson, L.R., Bose, S., Queiroz, A.L., Herrera, B.B., Baxt, L.A., et al. (2016). Intermediate filaments enable pathogen docking to trigger type 3 effector translocation. Nat. Microbiol. 1, 10625. Safaiyan, F., Kolset, S.O., Prydz, K., Gottfridsson, E., Lindahl, U., and Salmivirta, M. (1999). Selective effects of sodium chlorate treatment on the sulfation of heparan sulfate. J. Biol. Chem. 274, 36267–36273. Sarrazin, S., Lamanna, W.C., and Esko, J.D. (2011). Heparan sulfate proteoglycans. Cold Spring Harb. Perspect. Biol. 3, 1–33. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014). Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87. Shames, S.R., and Finlay, B.B. (2012). Bacterial effector interplay: a new way to view effector function. Trends Microbiol. 20, 214–219. Sheahan, K.-L., and Isberg, R.R. (2015). Identification of mammalian proteins that collaborate with type III secretion system function: involvement of a chemokine receptor in supporting translocon activity. MBio 6, 1–13. Shewell, L.K., Harvey, R.M., Higgins, M.A., Day, C.J., Hartley-Tassell, L.E., Chen, A.Y., Gillen, C.M., James, D.B.A., Alonzo, F., 3rd, Torres, V.J., et al. (2014). The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity. Proc. Natl. Acad. Sci. USA 111, E5312–E5320. Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y., Cai, T., Wang, F., and Shao, F. (2015). Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526, 660–665. Skoudy, A., Mounier, J., Aruffo, A., Ohayon, H., Gounon, P., Sansonetti, P., and Tran Van Nhieu, G. (2000). CD44 binds to the Shigella IpaB protein and participates in bacterial invasion of epithelial cells. Cell. Microbiol. 2, 19–33. Sugiyama, T., Iida, T., Izutsu, K., Park, K.-S., and Honda, T. (2008). Precise region and the character of the pathogenicity island in clinical Vibrio parahaemolyticus strains. J. Bacteriol. 190, 1835–1837. Wands, A.M., Fujita, A., McCombs, J.E., Cervin, J., Dedic, B., Rodriguez, A.C., Nischan, N., Bond, M.R., Mettlen, M., Trudgian, D.C., et al. (2015). Fucosylation and protein glycosylation create functional receptors for cholera toxin. eLife 4, e09545. Wang, T., Wei, J.J., Sabatini, D.M., and Lander, E.S. (2014). Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80–84. Xu, X., Nagarajan, H., Lewis, N.E., Pan, S., Cai, Z., Liu, X., Chen, W., Xie, M., Wang, W., Hammond, S., et al. (2011). The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line. Nat. Biotechnol. 29, 735–741. Zhou, X., Massol, R.H., Nakamura, F., Chen, X., Gewurz, B.E., Davis, B.M., Lencer, W.I., and Waldor, M.K. (2014). Remodeling of the intestinal brush border underlies adhesion and virulence of an enteric pathogen. MBio 5, e01639-14. Cell Host & Microbe 20, 226–237, August 10, 2016 237 Cell Host & Microbe, Volume 20 Supplemental Information CRISPR/Cas9 Screens Reveal Requirements for Host Cell Sulfation and Fucosylation in Bacterial Type III Secretion System-Mediated Cytotoxicity Carlos J. Blondel, Joseph S. Park, Troy P. Hubbard, Alline R. Pacheco, Carole J. Kuehl, Michael J. Walsh, Brigid M. Davis, Benjamin E. Gewurz, John G. Doench, and Matthew K. Waldor FigureS1 A Distribution of sgRNA in each replicate B sgRNA representation (log2normalized sgRNA counts) 10 5 0 Replicate A C Replicate B Replicate B 8 4 0 Input Round 1 Round 2 Round 3 sgRNA representation (log2normalized sgRNA counts) sgRNA representation (log2normalized sgRNA counts) Replicate A 12 12 8 T3SS1 screen 4 0 Input Replicate B 16 sgRNA representation (log2normalized sgRNA counts) sgRNA representation (log2normalized sgRNA counts) Replicate A 12 8 4 0 Input Round 1 Round 2 Round 3 Round 1 Round 2 Round 3 16 12 T3SS2 screen 8 4 0 Input Round 1 Round 2 Round 3 FigureS2 T3SS1screen T3SS2screen FigureS3 A HT-29 ARID1A 245kDa HT-29 TFAP4 αARID1A 39kDa αTFAP4 α GAPDH α CD71 HT-29 DPF2 44kDa αDPF2 αCD71 HT-29 SPTBN1 274kDa αSPTBN1 αGAPDH HT-29 STK11 αSTK11 49kDa αCD71 B C % Cell survival (Trypan blue exclusion) 80 ** 60 ** 40 * * * 20 Infection with T3SS2+ V. parahaemolyticus 0 Candidates from T3SS1 screen *** 100 80 60 ** * 40 Candidates from T3SS1 screen 80 HT-29 SLC35B2 60 40 20 0 % Cell viability (ATP levels) % Cell viability (ATP levels) 100 Candidates from T3SS2 screen 120 100 80 0.5 1.0 1.5 2.5 Hours of infection 3.5 HT-29 SLC35C1 60 40 20 0 0.0 * 0 E 120 * 20 Candidates from T3SS2 screen D * H SL TC 29 3 H 5B S C 6S 2 O T L1 1 7A SM TFA 1 AR P4 SM