Download Pex5p stabilizes Pex14p: a study using a newly isolated pex5 CHO

Biochem. J. (2013) 449, 195–207 (Printed in Great Britain)
195
doi:10.1042/BJ20120911
Pex5p stabilizes Pex14p: a study using a newly isolated pex5 CHO cell
mutant, ZPEG101
Ryuichi NATSUYAMA*, Kanji OKUMOTO*† and Yukio FUJIKI*†1
*Graduate School of Systems Life Sciences, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan, and †Department of Biology, Faculty of
Sciences, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan
Pex5p [PTS (peroxisome-targeting signal) type 1 receptor] plays
an essential role in peroxisomal matrix protein import. In the
present study, we isolated a novel PEX5-deficient CHO (Chinesehamster ovary) cell mutant, termed ZPEG101, showing typical
peroxisomal import defects of both PTS1 and PTS2 proteins.
ZPEG101 is distinct from other known pex5 CHO mutants in its
Pex5p expression. An undetectable level of Pex5p in ZPEG101
results in unstable Pex14p, which is due to inefficient translocation
to the peroxisomal membrane. All of the mutant phenotypes of
ZPEG101 are restored by expression of wild-type Pex5pL, a
longer form of Pex5p, suggesting a role for Pex5p in sustaining the
levels of Pex14p in addition to peroxisomal matrix protein import.
Complementation analysis using various Pex5p mutants revealed
that in the seven pentapeptide WXXXF/Y motifs in Pex5pL,
known as the multiple binding sites for Pex14p, the fifth motif
is an auxiliary binding site for Pex14p and is required for Pex14p
stability. Furthermore, we found that Pex5p–Pex13p interaction
is essential for the import of PTS1 proteins as well as catalase,
but not for that of PTS2 proteins. Therefore ZPEG101 with no
Pex5p would be a useful tool for investigating Pex5p function
and delineating the mechanisms underlying peroxisomal matrix
protein import.
INTRODUCTION
understanding of multiple functions of mammalian Pex5p. In
mammals, two types of Pex5p isoforms have been identified:
a shorter one (Pex5pS) and a longer one (Pex5pL) with a 37amino acid insertion at the N-terminal region [9,10]. By using
a Pex5 CHO mutant, ZP105, defective in both PTS1 and PTS2
import due to the mutation in the PEX5 gene yielding unstable
Pex5p [10,13], both isoforms of Pex5p are shown to function in
protein import via PTS1 by transporting its cargo PTS1 proteins
into peroxisomes by binding to its initial target Pex14p [13].
Furthermore, Pex5pL is indispensable for PTS2 protein import
by specific interaction with Pex7p via the additional insertion
and the proximal region to translocate the Pex7p–PTS2 protein
complex to the peroxisome [13–15]. The essential role of Pex5pL
in PTS2 protein import is evidently demonstrated with a Pex5
CHO cell mutant, ZPG231, where the impaired PTS2 protein
import is restored only by Pex5pL [14]. We isolated another
distinct mutant, ZP139, where only PTS1 protein, but not PTS2
protein, import is abrogated owing to the impaired binding of
Pex5pL to PTS1 proteins [10,13]. Pex5p releases PTS1 cargos
into the peroxisome matrix in collaboration with peroxisomal
translocation machinery comprising of Pex14p, Pex13p and three
RING peroxins [2,4,16]. Pex5p is then exported into the cytosol
by ternary complexes comprising of Pex1p and Pex6p and their
anchoring protein Pex26p, thereby acting as a shuttling receptor
between peroxisomes and the cytosol [17,18].
In the present study, we isolated a novel PEX5 CHO mutant,
ZPEG101, with a phenotype showing complete deficiency of
Pex5p and affecting Pex14p stability. We also address a novel
role for Pex5p in Pex14p stability via the fifth pentapeptide
motif.
Peroxisomes are ubiquitous intracellular organelles found in
organisms ranging from yeast to humans. Peroxisomes function
in a wide variety of metabolic pathways, including β-oxidation
of very long chain fatty acids and biosynthesis of plasmalogentype ether-glycerolipids [1]. The functional significance of
human peroxisomes is highlighted by fatal human genetic
diseases, named PBDs (peroxisome biogenesis disorders), such
as Zellweger syndrome [2,3]. To elucidate peroxisome biogenesis
and human PBDs, more than 15 different CGs (complementation
groups) of peroxisome-deficient mutants have been isolated
from CHO (Chinese-hamster ovary) cells [2]. Genetic
complementation analysis using peroxisome-deficient mutants of
CHO cells as well as yeast species led to identification of a number
of PEX genes essential for peroxisome biogenesis [2–4].
The majority of peroxisomal matrix proteins harbour a cisacting PTS1 (peroxisome-targeting signal type 1) and a Cterminal tripeptide SKL motif [5,6], with a few possessing a
cleavable N-terminal presequence PTS2 [7,8]. Pex5p and Pex7p
have been further identified as cytosolic receptors for PTS1
and PTS2 respectively [4]. PEX5 and PEX7 are shown to be
causal genes for the PBDs of CG2 and CG11 respectively
[2,3]. In mammals Pex5p recognizes PTS1 with seven TPR
(tetratricopeptide repeat) domains in the C-terminal region
[9–11] and interacts with the PMPs (peroxisomal membrane
proteins) Pex14p and Pex13p via several pentapeptide WXXXF/Y
motifs in the N-terminal portion [11,12]. In our collection of
peroxisome-deficient CHO mutant cells [2], several Pex5 CHO
mutants representing distinct phenotypes have contributed to the
Key words: Chinese-hamster ovary cell mutant (CHO cell
mutant), matrix protein import, peroxisome biogenesis, Pex14p,
peroxisome-targeting signal type 1 (PTS1), PTS1 receptor
(Pex5p).