C AR A4 C B D 1 AR PF ID 2 1 P4 A N H C B SL KA C PI 35 C 1 SL GM C D 35 A FU 2 ST T4 SP K1 TB 1 M N1 AR K2 H SL TC3 29 H 5B S C 6S 2 O T L1 1 7A SM TFA 1 AR P4 SM C AR A4 CB D 1 AR PF ID 2 1 P A NC 4H B SL KA C PI 35 C 1 SL GM C3 D 5A FU 2 ST T4 SP K1 TB 1 M N1 AR K2 % Cell survival (Trypan blue exclusion) Infection with T3SS1+ V. parahaemolyticus 0.0 0.5 1.0 1.5 2.5 Hours of infection 3.5 FigureS4 A B PBS 40 NaClO3 30 20 10 0 HT-29 HeLa Caco-2 293T 120 % Cell survival (Trypan blue exclusion) % Cell survival (Trypan blue exclusion) 50 100 80 * 60 CHO CHO pgsA-745 no HS and no CS CHO pgsD-677 no HS and high CS 40 20 0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 CHO Hours of infection D 200 100 50 SL C3 5B 2 SL C3 5B 2 29 0 T- 0 150 H 10 T3SST3SS- with Afa-1 29 T3SS1 T3SS2 T- 20 ** H ** ** N H He T ep pa a H rin rin ep 6 ar -O in 2O N H He T ep pa H arin rin ep 6 ar -O in 2O % Cell survival (Trypan blue exclusion) 30 % of Adherence C GFP+ bacteria per 103 cells FigureS5 1000 T3SST3SSΔmam7 ΔmshA1 ΔvpadF 800 600 400 200 0 PBS HS HT-29 HA SLC35C1 SLC35B2 HT-29 SLC35B2 FigureS6 A Binding to FITC conjugated lectins 50µg/ml 2-FF 50µg/ml 2-FF 50µg/ml 2-FF 10µg/ml 2-FF 10µg/ml 2-FF 10µg/ml 2-FF Control Control B 177 cAMP (fmol/well) 8 24 1250 VopT-Cya 1000 * 241 177 24 C T3SS2 αCyA 500 250 * HT-29 SLC35C1 SLC35B2 10µg/ml 50µg/ml GMFI Control HT-29 2FF 2FF 8 VopV-CyA 750 0 AAL-FITC (α-1,2; α-1,3; α-1,4; α-1,6) 10µg/ml 50µg/ml GMFI Control HT-29 2FF 2FF 10µg/ml 50µg/ml GMFI Control HT-29 2FF 2FF 241 Control UEA-I-FITC (α-1,2) LTL-FITC (α-1,2; α-1,3) 8 HT-29 HT-29 HT-29 241 177 HT-29 SLC35C1 +- +- 24 Supplemental Figure Legends Figure S1. Representation of sgRNAs in HT-29 Cas9 libraries (related to Figure 1). (A) Box plot showing the distribution of sgRNA frequencies in each library before infection (input). (B) Scatter plot showing the correlation between the sgRNA frequencies in each HT-29 Cas9 library. (C) Box plots showing the change in the distribution of sgRNA frequencies after each round of infection for T3SS1 and T3SS2 screens and for both biological replicates (replicate A and replicate B). The line in the middle of the box corresponds to the median and the whiskers are drawn at the 5th percentile and at the 95th. Figure S2. Scatter plots showing enrichment of specific sgRNAs in the T3SS1 and T3SS2 screens (related to Figure 1). The plots show the enrichment after each round of infection and sgRNAs targeting the same gene are highlighted with the same color. The values correspond to l og2 of normalized reads (see Table S2 for data). Figure S3. Validation of sgRNA disruptions and specificity of T3SS1 and T3SS2 hits. (related to Figure 1) (A) Immunoblotting to validate disruption of the targeted genes (related to Figure 1D, F). SDS/PAGE and immunoblot analysis of whole cell lysates of HT-29 and CRISPR-targeted cells. Arrows highlight the molecular weight of the corresponding protein. GAPDH and CD71 were used as loading controls. (B-C) Validation of candidate genes identified in T3SS1 and T3SS2 screens (related to Figure 1). HT-29 Cas9 cell lines with sgRNA disruptions of indicated genes were generated and tested for their relative resistance to T3SS1 and T3SS2 cytotoxicity at either 1.5 or 2.5 hours after V. parahaemolyticus infection, respectively. Cell survival, assessed by Trypan Blue exclusion analysis, is expressed as a percentage of the non-infected cells. Data are mean +/- SEM (n=3). P value *<0.001; **<0.0001 by one-way Anova with Dunnet post test correction. (D-E) Dynamics of T3SS1 killing of HT-29 and SLC35B2 cells (D) and of T3SS2 killing of HT-29 and SLC35C1 cells (E); in both cases, cell viability assayed by Cell Titer Glow method. Figure S4. Validation of candidate genes and additional characterization of sulfation and fucosylation in T3SS1 and T3SS2 cytotoxicity (related to Figures 1, 2 and 3). (A) Effect of sodium chlorate treatment on susceptibility to T3SS1 killing for a variety of cell lines. Cell survival was assessed by Trypan Blue exclusion analysis and is expressed as a percentage of the non-infected cells. (B) Dynamics of T3SS1 killing of CHO cells defective in GAG biosynthesis; pgsA-745 is defective in both heparan sulfate and chondroitin sulfate synthesis whereas, pgsD-677 is defective in heparan sulfate synthesis but produces high amounts of chondroitin sulfate. Cell death was evaluated by trypan