Abbreviations used: AOx, acyl-CoA oxidase; CG, complementation group; CHO, Chinese-hamster ovary; DMEM, Dulbecco’s modified Eagle’s medium;
EGFP, enhanced green fluorescent protein; FBS, fetal bovine serum; HA, haemagglutinin; LDH, lactate dehydrogenase; MDH, malate dehydrogenase;
PBD, peroxisome biogenesis disorder; Pex5p, peroxisome-targeting signal type 1 receptor; PMP, peroxisomal membrane protein; PMP70, 70 kDa integral
PMP; P9OH, 9-(1 -pyrene)nonanol; PTS, peroxisome-targeting signal; RT, reverse transcription; siRNA, small interfering RNA; TPR, tetratricopeptide repeat.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2013 Biochemical Society
196
R. Natsuyama, K. Okumoto and Y. Fujiki
EXPERIMENTAL
Mutation analysis
Antibodies
mRNA was purified from of CHO-K1 and ZPEG101 cells (8×106
cells each) using a QuickPrep micro mRNA Purification Kit (GE
Healthcare) according to manufacturer’s instructions. To amplify
the entire open reading frame of PEX5 RT (reverse transcription)–
PCR was performed with 5 μg of mRNA, SuperscriptIII reverse
transcriptase (Invitrogen) and a pair of ClPEX5-specific PCR
primers, a sense f1 and an antisense r1 primer (Table 1),
as described previously [26]. PEX5 cDNA was cloned into
pcDNAZeo3.1 (Invitrogen) and the nucleotide sequence was
determined with a BigDye terminator cycle sequencing kit and
a 3100-AVANT sequencer (Applied Biosystems).
The present study used rabbit antibodies against AOx (acyl-coA
oxidase) [19], 3-ketoacyl-CoA thiolase (thiolase) [19], catalase
[19], cytochrome P450 reductase (Santa Cruz Biotechnology),
Pex13p [20], Pex14p [21], PMP70 (70 kDa integral PMP) [19]
and MDH (malate dehydrogenase) [22], and affinity-purified IgG
against Pex5p [13]. Mouse monoclonal antibodies against FLAG
(Sigma), influenza virus HA (haemagglutinin; 16B12, Covance),
and His6 (BioDynamics Laboratory) and goat antiserum
against LDH (lactate dehydrogenase; Rockland) were also
used.
DNA construction of PEX5 variants
Cell culture and DNA transfection
Wild-type CHO-K1, TKaEG1 and peroxisome-deficient CHO
mutants, including ZPEG101, ZP105, ZP139 [10] and ZP110 [21]
were cultured in Ham’s F-12 medium (Invitrogen) and HeLa cells
were cultured in DMEM (Dulbecco’s modified Eagle’s medium;
Invitrogen), both supplemented with 10 % FBS (fetal bovine
serum) under 5 % CO2 /95 % air. DNA transfection into CHO
cells was done using LipofectamineTM (Invitrogen) as described
previously [23]. To obtain a parent cell for mutant isolation, TKa
cells, wild-type CHO-K1 cells transformed with rat PEX2 cDNA
[24], were transfected with a plasmid encoding EGFP (enhanced
green fluorescent protein)–PTS1 in a pUcD2Hyg vector [25] and
selected in the presence of 200 μg/ml hygromycin B (Sigma).
A stable transformant showing the peroxisomal localization of
EGFP–PTS1, termed TKaEG1, was cloned by limiting dilution
method as described previously [26]. A stable transformant
of ZPEG101 expressing N-terminally His- and C-terminally
HA-tagged Chinese hamster Pex5pL (His-ClPex5pL-HA) was
likewise isolated by transfection of pcDNAZeo/His-ClPEX5L-HA
[27] followed by selection with Zeocin (Invitrogen) as described
previously [23].
To construct the PEX5L(1–243) variants in pcDNA3.1/Zeo,
PEX5L(1-243)Mut123, PEX5L(1-243)Mut234 and PEX5L(1243)Mut1234 in pGEX6P-1 [12] were cleaved by Sse8387INotI and replaced into wild-type pcDNAZeo/His–ClPEX5L–
HA [27]. ClPEX5L variants were constructed by a PCRbased method using three sets of forward and reverse primers,
Mut5f and AxyIr, Mut56f and Mut7r, and Mut7f and AxyIr,
by using pcDNAZeo/His–ClPEX5L–HA as a DNA template.
These PCR products were likewise amplified by a second
PCR, using Mut56f-Mut7r and Mut7f-AxyIr as a template. The
respective PCR products were cleaved with SacI and AxyI
and cloned into the wild-type ClPEX5L, PEX5LMut123 and
PEX5LMut1234 [12] using a pcDNA3.1/Zeo vector by replacing
their corresponding fragments. To construct the deletion variants
of PEX5L-FLAG encoding Pex5pL(1-305) and Pex5pL(306-632),
PCR was performed with two primer pairs, T7 and 306stop_r and
307f and 632r, using pcDNAZeo/His–ClPEX5L–FLAG [27] as
a template. The BglII–XhoI fragments of the respective PCR
products were cloned into pcDNAZeo by replacing the BamHI–
XhoI fragment of pcDNAZeo/His–ClPEX5L-FLAG.
Northern blot analysis
Isolation of a peroxisome-deficient CHO mutant ZPEG101
Peroxisome-deficient mutants were isolated using TKaEG1 as
a parent cell using the same procedure as for the other
well-established parental cell, TKaEG2, a TKa cell stably
expressing PTS2–EGFP [26]. TKaEG1 cells were mutagenized
with 0.4 μg/ml of ICR-191 (Sigma) for 7 h and P9OH [9-(1 pyrene)nonanol]/UV-resistant colonies defective in peroxisome
assembly were selected by directly observing the intracellular
localization of EGFP–PTS1 using a Carl Zeiss Axioskop FL
microscope as described previously [26].
mRNA of the wild-type CHO-K1 and ZPEG101 cells was
separated by electrophoresis, transferred on to a zeta-probe
membrane (GE Healthcare) and hybridized with a 32 P-labelled
BamHI fragment of ClPEX14 cDNA in ExpressHyb hybridization
solution (Clontech) as described previously [21]. The membrane
was washed twice at room temperature (22 ◦ C) and three times
at 65 ◦ C with 2× SSPE [20 mM sodium phosphate (pH 7.4),
0.3 M NaCl and 1 mM EDTA] and 1 % SDS. Radioactive bands
were detected by a FLA-5000 Autoimaging analyser (Fuji Film).
The membrane was repeatedly hybridized with 32 P-labelled actin
cDNA as a control for the loading and integrity of RNA.
siRNA (small interfering RNA)
Morphological analysis
Immunostaining of CHO cells was performed as described
previously [23], using 4 % paraformaldehyde for cell fixation
and 0.1 % Triton X-100 for permeabilization. To verify the
peroxisomal localization of the Pex5p variants, cells were semipermeabilized with 25 μg/ml of digitonin, washed to remove
cytosolic Pex5p and then subjected to immunostaining as
described previously [27]. Antigen–antibody complexes were
visualized with Alexa Fluor® 488-, 568- or 647-labelled goat
antibodies against rabbit or mouse IgG (Invitrogen) and observed
together with EGFP fluorescence using a Axioplan2 fluorescent
microscope and a LSM510 confocal laser microscope (Carl
Zeiss).
c The Authors Journal compilation c 2013 Biochemical Society
Knockdown of Pex5p in HeLa cells was performed using a
Stealth siRNA duplex (Invitrogen) specific to human PEX5
(target sequence, 5 -GGCAGAGAATGAACAAGAACTATTA3 ). Stealth RNAi negative control was also used as a control.
HeLa cells were transfected twice with a 48-h interval with siRNA
duplex and LipofectamineTM 2000 as described previously [27].
Subcellular fractionation and immunoprecipitation
Cells were homogenized in homogenizing buffer [0.25 M sucrose,
20 mM Hepes-KOH (pH 7.4), 25 μg/ml each of leupeptin and
antipain, and 1 mM PMSF] with a Potter–Elvehjem Teflon
homogenizer and fractionated as described previously [13].
A novel CHO mutant lacking Pex5p
Table 1
197
Primers and the sequences used in the present study
f and r indicate forward and reverse primers respectively. Underline shows recognition sites of restriction enzymes and nucleotides for amino-acid substitutions or characteristic codons.
Name
Sequence (5 →3 )
Notes
f1
r1
Mut5f
Mut56f
GCGCAGATCTTGGTCACCATGGCAATGAGGGAGCTG
GCGCGCGGCCGCAGGGAGTCACATCCAGAGCGAGAAC
CGGGCCGAGCTCAGGCAGAACAGGCGGCAGCAGAGGCTATACAGCAGCAG
GTCGGGCCGAGCTCAGGCAGAACAGGCGGCAGCAGAGGCTATACAGCAGC
AGGGCACATCAGAGGCCGCGGTCGATCAGGCCACAAGGTCAG
CACCCCGCGCTTTCTGACGCTGATGACCTC
CATCAGCGTCAGAAAGCGCGGGGTGCGCC
AGCCCTTCTTCGAAAGCC
CCGCTCGAGTCAATAGTCAGAAAGCCAGGG
GGAAGATCTCCGATGACCTCACATCTGC
CCGCTCGAGCTGGGGCAGGCCAAACATAGC
BglII site, initiation codon
NotI site, termination codon
SacI site, W244A and F248A mutations
SacI site, W244A, F248A, W258A, and
Y262A mutations
W301A and Y305A mutations
W301A and Y305A mutations
Mut7f
Mut7r
AxyIr
306stop_r
307f
632r
For immunoprecipitation of FLAG-tagged proteins, cells or
subcellular fractions were lysed in buffer-L [20 mM HepesKOH (pH 7.4), 150 mM NaCl, 25 μg/ml each of leupeptin and
antipain, 1 mM PMSF, 1 mM EDTA, and 1 mM dithiothreitol
containing 0.5 % CHAPS]. A soluble fraction was subjected
to immunoprecipitation with anti-FLAG IgG-conjugated agarose
(Sigma) as described previously [23]. Proteins bound to the beads
and total cell lysates were analysed by SDS/PAGE (9 % gel) and
immunoblotting as described previously [23].
Pulse–chase experiments
CHO-K1, ZPEG101 and ZP110 cells growing in 35-mm-diameter
dishes were washed twice with PBS and incubated in cysteine- and
methionine-free DMEM (Invitrogen) for 30 min, and then pulselabelled for 1 h with 10 mCi/ml [35 S]methionine plus [35 S]cysteine
(American Radiolabeled Chemicals). To chase the 35 S-labelled
proteins, cells were washed with PBS and further incubated with
complete Ham’s F12 medium containing 10 % FBS. At selected
intervals, the cells were lysed in buffer-L containing 0.5 %
Nonidet P40 and 0.1 % SDS. Soluble fractions were subjected to
immunoprecipitation using an anti-Pex14p antibody as described
previously [19]. In subcellular fractionation of 35 S-labelled cells,
cells pulse-labelled for 1 h as described above were harvested and
incubated in homogenizing buffer containing 25 μg/ml digitonin
for 5 min at room temperature as described previously [28]. After
centrifugation at 100 000 g for 30 min at 4 ◦ C, cytosolic and
organellar fractions were subjected to immunoprecipitation with
anti-Pex14p antibody as described above. 35 S-labelled proteins
were separated by SDS/PAGE (9 % gel) and detected with a FLA5000 Autoimaging analyser (Fuji Film).
Integrity of Pex14p
Organelle fractions prepared as described above were resuspended in homogenizing buffer and divided into several equal
aliquots (100 μl). They are added with various concentration of
NaCl and incubated on ice for 30 min. These organelle fractions
were re-centrifuged at 100 000 g for 30 min at 4 ◦ C and the pellet
fractions were subjected to immunoblotting as described above.
Other methods
Protein bands in the immunoblot analysis were quantified with
ImageJ (http://rsbweb.nih.gov/ij/). Statistical significance was
examined by Student’s t test and shown as *P < 0.05 and
**P < 0.01.
XhoI site
BglII site
XhoI site
RESULTS
Isolation of a novel peroxisome-deficient mutant ZPEG101
To investigate the molecular mechanism of peroxisome
biogenesis, we attempted to isolate peroxisome biogenesisdefective CHO cell mutants by mutagenesis using ICR-191 [26]
and P9OH/UV selection methods [29]. As a parental cell, we used
TKaEG1, which are CHO-K1 cells stably expressing rat Pex2p
and EGFP–PTS1. EGFP–PTS1 in TKaEG1 was discernible in
numerous punctate structures (Figure 1A, a) colocalizing with the
PMP Pex14p (Figure 1A, c and e), indicative of the peroxisomal
location. About 1.0×107 of TKaEG1 cells were mutagenized.
After the treatment with P9OH/UV, viable cell colonies were
examined for the intracellular localization of EGFP–PTS1, as
was also done for the TKaEG2 cells [26]. Finally, a peroxisomedeficient mutant was isolated and named ZPEG101. ZPEG101
cells showed a diffused pattern of EGFP–PTS1 in the cytosol
(Figure 1A, b), indicating a defect in peroxisomal PTS1 import.