blue exclusion. Statistical significance is shown for the 1.0 hr time point in comparison to the parental CHO cell line. (C) Effect of desulfated heparin on T3SS1 and T3SS2 cytotoxicity (related to Figure 2 and Figure 3). HT-29 cells were infected with V. parahaemolyticus strains expressing either T3SS1 or T3SS2 and cell survival was evaluated at either 1.5 or 2.5 hours, respectively. The infections were performed in the presence of 500µg/ml of the indicated proteoglycan. (D) Modulation of V. parahaemolyticus (T3SS-) adherence to HT-29 or SLC35B2 mutant cells by the Afa-I adhesin. Values are expressed as % of adherence versus the parental HT-29 cell line. Data are mean +/- SEM (n=3). P value *<0.001; **<0.0001 by one-way Anova with Dunnet post test correction. Figure S5. V. parahaemolyticus adherence assayed with fluorescent microscopy (related to Figure 2 and 5). Adherence of T3SS- V. parahaemolyticus expressing GFP to HT-29, SLC35C1 and SLC35B2 mutant cells is expressed as GFP+ bacteria per 1,000 cells. Between 5 -10, 40X fields were analyzed per sample. HS, heparan sulfate; HA, hyaluronic acid. Figure S6. Surface fucosylation does not modulate secretion of T3SS2 effectors. (Related to Figure 4, 5). (A) Reduction in cell surface fucosylation after treatment with 2-FF. Lectin binding profile of HT-29 cells treated with 2 different concentrations of 2-FF and stained with FITCconjugated lectins. GMFI, geometric mean fluorescence intensity. AAL, Aleuria aurantia; LTL, Lotus tetragonolobus; UEA-1, Ulex europaeus Iectin. Control cells were not stained with the lectins. (B) Immunodetection of the T3SS2 effector protein VopV-Cya in the culture media of HT-29 and SLC35C1 cells infected either with T3SS2+ or T3SS2- V. parahaemolyticus strains; T3SS2- serves as a negative control. (C) Translocation of the T3SS2 effector protein VopT fused to adenylate cyclase into HT-29, SLC35C1 and SLC35B2 cells after 20 minutes of infection. P value *<0.01 by one-way Anova with Dunnet post test correction. Table S1. Supplemental Table 1, Related to Figures 1-6. Strains and plasmids used in this study. Table S2. Supplemental Table 2, Related to Figure 1. Screening Data both T3SSs screens. Table S3. Supplemental Table 3, Related to Figure 1. Gene Ranking for both T3SSs screen in each biological replicate. Table S4. Supplemental Table 4, Related to Figure 1, 2 and 5. sgRNA sequences for followup experiments. Gene ID SLC35C1 GMD FUT4 SLC35A2 SPTBN1 STK11 SLC35B2 HS6ST1 COL17A1 TFAP4 SMARCA4 SMARCB1 DPF2 ARID1A P4HB MARK2 NCKAP1 Construct ID 0004M 7917 FUT40001 8009 1761 2870 8039 3400 468 6212 9311 9339 6950 5555 8193 5263 1070 sgRNA sequence CAGTCCTGTCACGTAGCCGA GATTGTGGTGAACTTCCGTG AGTAGCGGCGATAGACCGCG GCACCAGGACAGCCTCATGG ACATCAAGCGCATCACAGCG GGCACTGCACCCGTTCGCGG GCCTGAAGTACTGCACCAGG AGAAGAGCCAAGTCTCGCGG TTTCTTGCAGGAAATCTCCG ACGCATGCAGAGCATCAACG CTAGGTATGAAGTAGCTCCG TGTGACCCTGTTAAAAGCCT TGGATGGAAAAGCGACACCG GTGTGTATCTGTCCTCCGGA TTCTGCCTTCAGCTTCCCAG GCTGCCCCAGAACTCTTCCA ATAGGCATGTGGAGACCCCA Supplemental Experimental Procedures Bacterial strains, plasmids and growth conditions All bacterial strains and plasmids used in this study are listed in Table S1. Primers used in strain construction are shown in the Primers Table. Bacterial strains were routinely cultured in LB medium or on LB agar plates at 37°C unless otherwise specified. Culture media was supplemented with the following chemicals and antibiotics at the following concentrations: 0.04% bovine and ovine bile (Sigma Cat No. B8381); 50µg/ml carbenicillin, 5µg/ml and 20µg/ml chloramphenicol for V. parahemolyticus and E. coli, respectively; 1ug/ml IPTG; 50µg/ml kanamycin and 200µg/ml streptomycin. V. parahaemolyticus deletion mutants were constructed by allelic exchange using the pDM4 suicide vector carrying DNA sequences flanking the gene targeted for deletion (Zhou, X. et al., 2013). Eukaryotic cell lines and growth conditions 293T, HeLa, Caco-2, HT-29 and HCTC116 cells were cultured in high glucose DMEM (Thermo Fisher Cat No. 11965126) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Cat No. 16140089). CHO cells were cultured in Ham’s F12-K Media (Thermo Fisher Cat No. 21127030) supplemented with 10% FBS. Cells were grown at 37°C with 5% CO2 and routinely passaged at 70-80% confluency; media was replenished every 48h. Lentiviral transductions Lentiviral particles were packaged in 293T cells using the TransIT-LT1 transfection reagent (Mirus Bio Cat No. MIR 2300) and lentiviral packaging plasmids psPAX2 and pVSVG and the corresponding cargo plasmid according to the manufacturer's protocol. 48h following transfection, 293T culture supernatant was harvested, passed through a 0.22µm pore filter, and added to target cells that were grown to 70-80% confluency in 6-well plates. 8µg/ml polybrene was added and the 6-well plates were spun at 1600g for 2h at 30°C. Cells were returned to 37°C and this spin infection process was repeated the next day with supernatant from 72h post transfection. Drug selection for positive transductants was initiated the following day. Construction of HT-29 Cas9 cells with targeted gene disruptions The sgRNA sequences used for construction of HT-29 Cas 9 mutant cells are shown in Table S4. All sgRNA oligo sequences were obtained from Integrated DNA Technologies (IDT, Inc) and cloned into the pLentiGuide-Puro plasmid (Addgene plasmid #52963) according to protocols from Dr. Feng Zhang’s website (genome-engineering.org). Briefly, 5µg of plasmid pLentiGuide-Puro was digested with BmsBI (Fermentas Cat No. ER0451) and purified using the QIAquick Gel extraction kit. Each pair of oligos was annealed and phosphorylated with T4 PNK (NEB Cat No. M0201S) in the presence of 10X T4 DNA ligase buffer in a thermocycler with the following parameters: i) incubation for 30 minutes at 37°C, ii) incubation at 95°C for 5 min with a ramp down to 25°C at 5°C per minute. Oligos were then diluted 1:200 and 1µl of the diluted oligo mixture was ligated with 50ng of BsmBI digested plasmid. Ligations were transformed into STBL3 bacteria (Thermo Fisher Cat No. C7373-03) and transformed clones were checked by PCR and DNA sequencing. Lentiviral transduction of sgRNAs cloned into pLentiGuide-Puro into HT-29 Cas9 cells was performed as described above, and after 10 days of selection with Puromycin 1µg/ml the extent of disruption of the targeted gene was analyzed by immunoblotting for the corresponding gene product (Figure S3) and/or by Flow cytometry analysis of the targeted protein or its products. For the SLC35C1, GMD, FUT4 and SLC35A2 transductant populations, most subsequent analyses were performed with FACS sorted cells that were not bound by lectins recognizing surface fucosylation (see below), in order to eliminate analysis of transductants in which disruptions had not occurred at both alleles. Analysis by immunoblotting and FACS corroborated the correct disruption of 10 of the 16 gene candidates (Figure S3); disruptions in COL17A1, P4HB, SMARCB1 and SMARCA4, MARK2, NCKAP1 were not isolated. Construction of FUT expressing CHO cells CHO-K1 cells were obtained from the Harvard Digestive Diseases Center (HDDC) and were transduced with lentiviral particles (as described above) packaged with lentiviral plasmids harboring either FUT1 (Orfome collection Broad Institute ccsbBroad304_00597), FUT4 (Origene Cat. No. RCS223829), FUT7 (Orfome collection Broad Institute ccsbBroad304_00599) or FUT9 (PlasmID repository Harvard Medical School HsCD00420422). Blasticidin drug selection was carried out at 10ug/ml for 5 days and the fucosylation status of the cells was analyzed with FITC-conjugated lectins as described below. T3SS-dependent cell death For cell survival assays, 6*104 HT-29 cells were seeded into 6-well plates and grown for 48 hours in complete media. V. parahaemolyticus strains were cultured overnight and the next day diluted 1:100 into LB liquid media and grown for 2.5 hours to reach OD600nm=0.6. To induce T3SS2 expression, bacterial cultures were grown in the presence of 0.04% bile. HT-29 cells were infected at an MOI=1 and incubated at 37°C with 5% CO2. At each time point assayed, the media was replaced with fresh complete DMEM media supplemented with 100ug/ml of gentamicin. Cells were incubated overnight and surviving cells were quantified either by trypan blue exclusion (0.4% trypan blue) and counted on a Countess II Automated Cell Counter (Thermo Fisher Scientific), or alternatively cells were analyzed by the CellTiter-Glo Luminescent Cell Viability Assay (Promega). For infection of CHO cells 6*104 were seeded into 6-well plates and incubated for 24 hours before performing the infection with V. parahaemolyticus strains. Pharmacologic inhibitors To inhibit cellular sulfation, sodium chlorate (Sigma Cat No. 403016) a specific