Interestingly, the Pex14p-positive structures in ZPEG101 were
significantly less in fluorescence intensity and moderately smaller
in number (Figure 1A, d) as compared with those in TKaEG1
(Figure 1A, c).
In contrast, PMP70-positive membrane remnants, which are
typically larger in size and smaller in number in pex mutants,
were clearly discernible in ZPEG101 (Figure 1A, h) showing a
fluorescence intensity similar to normal peroxisomes in TKaEG1
(Figure 1A, g). Pex14p was co-localized with the PMP70-positive
structures in both TKaEG1 and ZPEG101 (Figure 1A, g and i, and
h and j respectively) with the Pex14p level being distinctly lowered
in ZPEG101 (Figure 1A, j). These results strongly suggested
that ZPEG101 was a peroxisomal matrix protein import-defective
mutant with a severely lowered level of Pex14p.
To determine a CG of ZPEG101, 14 different PEX cDNAs
were separately transfected into ZPEG101. EGFP–PTS1 import in
ZPEG101 was restored only by expression of PEX5L (Figure 1B,
b) and not other genes, including PEX1 (Figure 1B, a), PEX14
(Figure 1B, c), PEX2, PEX3, PEX6, PEX7, PEX10, PEX11β,
PEX12, PEX13, PEX16, PEX19 and PEX26 (results not shown),
strongly suggesting that ZPEG101 was a pex5 mutant. In
immunostaining analysis, PTS1 protein, AOx, PTS2 protein,
thiolase and catalase were detected in the cytosol (Figure 1C,
d–f), whereas those in TKaEG1 were located in peroxisomes
(Figure 1C, a–c). These import defects of peroxisomal matrix
proteins in ZPEG101 were similar to those in another pex5 CHO
mutant, ZP105 (Figure 1C, g–i) [10]. Although PTS1 protein
import in ZPEG101 was restored by expression of PEX5L and
PEX5S (Figure 1D, a–c), PTS2 import was recovered only by
PEX5L (Figure 1D, d–f), as has been previously shown in ZP105
c The Authors Journal compilation c 2013 Biochemical Society
198
Figure 1
R. Natsuyama, K. Okumoto and Y. Fujiki
Isolation of a peroxisome-deficient CHO cell mutant, ZPEG101
(A) Fluorescence microscopy of TkaEG1, rat PEX2 -transformed wild-type CHO-K1 stably expressing EGFP–PTS1 (a, c, e, g and i) and a peroxisome biogenesis-defective mutant ZPEG101 (b, d, f, h
and j). Cells were immunostained with anti-Pex14p antibody (c and d) and were monitored by EGFP fluorescence with that of EGFP–PTS1 (a and b) using confocal microscopy. Merged views are
shown in (e) and (f). Images of dual-immunostaining with antibodies to PMP70 (g and h) and Pex14p (i and j) were also shown. Scale bar, 10 μm. (B) CG analysis was done by PEX transfection.
ZPEG101 was transfected with PEX1 (a), PEX5L (b), PEX14 (c) and a mock plasmid (d). At 24 h after the transfection, fluorescence of EGFP–PTS1 input was assessed as in (A). Scale bar, 10 μm.
(C) Intracellular localization of peroxisomal matrix proteins in TKaEG1 (a–c), ZPEG101 (d–f), and ZP105 (g–i) was verified by immunostaining with antibodies against AOx (a, d and g), thiolase (b,
e and h) and catalase (c, f and i). Scale bar, 10 μm. (D) Complementation assay with PEX5L and PEX5S . ZPEG101 was transfected with PEX5L (a and d), PEX5S (b and e) and a mock plasmid (c
and f). At 24 h after the transfection, PTS1 AOx (a–c) and PTS2 thiolase (d–f) were verified as in (C). Scale bar, 10 μm.
[10]. These results strongly suggested that ZPEG101 was a typical
pex5 CHO cell mutant with import defects in both PTS1 and PTS2
proteins.
ZPEG101 is a pex5 mutant with distinct phenotypes that has no
detectable Pex5p and instable Pex14p
To investigate the primary defect of ZPEG101, PEX5 cDNA was
isolated by RT–PCR using the mRNA from ZPEG101 and PEX5specific primers. Subsequent sequencing of nine independent
ZPEG101-derived PEX5 cDNA clones showed that a singlebase insertion of cytosine into a four cytosine tandem repeat
c The Authors Journal compilation c 2013 Biochemical Society
at nucleotide positions 217–220 (the A of the initiating codon
ATG being base 1), resulted in a frameshift in a codon encoding
Leu74 (CTT) to a proline (CCT) and creation of a premature
termination codon at amino acid position 86 (Figures 2A and
2B), thereby indicating a homozygote mutation. Therefore PEX5
in ZPEG101, named PEX5ZPEG101 , is more likely to encode a
shortened Pex5p with a length of 85 amino acids comprising
the N-terminal 73-amino-acids of Pex5p and an additional 12amino-acid oligopeptide (Figure 2B). Transfection of HA-tagged
PEX5ZPEG101 (PEX5ZPEG101 –HA) into ZPEG101 did not complement
the phenotype of ZPEG101 (Figure 2C, b) as in the mocktransfected cells (Figure 2C, c), where Pex5pZPEG101 –HA was not
A novel CHO mutant lacking Pex5p
Figure 2
Mutation analysis of PEX5 in ZPEG101
(A) RT–PCR was performed using ClPEX5 -specific primers to amplify PEX5 derived from
CHO-K1 (left-hand panel) and ZPEG101 (right-hand panel). Partial nucleotide and the deduced
amino-acid sequences of respective PEX5 cDNA are shown. Nine independent PCR products
of PEX5 cDNA isolated from ZPEG101 possessed a same frame-shift, one-base insertion
of cytosine in a four cytosine tandem repeat from nucleotides 217–220 (italic), resulted
in a frame-shift giving rise to unrelated polypeptide sequence downstream of Pro74 (bold).
(B) Deduced amino-acid sequence of Pex5p derived from CHO-K1 and ZPEG101. The identical
residues between normal and mutant sequences are highlighted. In ZPEG101-derived Pex5p,
a double underline indicates an additional 12-amino-acid sequence created by the frameshift
mutation in the codon for Leu74 (arrowhead). *, termination codon. (C) Pex5pZPEG101 showed
no complementary activity in ZPEG101 cells. His-ClPEX5L–HA (a), His-ClPEX5ZPEG101 –HA (b)
and a mock plasmid (c) were transfected into ZPEG101 and analysed as Figure 1(B). Scale bar,
10 μm.
detectable at the expected molecular mass (Supplementary Figure
S1 at http://www.biochemj.org/bj/449/bj4490195add.htm). Taken
together, we concluded that primary defect of ZPEG101 is the
PEX5-inactivating mutation.