inhibitor of PAPS synthetase, was used. To inhibit fucosylation at the level of fucosyltransferases in the Golgi, the fluorinated fucose derivative 2-fluoro-peracetyl-fucose (2-FF) was used (Merck Millipore Cat No. 344827). For cell death experiments, 3*105 HT-29 cells were seeded in 6-well plates and incubated for 48 hours in the presence of different concentrations of the inhibitors. Flow cytometry and fluorescence-activated cell sorting (FACS) of CRISPR/Cas9 knockout cells For analysis of cell surface markers, monolayers of HT-29 cells were trypsinized with the TrypLE Express reagent (Thermo Fisher Cat No. 12604013) and 1×106 cells were used for each staining procedure. For staining with fluorescein-labeled (FITC) lectins, cells were first washed and resuspended in 1X CarboFree blocking solution (Vector Labs Cat No. SP-5040), incubated for 20 minutes at room temperature, then washed and stained with 15 µg/ml FITC-conjugated lectins for 30 minutes at 4°C with shaking. Finally, cells were washed twice in cold blocking solution and a final wash in DPBS+ calcium and magnesium (Thermo Fisher Cat No. 14040-133) and analyzed immediately or fixed with 3.7% paraformaldehyde. The FITC conjugated lectins included UEA-1-FITC (Cat No. FL-1061), LTL-FITC (Cat No. FL-1321) or AALFITC (Cat No. FL-1391) from Vector Labs, USA. For detection of cell surface heparin sulfate, 1×106 cells were incubated in 500ul of staining solution containing 1% BSA and 15 µl of anti-heparan sulfate 10E4 antibody conjugated with FITC (USBiological Cat No. H1890-10). Cells were incubated for 30 minutes at 4°C with shaking, washed 3 times with PBS and then analyzed immediately or fixed with 3.7% paraformaldehyde. Flow cytometry was carried out on a BD FACSCalibur instrument (BD Biosciences) and the data analysed with FlowJo software, LLC. FACS was used to enrich for the SLC35C1, GMD, FUT4 and SLC35A2 CRISPR/Cas9 mutant cells from a complex population after puromycin selection; 20*106 cells were stained with the LTL-FITC conjugated lectin and sorted in a FACSaria instrument (Flow Cytometry Core Facility, Harvard Medical School). Immunoblot analyses Protein samples were prepared in NuPAGE LDS sample buffer (Invitrogen) with 50mM DTT, separated by NuPAGE Bis-Tris gel electrophoresis and transferred to nitrocellulose membranes. The Pierce Coomassie Plus (Bradford) Assay Kit (Thermo Fisher Cat No. 23236) was used for determination of protein concentration. Antibodies were used at the following dilutions: anti-VopB2 (rabbit polyclonal, 1:2,500), anti-VopD2 (rabbit polyclonal, 1:2,500), anti-RNA polymerase (mouse monoclonal, 1:2,000; Santa Cruz Biotechnology Cat. No. Sc-101597), anti-calnexin (rabbit monoclonal, 1µg/ml; Abcam) and with horseradish peroxidase-conjugated secondary antibody against mouse (goat monoclonal, 1:2,500; Santa Cruz Biotechnology Cat No. sc-2031) or rabbit (goat monoclonal, 1:40,000; Thermo Fisher Cat No. 31460). The blots were developed with either the SuperSignal West Pico or the Femto ECL substrate (Thermo Fisher Cat No. 35060 and 35086) and imaging was performed on the Chemidoc Touch Imaging System (Biorad). All blots are representative of at least 3 biological replicates. The VopB2 and VopD2 antibodies were a kind gift from Drs. Iida and Kodama (Research Institute for Microbial Diseases, Osaka University). Bacterial adhesion assay For bacterial adhesion assays, 300,000 cells were seeded in 24-well plates and incubated for ~5 days to achieve a full monolayer. Full monolayers were required to avoid non-specific binding of V. parahaemolyticus to the plastic tissue culture plates. Monolayers were infected at an MOI=1 for 45 minutes and then washed 5 times with PBS to remove non-adherent bacteria. To lyse eukaryotic cells, 1% Triton-X was added and incubated for 10 minutes to ensure full lysis. The lysate was serially diluted and plated on LB agar plates to determine the numbers of CFUs of adherent bacteria. Bacterial adhesion was also evaluated by fluorescence microscopy. For this full HT-29, SLC35B2 and SLC35C1 cell monolayers were prepared in 4-well slide chambers. Cells were infected in the same conditions as the CFU adhesion experiments but with V. parahaemolyticus strains harboring plasmid pGFP which allows constitutive expression of GFP. After infection, cells were washed 5 times with PBS to remove non-adherent bacteria and monolayers were fixed