Next, we examined the endogenous Pex5p expression in
ZPEG101 and other PEX5-deficient CHO mutants by immunoblot
analysis. A small amount of Pex5p was found in a pex5 mutant
ZP139 (Figure 3A, lane 3), which harbours a G522E mutation
in the sixth TPR in Pex5pL (G485E in Pex5pS) [10], in contrast
to the level of Pex5p in CHO-K1 (Figure 3A, lane 1). Another
pex5 mutant, ZP105, showed a much lower, but detectable, level
of Pex5p (Figure 3A, lane 2) with a G335E mutation (G298E in
Pex5pS) in the first TPR motif [10]. These results show that a
small, but significant, level of Pex5p, with a missense mutation
in the TPR motifs, is expressed in these two pex5 mutants. In
contrast, in ZPEG101 no discernible Pex5p (Figure 3A, lane 4)
and endogenous Pex5pZPEG101 (results not shown) was observed.
Given the finding that even ectopically expressed Pex5pZPEG101 –
HA in ZPEG101 was hardly detectable (Supplementary Figure
S1), thereby suggesting that PEX5ZPEG101 encodes a highly unstable
Pex5p fragment with no complementing activity. Consistent
with the morphological analysis (Figure 1D), the 52 kDa Bcomponent of PTS1 protein, AOx, which is derived from the
199
75 kDa A-component [6], and cleavage of the PTS2 signal
peptide of thiolase in peroxisomes [7,8] were not detectable in
ZPEG101 (Figure 3A, lane 4). This was the same for ZP105 and
ZP139 (Figure 3A, lanes 2 and 3), in contrast with the normal
import of these proteins in the wild-type CHO-K1 (Figure 3A,
lane 1). Taken together, these results suggested that ZPEG101 is
a novel pex5 CHO mutant completely lacking Pex5p protein.
Moreover, in ZPEG101, Pex14p was detected at a remarkably
lower level (Figure 3A, lane 4) as compared with that in CHO-K1
and ZP105 and ZP139 (Figure 3A, lanes 1–3), consistent with
the barely detectable immunostaining of Pex14p (Figure 1A, d).
The level of Pex13p was slightly elevated in all three of these
pex5 mutants than in CHO-K1 (Figure 3A), as has been observed
previously in other peroxisome matrix protein import-deficient
CHO mutants [10]. Pex14p, but not Pex13p, was likewise severely
reduced in HeLa cells that had been treated with PEX5 siRNA.
This siRNA treatment depleted Pex5p to a barely detectable level,
giving rise to severely abrogated peroxisomal import of AOx as
shown by the low level of the B-component of AOx (Figure 3B).
PEX14 mRNA was expressed at a normal level in ZPEG101, as
in CHO-K1 (Figure 3C). No mutation was identified in PEX14
cDNA derived from ZPEG101 (results not shown), indicating
that Pex14p in ZPEG101 is unstable at the protein, but not the
transcriptional, level. We therefore interpreted these results to
mean that the elimination of Pex5p results in a severe reduction
in Pex14p.
To further examine whether ectopic PEX5 expression restores
such defects in ZPEG101, we established a stable transformant
of ZPEG101 expressing FLAG–Pex5pL, named ZPEG101/FLPEX5L. In the immunostaining analysis of ZPEG101/FL-PEX5L
cells, AOx (Figure 4A, a), as well as EGFP–PTS1, thiolase
and catalase (results not shown) were colocalized with PMP70positive punctate structures (peroxisomes; Figure 4A, b) as in the
parental TkaEG1 cells (Figures 1A and 1C), whereas the soluble
proteins were present in the cytosol in ZPEG101 (Figure 4A,
c). Immunoblot analysis also showed that the impaired import
of AOx in ZPEG101 (Figure 4B, lanes 7 and 9) were restored
by Pex5pL expression as verified by the appearance of the
AOx component-B in the post-nuclear supernatant and organelle
fractions of ZPEG101/FL-PEX5L (Figure 4B, lanes 4 and 6)
as in CHO-K1 (Figure 4B, lanes 1 and 3). In addition, the
observed lower level of Pex14p in ZPEG101 was restored in
ZPEG101/FL-PEX5L (Figure 4B, lanes 4 and 6) to the same level
as CHO-K1 (Figure 4B, lanes 1 and 3). Two RING peroxins,
Pex10p and Pex2p, a membrane peroxin, Pex3p, and a major
PMP, PMP70, were detected at nearly the same level in the
organelle fractions from CHO-K1, ZPEG101 and ZPEG101/FLPEX5L (Figure 4C), whereas Pex12p appeared to be slightly
less expressed in ZPEG101 (Figure 4C, lane 2). Together with
the morphological findings (Figure 1A), these results strongly
suggested that Pex14p was specifically lowered in ZPEG101.
ZPEG101/FL-PEX5L was indistinguishable from CHO-K1 in
the morphological and biochemical properties, although FLAG–
Pex5pL was expressed in ZPEG101/FL-PEX5L cells at a higher
level (∼ 10-fold) than endogenous Pex5p in CHO-K1 (Figure 4B,
lanes 1–6). Therefore, we concluded that PEX5L complements
peroxisomal defects of Pex14p stability as well as matrix protein
import in ZPEG101.
Biogenesis of Pex14p in ZPEG101
To further verify the biogenesis of Pex14p in ZPEG101,
CHO-K1 and pex5 ZPEG101 were pulse-labelled for 1 h with
[35 S]methionine and [35 S]cysteine and the radioactivity was
chased in a medium containing no labelled amino acids. After the
c The Authors Journal compilation c 2013 Biochemical Society
200
Figure 3
R. Natsuyama, K. Okumoto and Y. Fujiki
Pex5p-deficient ZPEG101 shows a lower level of Pex14p
(A) Wild-type CHO-K1 (lane 1) and the pex5 CHO mutants ZP105 (lane 2), ZP139 (lane 3) and ZPEG101 (lane 4) were lysed in sample buffer and analysed by SDS/PAGE. Immunoblotting was done
using antibodies against the proteins indicated on the left-hand side. Note that ZPEG101 (completely lacking Pex5p) showed a lesser amount of Pex14p as compared with the other pex5 mutants,
ZP105 and ZP139, in which their respective mutant forms of Pex5p were partially expressed. (B) Knockdown of Pex5p in HeLa cells decreases Pex14p protein level. HeLa cells treated for 96 h with a
control siRNA (lane 1) and PEX5 siRNA (lane 2) were analysed as in (A) by immunoblotting with the antibodies indicated on the left-hand side. (C) Expression of PEX14 mRNA in ZPEG101. Northern
blot analysis using mRNA (5 μg) isolated from CHO-K1 (lane 1) and ZPEG101 (lane 2) was done with 32 P-labelled probes specific against PEX14 (upper panel) and actin (lower panel).
initial 1-h pulse-labelling, a similar amount of [35 S]Pex14p was
detected in the immunoprecipitates from CHO-K1 and ZPEG101
with the anti-Pex14p antibody (Figure 5A, lanes 1 and 5),
indicating normal synthesis of Pex14p in ZPEG101. In ZPEG101,
[35 S]Pex14p was significantly reduced after a 1-h chase and barely
detectable after a 2- and 6-h chase (Figure 5A, lanes 6–8), whereas
[35 S]Pex14p was stable at least after a 6-h chase in CHO-K1
(Figure 5A, lanes 2–4). These results strongly suggested a rapid
turnover of Pex14p in ZPEG101.
PMPs including Pex14p are synthesized in free ribosomes in
the cytosol, recognized by the cytosolic PMP receptor Pex19p
and then transported to peroxisomes [30,31]. To examine whether
the loss of Pex5p affects the translocation process of Pex14p
to the peroxisomes, CHO-K1, pex5 ZPEG101 and pex14 ZP110,
devoid of expression of Pex14p [21], were pulse-labelled with
35
S-labelled methionine and -cysteine for 1 h and fractionated into
organelle and cytosol fractions. The immunoblot analysis showed
that a normal and a small amount of Pex14p was immunoprecipitated only from the organelle fractions of CHO-K1 and ZPEG101
respectively (Figure 5B, lanes 3–6), consistent with the subcellular
localization of Pex14p (Figure 4B), whereas no Pex14p was
detected in both fractions of ZP110 (Figure 5B, lanes 1 and 2). On
the other hand, newly synthesized [35 S]Pex14p was recovered in
both cytosol and organelle fractions from ZPEG101 (Figure 5B,
lanes 5 and 6), whereas [35 S]Pex14p was mostly in organelle
fraction from CHO-K1 (Figure 5B, lanes 3 and 4). Collectively,
these results strongly suggested that Pex14p synthesized in the
cytosol is rapidly localized to peroxisomes in the wild-type
CHO-K1 cells. In contrast, it is more probable that in ZPEG101
Pex14p is unstable presumably due to inefficient translocation to
c The Authors Journal compilation c 2013 Biochemical Society
peroxisomes, resulting in the apparent increase in its cytosolic
localization and elevated susceptibility to degradation.
Although Pex5p is present mainly in the cytosol, it is
partly localized in the peroxisomal membrane in a proteaseresistant form, which constitutes a putative translocation complex
including Pex14p and Pex13p [16,18,32,33]. To examine
the possibility that peroxisome-localized Pex5p has a role in the
stability of Pex14p, the organelle fractions of CHO-K1 and
ZPEG101 were treated with various concentrations of NaCl
and then centrifuged. In CHO-K1, the amount of Pex14p in the
re-isolated organelle fraction was not altered by treatment with
any of the concentrations of NaCl tested (Figure 5C, lanes 1–
5). On the other hand, after NaCl treatment less Pex14p was
recovered from the ZPEG101-derived organelle fraction in a
concentration-dependent manner (Figure 5C, lanes 6–10). Taken
together, these results strongly suggest that Pex5p is required for
the translocation, integration and stabilization of Pex14p into the
peroxisome membrane.
The fifth pentapeptide motif in Pex5pL is essential for
Pex14p stability
In the interaction of Pex5p with Pex14p, all of the seven
pentapeptide WXXXF/Y motifs in the N-terminal region of
Pex5pL are suggested to be binding sites for Pex14p [11,12].
The motifs 1, 3 and 5 bind to Pex14p with a much higher
affinity as compared with the others [11,12,34]. To investigate
which WXXXF/Y motif, if any, of Pex5pL is involved in the
stabilization, we constructed a series of C-terminally HA-tagged
full-length Pex5pL (Pex5pL–HA) mutants with various alanine
A novel CHO mutant lacking Pex5p
Figure 4
201
Expression of Pex5p restores the impaired phenotype of ZPEG101
(A) ZPEG101/FL-PEX5L, a stable formant of ZPEG101 expressing FL-ClPEX5L (a and b) and ZPEG101 (c and d) were dual immunostained with antibodies against AOx (a and d) and PMP70
(b and e). Scale bar, 10 μm. (B) Post-nuclear supernatant fractions (P) prepared from CHO-K1 (lanes 1–3), ZPEG101/FL-PEX5L (lanes 4–6) and ZPEG101 (lanes 7–9) were separated into
cytosol (C) and organelle (O) fractions by ultracentrifugation. Equal aliquots of respective fractions were analysed by SDS/PAGE and immunoblotting using antibodies against the proteins
indicated on the left-hand side. MDH, a mitochondrial protein. (C) Organelle fractions were prepared from CHO-K1 (lane 1), ZPEG101 (lane 2) and ZPEG101/FL-PEX5L (lane 3) as in
(B). Equal aliquots were analysed by SDS/PAGE and immunoblotting with antibodies against the proteins indicated on the left-hand side.
substitutions in the conserved amino acids at the positions 1 (W)
and 5 (F or Y) of the seven WXXXF/Y motifs (Figure 6A).