in 4% PFA. Actin was stained with Alexa 647 Phalloidin and bacteria and cell nuclei were stained with propidium iodide. Slides were mounted using Prolong Diamond Anti-fade solution and analyzed using confocal microscopy. Analysis was done in 40X resolution and adherent bacteria were quantified using an in-house script and normalized by the total number of cells in the field. Blocking and coating with proteoglycans Cells were seeded as described for cell death or adhesion assays. For ‘blocking’ experiments, V. parahaemolyticus infection of host cells was carried out in complete media supplemented with different concentrations of GAGs. For ‘coating’ experiments, prior to addition of V. parahaemolyticus, host cells were washed once in PBS, then incubated with different concentrations of GAGs for 1 hour in PBS at room temperature with shaking, and then washed 3 times with PBS before fresh media was added and infection was performed as described above. T3SS1 and T3SS2 effector protein translocation assay Translocation of the T3SS2 effector VopT was measured with an adenylate cyclase reporter assay as previously described (Zhou, X. et al., 2012) but with slight modifications. Briefly, 2*104 HT-29 cells were seeded in 96-well plates and incubated for 48 hours. Overnight V. parahaemolyticus cultures were diluted 1:100 and grown for 2.5 hours to OD600nm=0.6. HT-29 cells were infected with V. parahaemolyticus strains harboring a plasmid encoding a VopT-CyA fusion (pVopT-Cya) or only adenylate cyclase (pCyA, negative control) at an MOI=50 for 45min. After infection, cyclic AMP levels in infected cells were determined using the cAMP Direct Biotrak enzyme immunoassay kit (GE Healthcare Life Sciences Cat No. RPN225) according to the manufacturer's instructions. For the T3SS1 effector VopQ, the first 150 aminoacids of VopQ were fused to the adenylate cyclase reporter; translocation experiments for VopQ were carried out for only 20 minutes, to avoid T3SS1-dependent cell toxicity. Heparin binding to V. parahaemolyticus strains To test bacterial binding to heparin, 100 µl of bacterial cultures (OD600nm=0.6) were washed once with PBS and then incubated with PBS with 500 µg/ml of heparin-FITC (Thermo Fisher H-7482). The bacteria were then incubated at 4°C for 30 minutes in the dark, washed twice with PBS, fixed with 3.7% paraformaldehyde and analyzed by flow cytometry. Fractionation of infected cells Fractionation of infected host cells was performed as described previously (Gauthier et al., 2000) with slight modifications. 10*106 HT-29 cells were seeded in T-225 flasks in DMEM 10% FBS and incubated for 48 hours. Overnight bacterial cultures were diluted 1:100 into LB liquid media supplemented with 0.04% bile and grown for 2.5 hours to reach OD600nm=0.6. HT-29 cells were infected for 1.5 h at an MOI of 100. After infection, cells were washed 5 times with ice-cold PBS and then suspended in 1ml homogenization buffer (3 mM imidazole, 250 mM sucrose, 0.5 mM EDTA, pH 7.4) supplemented with Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Cat. No. 78440) and mechanically disrupted by vigorous passage through a 27-gauge needle. The homogenates were centrifuged at 11000 rpm for 15 minutes to pellet unbroken cells, bacteria, nuclei and cytoskeletal components. The supernatants were centrifuged once again at 11000 rpm to remove any residual contaminants and then the supernatant fractions were subjected to ultracentrifugation at 41,000 g for 20 min to isolate the host cell membranes (pellet). Fractions were analyzed by immunoblotting as described above. Introduction of sgRNA resistant versions of SLC35C1 and SLC35B2 genes in HT-29 mutant cells lines. SLC35C1 and SLC35B2 mutant cell lines harbor both Cas9 and the corresponding targeting sgRNAs in their genomes; therefore to efficiently restore these genes we introduced sgRNA resistant cDNA versions of the genes to the respective cell lines. sgRNA resistant variants of the SLC35C1 and SLC35B2 genes were generated by gene synthesis of the corresponding genes (GenScript) but with an alteration in the PAM sequence (NGG) targeted by the each of the sgRNAs. Lentiviral particles were produced and SLC35C1- and SLC35B2-expressing cells were selected by growth on Hygromycin (600 ug/ml) for 2 weeks along with an empty-vector control. Restoration of fucosylation and sulfation was assessed by cell surface staining and