First, the respective pentapeptide-motif mutants of Pex5pL–
HA were verified for binding to Pex14p. Immunoprecipitation
analysis of Pex5pL–HA variants expressed in CHO-K1 cells was
performed. Mut123, a Pex5pL–HA variant with mutations in
the WXXXF/Y motifs 1, 2 and 3, was co-immunoprecipitated
with endogenous Pex14p at a level 10 % that of the wild-type
(Figure 6B, lanes 6 and 7). This is in agreement with previous
studies that the Mut123 variant of the N-terminal 243 aminoacid-long Pex5pL, termed Pex5p(1-243), showed no binding
to Pex14p in vitro [12]. Pex14p in the immunoprecipitate of
the WXXXF/Y motif 5 mutant of Pex5pL–HA, Mut5, was
moderately decreased as compared with the wild-type (Figure 6B,
lane 8), whereas Pex14p was not co-immunoprecipitated with
Mut1-7 (a variant with mutations in all of the seven WXXXF/Y
motifs; Figure 6B, lane 9). All of the Pex5pL–HA mutants
active in binding to Pex14p, including Mut123 and Mut5, were
targeted to the peroxisomes in CHO-K1 (Supplementary Figure
S2 at http://www.biochemj.org/bj/449/bj4490195add.htm). These
results strongly suggested that the WXXXF/Y motif 5 functions
as an auxiliary binding site for Pex14p in vivo, whereas
Pex5pL interacts with Pex14p mainly via WXXXF/Y motifs 1–3.
Furthermore, the impaired PTS1 protein import in ZPEG101 was
not restored by expression of Mut123, Mut234, Mut1235, Mut1-7
or mock transfection (Figure 6C, b, c and f–h). The peroxisomal
localization of EGFP–PTS1 in ZPEG101 was restored only with
Mut5 and Mut567 (Figure 6C, d and e) to the level of wild-type
Pex5pL–HA (Figure 6C, a). Taken together, these results suggest
that the binding of Pex5pL to Pex14p via WXXXF/Y motifs 1–3
was necessary for the complementing activity and that WXXXF/Y
motif 5-mediated binding was dispensable (Figure 6D, bottom
panel).
Next, the Pex5pL–HA mutants were examined to investigate
whether they restore the reduced level of Pex14p in ZPEG101.
When full-length Pex5pL–HA was transiently expressed in
ZPEG101, the level of Pex14p was elevated (Supplementary Figure S3, lane 1 at http://www.biochemj.org/bj/449/bj4490195add.
htm) as was also observed in ZPEG101 stably expressing
FL-Pex5pL (Figure 4B). Pex14p in ZPEG101 was less,
but significantly, increased by expression of Pex5pL(1-305)
containing all seven of the WXXXF/Y motifs (Supplementary
Figure S3, lane 2), whereas Pex5pL(1-243), harbouring
WXXXF/Y motifs 1–4, and Pex5pL(305-632) did not restore the
levels of Pex14p (Supplementary Figure S3, lanes 3 and 4), as in
the mock transfection (Supplementary Figure S3, lane 5). These
results suggest that the N-terminal region of Pex5pL containing
the WXXXF/Y motifs, especially motifs 5–7, plays an important
role in stabilizing the level of expressed Pex14p in ZPEG101.
The expression of Mut234, a Pex5pL–HA mutant with normal
c The Authors Journal compilation c 2013 Biochemical Society
202
Figure 5
R. Natsuyama, K. Okumoto and Y. Fujiki
Biogenesis of Pex14p in ZPEG101
(A) CHO-K1 (lanes 1–4) and ZPEG101 (lanes 5–8) were labelled with [35 S]methionine and [35 S]cysteine for 1 h and were chased for the indicated times at the top. The cells were lysed and subjected
to immunoprecipitation with an anti-Pex14p antibody. Upper panel, the immunoprecipitates and the total cell lysates (5 %) were separated by SDS/PAGE and analysed by autoradiography for
[35 S]Pex14p and immunoblotting with an anti-LDH antibody. Lower panel, [35 S]Pex14p level at each time point was quantified, normalized with LDH as a loading control and plotted by taking as 1
the level at 0 h chase. Results are means +
− S.E.M. for three independent experiments. *P < 0.05 and **P < 0.01. (B) pex14 ZP110 (lanes 1 and 2), CHO-K1 (lanes 3 and 4) and pex5 ZPEG101
(lanes 5 and 6) cells were pulse-labelled with [35 S]methionine and [35 S]cysteine as in (A) and fractionated as described in the Materials and methods section. Immunoprecipitated Pex14p from equal
aliquots of the resultant supernatant (S) and pellet (P) fractions was analysed by autoradiography (top panel) and immunoblotting with anti-Pex14p antibody (upper middle panel). Equal aliquots
of the supernatant and pellet fractions from the respective cells were analysed by SDS/PAGE and immunoblotting using antibodies against an endoplasmic membrane protein, cytochrome P450
reductase (P450R; lower middle panel) and cytosolic LDH (bottom panel). (C) Integrity of Pex14p in ZPEG101. Upper panel, organelle fractions of CHO-K1 (lanes 1–4) and ZPEG101 (lanes 5–8),
prepared as in (B), were incubated for 30 min on ice in buffer containing various concentrations of NaCl as indicated at the top. Reaction mixtures were centrifuged. Pellet fractions were analysed
by immunoblotting with antibodies to Pex14p and Pex13p. Lower panel, the Pex14p level was normalized with Pex13p as a loading control. Results are means +
− S.E.M. for three independent
experiments. **P < 0.01.
binding to Pex14p, but deficient in the binding to Pex13p [12],
restored the level Pex14p in ZPEG101, nearly to the same level
as observed in CHO-K1 (Figure 6D, lanes CHO-K1 and Mut234)
and the wild-type Pex5pL–HA (Figure 6D, lane WT). The Pex14p
level in ZPEG101 was likewise restored by expression of Mut123
(Figure 6D, lane Mut123), despite its lower binding activity to
Pex14p (Figure 6B, lane 7), thereby suggesting that binding of
Pex5pL to Pex13p and Pex14p via WXXXF/Y motifs 1–3 was
dispensable for sustaining the stability of Pex14p. In contrast,
Mut5 and other multiple WXXXF/Y-motif mutants containing
the motif 5 mutation, showed only a slightly elevated level of
Pex14p (Figure 6D, lanes Mut5, Mut567, Mut1235 and Mut1-7),
suggesting that the WXXXF/Y motif 5, not motifs 1–4, is essential
for the Pex14p stability. Taken together, the results suggest that
the WXXXF/Y motifs 1 and 3 of Pex5pL mainly function in the
binding to Pex14p and the matrix protein import activity, whereas
the WXXXF/Y motif 5 has an essential role in the stabilizing
Pex14p in the peroxisome membrane (Figure 6D, bottom panel).