FACS analysis as described below. The complete DNA sequences of sgRNA resistant genes and the sequence alignment of the sgRNA and mutated PAM sequence are shown below: SLC35C1 sgRNA targeting site PAM NGG SLC35C1_native 1 CAGTCCTGTCACGTAGCCGATGG cDNA S L C 3 5 C 1 _ s g R N A _ rcDNA e s i ssgRNA t a n t resistant 1 CAGTCCTGTCACGTAGCCGATTG consensus 1 ********************* * SLC35B2 sgRNA targeting site PAM NGG AG CC C AG A GT AG G ScLDCN3A5_CS1L_Cn3a5tBi2v_en a t i v e 11 CGACGCTTCGCATAGGTTCAACCTGGTCA cDNA AG CC C AG A GT AT GG A SSLLCC3355CB12__ssggRRNNAA__rr eessiisssgRNA ttaanntt resistant 11 CGACGCTTCGCATAGGTTCAACCTGGTCA cDNA ** ** * * * * * * . ccoonnsseennssuuss 11 ***************************** Statistical Methods Statistical analyses were carried out using GraphPad Prism5. The statistical methods used and sample sizes are listed in the figure legends. Supplemental References • Zhou X, Gewurz BE, Ritchie JM, Takasaki K, Greenfeld H, Kieff E, Davis BM, Waldor MK. (2013) A Vibrio parahaemolyticus T3SS effector mediates pathogenesis by independently enabling intestinal colonization and inhibiting TAK1 activation. Cell Rep. 3(5):1690-702. • Zhou X, Ritchie JM, Hiyoshi H, Iida T, Davis BM, Waldor MK, Kodama T. (2013) The hydrophilic translocator for Vibrio parahaemolyticus, T3SS2, is also translocated. Infect Immun. 80(8):2940-7. • Gauthier A, de Grado M, Finlay BB. (2000) Mechanical fractionation reveals structural requirements for enteropathogenic Escherichia coli Tir insertion into host membranes. Infect Immun. 68(7):4344-8. • Labigne-Roussel, A.F., Lark, D., Schoolnik, G., and Falkow, S. (1984) Cloning and expression of an afimbrial adhesin (AFA-I) responsible for P blood group-independent, mannose-resistant hemagglutination from a pyelonephritic Escherichia coli strain. Infect Immun 46: 251–259. • Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K, Iijima Y, Najima M, Nakano M, Yamashita A, Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, Hattori M, Iida T. (2003) Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V cholerae. Lancet. 361(9359):743-9. Table Primers. Oligonucleotide sequences used in this study. Primer Sequence F5_VP2698_DM4 agtacgcgtcactagtggggcccttctagaGGTTAGCTGTTCA TTACCCGCAACG R5_VP2698_DM4 F3_VP2698_DM4 R3_VP2698_DM4 F5_VP1611_DM4 R5_VP1611_DM4 F3_VP1611_DM4 R3_VP1611_DM4 F5_VP1767_DM4 Comments Creation of MshA1 allele exchange vector CCAGTATCTGTTACAGCAGTTGTagatctGATAA GGGTGAAACCACCTTGTC GACAAGGTGGTTTCACCCTTATCagatctACAAC TGCTGTAACAGATACTGG taacaatttgtggaattcccgggagagctcACTAGGATCAGCT CCATTAATG agtacgcgtcactagtggggcccttctagaggccactatcgcgatttttcct gct Creation of MAM7 allele exchange vector GCTTAGGAATTGGCGTTCTCCATTGagatctCGA TGTTTGAGAATTGTTCTGATC GATCAGAACAATTCTCAAACATCGagatctCAA TGGAGAACGCCAATTCCTAAGC taacaatttgtggaattcccgggagagctcCGTCATTCATGAA TAGGGCAGATAC agtacgcgtcactagtggggcccttctagaTTTCTTGCCTATT GTTTACC Creation of VpadF allele exchange vector F_xbaI_VopQ150 AGAGGAACGCCAGGCGCGTCAGAagatctAGTA TTTTTGCTTATCATAGAGTCA TGACTCTATGATAAGCAAAAATACTagatctTCT GACGCGCCTGGCGTTCCTCT taacaatttgtggaattcccgggagagctcCTGAATGTTTGCA AATTTTTGC gctctagaatggtgaatacaacgcaaaaaatc Creation of VopQ R_xhoI_VopQ150 ccgctcgagctggttttccaaactgacct CyA fusion Fwd-Check-VP1767 agcggtattgctgagttgtttg Rev-Check-VP1767 ctcccgaaggagcctattcac Fwd-Check-VP2698 ccaagcgtggttagtgcaagg Rev-Check-VP2698 catgcgattaacctgcacttgg Fwd-Check-VP1611 gcagtaaagtggatcggtaaatgg Rev-Check-VP1611 tacgaaagcgacgcagaaac DM4_Fwd aaagcaccgccggacatcag R5_VP1767_DM4 F3_VP1767_DM4 R3_VP1767_DM4 DM4_Rev ggatgtaacgcactgagaagc For the DM4 primers, capital letters highlight the region of the oligonucleotide that anneals with the corresponding gene and lowercase letters with the nucleotides that anneal with the pDM4 plasmid. ThecompletecDNAsequenceofnativeandsgRNAresistantversionisasfollows(inyellowis thesgRNAsequenceandingreenthePAMsequence): >cDNA_SLC35C1_native ATGAATAGGGCCCCTCTGAAGCGGTCCAGGATCCTGCACATGGCGCTGACCGGGGCCTCAGACCCCTCTGCA GAGGCAGAGGCCAACGGGGAGAAGCCCTTTCTGCTGCGGGCATTGCAGATCGCGCTGGTGGTCTCCCTCTAC TCGGTCACCTCCATCTCCATGGTGTTCCTTAATAAGTACCTGCTGGACAGCCCCTCCCTGCGGCTGGACACCC CCATCTTCGTCACCTTCTACCAGTGCCTGGTGACCACGCTGCTGTGCAAAGGCCTCAGCGCTCTGGCCGCCTG CTGCCCTGGTGCCGTGGACTTCCCCAGCTTGCGCCTGGACCTCAGGGTGGCCCGCAGCGTCCTGCCCCTGTCG GTGGTCTTCATCGGCATGATCACCTTCAATAACCTCTGCCTCAAGTACGTCGGTGTGGCCTTCTACAATGTG GGCCGCTCACTCACCACCGTCTTCAACGTGCTGCTCTCCTACCTGCTGCTCAAGCAGACCACCTCCTTCTATG CCCTGCTCACCTGCGGTATCATCATCGGGGGCTTCTGGCTTGGTGTGGACCAGGAGGGGGCAGAAGGCACCC TGTCGTGGCTGGGCACCGTCTTCGGCGTGCTGGCTAGCCTCTGTGTCTCGCTCAACGCCATCTACACCACGAA GGTGCTCCCGGCGGTGGACGGCAGCATCTGGCGCCTGACTTTCTACAACAACGTCAACGCCTGCATCCTCTTC CTGCCCCTGCTCCTGCTGCTCGGGGAGCTTCAGGCCCTGCGTGACTTTGCCCAGCTGGGCAGTGCCCACTTCT GGGGGATGATGACGCTGGGCGGCCTGTTTGGCTTTGCCATCGGCTACGTGACAGGACTGCAGATCAAGTTCA CCAGTCCGCTGACCCACAATGTGTCGGGCACGGCCAAGGCCTGTGCCCAGACAGTGCTGGCCGTGCTCTACT ACGAGGAGACCAAGAGCTTCCTCTGGTGGACGAGCAACATGATGGTGCTGGGCGGCTCCTCCGCCTACACCT GGGTCAGGGGCTGGGAGATGAAGAAGACTCCGGAGGAGCCCAGCCCCAAAGACAGCGAGAAGAGCGCCATG GGGGTG >SLC35C1_sgRNA_resistant ATGAATAGGGCCCCTCTGAAGCGGTCCAGGATCCTGCACATGGCGCTGACCGGGGCCTCAGACCCCTCTGCA GAGGCAGAGGCCAACGGGGAGAAGCCCTTTCTGCTGCGGGCATTGCAGATCGCGCTGGTGGTCTCCCTCTAC TCGGTCACCTCCATCTCCATGGTGTTCCTTAATAAGTACCTGCTGGACAGCCCCTCCCTGCGGCTGGACACCC CCATCTTCGTCACCTTCTACCAGTGCCTGGTGACCACGCTGCTGTGCAAAGGCCTCAGCGCTCTGGCCGCCTG CTGCCCTGGTGCCGTGGACTTCCCCAGCTTGCGCCTGGACCTCAGGGTGGCCCGCAGCGTCCTGCCCCTGTCG GTGGTCTTCATCGGCATGATCACCTTCAATAACCTCTGCCTCAAGTACGTCGGTGTGGCCTTCTACAATGTG GGCCGCTCACTCACCACCGTCTTCAACGTGCTGCTCTCCTACCTGCTGCTCAAGCAGACCACCTCCTTCTATG CCCTGCTCACCTGCGGTATCATCATCGGGGGCTTCTGGCTTGGTGTGGACCAGGAGGGGGCAGAAGGCACCC TGTCGTGGCTGGGCACCGTCTTCGGCGTGCTGGCTAGCCTCTGTGTCTCGCTCAACGCCATCTACACCACGAA GGTGCTCCCGGCGGTGGACGGCAGCATCTGGCGCCTGACTTTCTACAACAACGTCAACGCCTGCATCCTCTTC CTGCCCCTGCTCCTGCTGCTCGGGGAGCTTCAGGCCCTGCGTGACTTTGCCCAGCTGGGCAGTGCCCACTTCT GGGGGATGATGACGCTGGGCGGCCTGTTTGGCTTTGCAATCGGCTACGTGACAGGACTGCAGATCAAGTTCA CCAGTCCGCTGACCCACAATGTGTCGGGCACGGCCAAGGCCTGTGCCCAGACAGTGCTGGCCGTGCTCTACT ACGAGGAGACCAAGAGCTTCCTCTGGTGGACGAGCAACATGATGGTGCTGGGCGGCTCCTCCGCCTACACCT GGGTCAGGGGCTGGGAGATGAAGAAGACTCCGGAGGAGCCCAGCCCCAAAGACAGCGAGAAGAGCGCCATG GGGGTG >cDNA_SLC35B2_native ATGGACGCCAGATGGTGGGCAGTGGTGGTGCTGGCTGCGTTCCCCTCCCTAGGGGCAGGTGGGGAGACTCCC GAAGCCCCTCCGGAGTCATGGACCCAGCTATGGTTCTTCCGATTTGTGGTGAATGCTGCTGGCTATGCCAGC TTTATGGTACCTGGCTACCTCCTGGTGCAGTACTTCAGGCGGAAGAACTACCTGGAGACCGGTAGGGGCCTC TGCTTTCCCCTGGTGAAAGCTTGTGTGTTTGGCAATGAGCCCAAGGCCTCTGATGAGGTTCCCCTGGCGCCC CGAACAGAGGCGGCAGAGACCACCCCGATGTGGCAGGCCCTGAAACTGCTCTTCTGTGCCACAGGGCTCCAG GTGTCTTATCTGACTTGGGGTGTGCTGCAGGAAAGAGTGATGACCCGCAGCTATGGGGCCACAGCCACATCA CCGGGTGAGCGCTTTACGGACTCGCAGTTCCTGGTGCTAATGAACCGAGTGCTGGCACTGATTGTGGCTGGC CTCTCCTGTGTTCTCTGCAAGCAGCCCCGGCATGGGGCACCCATGTACCGGTACTCCTTTGCCAGCCTGTCCA ATGTGCTTAGCAGCTGGTGCCAATACGAAGCTCTTAAGTTCGTCAGCTTCCCCACCCAGGTGCTGGCCAAGG CCTCTAAGGTGATCCCTGTCATGCTGATGGGAAAGCTTGTGTCTCGGCGCAGCTACGAACACTGGGAGTACC TGACAGCCACCCTCATCTCCATTGGGGTCAGCATGTTTCTGCTATCCAGCGGACCAGAGCCCCGCAGCTCCCC AGCCACCACACTCTCAGGCCTCATCTTACTGGCAGGTTATATTGCTTTTGACAGCTTCACCTCAAACTGGCA GGATGCCCTGTTTGCCTATAAGATGTCATCGGTGCAGATGATGTTTGGGGTCAATTTCTTCTCCTGCCTCTT CACAGTGGGCTCACTGCTAGAACAGGGGGCCCTACTGGAGGGAACCCGCTTCATGGGGCGACACAGTGAGTT TGCTGCCCATGCCCTGCTACTCTCCATCTGCTCCGCATGTGGCCAGCTCTTCATCTTTTACACCATTGGGCAG TTTGGGGCTGCCGTCTTCACCATCATCATGACCCTCCGCCAGGCCTTTGCCATCCTTCTTTCCTGCCTTCTCT ATGGCCACACTGTCACTGTGGTGGGAGGGCTGGGGGTGGCTGTGGTCTTTGCTGCCCTCCTGCTCAGAGTCT ACGCGCGGGGCCGTCTAAAGCAACGGGGAAAGAAGGCTGTGCCTGTTGAGTCTCCTGTGCAGAAGGTT >SLC35B2_sgRNA_resistant ATGGACGCCAGATGGTGGGCAGTGGTGGTGCTGGCTGCGTTCCCCTCCCTAGGGGCAGGTGGGGAGACTCCC GAAGCCCCTCCGGAGTCATGGACCCAGCTATGGTTCTTCCGATTTGTGGTGAATGCTGCTGGCTATGCCAGC TTTATGGTACCTGGCTATCTCCTGGTGCAGTACTTCAGGCGGAAGAACTACCTGGAGACCGGTAGGGGCCTC TGCTTTCCCCTGGTGAAAGCTTGTGTGTTTGGCAATGAGCCCAAGGCCTCTGATGAGGTTCCCCTGGCGCCC CGAACAGAGGCGGCAGAGACCACCCCGATGTGGCAGGCCCTGAAACTGCTCTTCTGTGCCACAGGGCTCCAG GTGTCTTATCTGACTTGGGGTGTGCTGCAGGAAAGAGTGATGACCCGCAGCTATGGGGCCACAGCCACATCA CCGGGTGAGCGCTTTACGGACTCGCAGTTCCTGGTGCTAATGAACCGAGTGCTGGCACTGATTGTGGCTGGC CTCTCCTGTGTTCTCTGCAAGCAGCCCCGGCATGGGGCACCCATGTACCGGTACTCCTTTGCCAGCCTGTCCA ATGTGCTTAGCAGCTGGTGCCAATACGAAGCTCTTAAGTTCGTCAGCTTCCCCACCCAGGTGCTGGCCAAGG CCTCTAAGGTGATCCCTGTCATGCTGATGGGAAAGCTTGTGTCTCGGCGCAGCTACGAACACTGGGAGTACC TGACAGCCACCCTCATCTCCATTGGGGTCAGCATGTTTCTGCTATCCAGCGGACCAGAGCCCCGCAGCTCCCC AGCCACCACACTCTCAGGCCTCATCTTACTGGCAGGTTATATTGCTTTTGACAGCTTCACCTCAAACTGGCA GGATGCCCTGTTTGCCTATAAGATGTCATCGGTGCAGATGATGTTTGGGGTCAATTTCTTCTCCTGCCTCTT CACAGTGGGCTCACTGCTAGAACAGGGGGCCCTACTGGAGGGAACCCGCTTCATGGGGCGACACAGTGAGTT TGCTGCCCATGCCCTGCTACTCTCCATCTGCTCCGCATGTGGCCAGCTCTTCATCTTTTACACCATTGGGCAG TTTGGGGCTGCCGTCTTCACCATCATCATGACCCTCCGCCAGGCCTTTGCCATCCTTCTTTCCTGCCTTCTCT ATGGCCACACTGTCACTGTGGTGGGAGGGCTGGGGGTGGCTGTGGTCTTTGCTGCCCTCCTGCTCAGAGTCT ACGCGCGGGGCCGTCTAAAGCAACGGGGAAAGAAGGCTGTGCCTGTTGAGTCTCCTGTGCAGAAGGTT