Next, we expressed wild-type Pex5pS–HA, a shorter form
of Pex5p lacking a Pex5pL-specific 37 amino-acid insertion
containing the WXXXF/Y motif 5, in ZPEG101. Pex5pS–HA
restored the reduced level of Pex14p in ZPEG101, but less
c The Authors Journal compilation c 2013 Biochemical Society
efficiently than Pex5pL–HA (Figure 6E, lanes 2 and 4) in a manner
dependent on the WXXXF/Y motifs excluding motif 5 where no
restoration of the lowered Pex14p was observed with Mut1-4,6,7
(all of the six WXXXF/Y motifs in Pex5pS were mutated, where
the fifth and sixth WXXXF/Y motifs in Pex5pS are numbered as
6 and 7 respectively; Figure 6E, lane 5). Together with the results
obtained with various WXXXF/Y motif mutants of Pex5pS–HA,
we conclude that the motifs 1 and 7 possess the Pex14p-stabilizing
activity in Pex5pS, with a relatively higher efficiency of motif 1 as
compared with motif 7 (Figure 6E). Thus the WXXXF/Y motifs
1 and 7 of Pex5pS are more likely to play a compensatory role for
the function of motif 5 of Pex5pL.
Pex5p–Pex13p interaction is essential for the import of PTS1
proteins and catalase, but not for PTS2 proteins
On the basis of an assay with a Pex5pL mutant, Mut234, in
the pex5 mutant ZP105, we earlier suggested that interactions
between Pex5pL and Pex13p are required for peroxisomal import
of catalase, but not PTS1 and PTS2, in mammalian cells [12].
However, ZP105 might not be the most suitable mutant to evaluate
A novel CHO mutant lacking Pex5p
Figure 6
203
Pentapeptide WXXXF/Y motif 5 in Pex5pL is essential for stabilization of Pex14p
(A) Schematic representation of the domain structure of Chinese hamster Pex5pL and Pex5pS. Seven pentapeptide (WXXXF/Y)-motifs (solid horizontal bars), a 37-amino-acid insertion (grey box)
and a C-terminal region containing seven TPR motifs (black box) are shown in Pex5pL, whereas six WXXXF/Y motifs lacking the fifth one are shown in Pex5pS. (B) Interaction of Pex5p with Pex14p
via WXXXF/Y motifs. CHO-K1 cells transfected with wild-type PEX5L–HA and its variants were immunoprecipitated (IP) with anti-HA antibody (lanes 6–10) and analysed by immunoblotting using
antibodies against HA and Pex14p. Input (5 %) was loaded in lanes 1–5. (C) Wild-type PEX5L–HA and its variants were transfected into ZPEG101 and their complementing activity of ZPEG101
was verified by import of EGFP–PTS1 as in Figure 1(A). Scale bar, 10 μm. (D) Restoration of Pex14p protein level in ZPEG101 cells. ZPEG101 cells were transfected with the wild-type PEX5L–HA
and its variants and analysed by immunoblotting as in (B). LDH was detected as a loading control. Wild-type Pex5pL–HA (WT) and the variants were verified for restoring PTS1 protein import
activity (PTS1 import) and Pex14p level (stability) in ZPEG101 and for their localization into peroxisomes (Ps localization) in CHO-K1 cells (bottom panels). − , negative; + , positive; + + ,
highly positive. (E) Involvement of Pex5pS in Pex14p stability. Pex5pS, a shorter form of Pex5p, lacks a Pex5pL-specific 37-amino-acid insertion containing the WXXXF/Y motif 5 (see a schematic
view in A). The fifth and sixth WXXXF/Y motifs in Pex5pS are numbered as motifs 6 and 7 respectively, because these are the motifs equivalent to the sixth and seventh ones in Pex5pL. ZPEG101
cells were transfected with the wild-type PEX5S–HA and its variants and analysed by immunoblotting as in (D). Note that the wild-type PEX5S-HA restored the lowered Pex14p level in
ZPEG101 cells, but less efficiently than wild-type PEX5L–HA (lanes 2 and 4). This Pex14p-stabilizing activity of Pex5pS was reduced largely in Mut1-4 and Mut1 (lanes 6 and 9), partially in Mut6,7
and Mut7 (lanes 7 and 10), and almost completely in Mut1,7 and Mut1-4,6,7 (lanes 8 and 5). Mut2 and Mut3 showed full activity and were as active as the wild-type (lanes 4, 11 and 12).
the complementary activity of Pex5p variants because a very low
level of the Pex5p mutant with a missense mutation in the first
TPR motif [12] is expressed at 37 ◦ C in ZP105 (Figure 3A, lane
2), with a temperature-sensitive phenotype expressing a normal
level of Pex5p [13]. Therefore we also verified the importance
of Pex5p–Pex13p interaction in matrix protein import in pex5
ZPEG101 without Pex5p.
Wild-type Pex5pL–HA and the Mut234 mutant were separately
expressed in ZP105 or ZPEG101 and the import of PMPs was
analysed by immunofluorescent microscopy and immunoblotting.
In ZP105, peroxisomal import of the PTS1 protein AOx and
the PTS2 protein thiolase was restored with both the wildtype Pex5pL and Mut234, whereas catalase import was reestablished only with the wild-type Pex5pL (Supplementary
Figure S4 at http://www.biochemj.org/bj/449/bj4490195add.htm)
as reported previously [12]. Upon expression of Mut234 in ZP105,
peroxisomal AOx import was also biochemically assessed by
conversion of the A-polypeptide chain of AOx into the B-chain
[6]. This occurred with less efficiency as compared with the wild-
type Pex5pL–HA (Figure 7A, lanes 1 and 2). Under the same
experimental conditions, upon Mut234 expression in ZPEG101,
the impaired import of thiolase was increased (Figure 7B, h), but
catalase was not imported (Figure 7B, b), as observed in ZP105
(Supplementary Figure S4, b and h), whereas the import of both
proteins was restored with wild-type Pex5pL–HA (Figure 7B,
a and g). After expression of Mut234 in ZPEG101, AOx was
stained in a diffuse pattern in the cytosol (Figure 7B, e), where
the AOx B-polypeptide chain was not detectable (Figure 7A,
lane 5). The lower level of Pex14p in ZPEG101 was altered to
a normal level comparable with wild-type Pex5pL by Mut234
expression (Figure 7A, lanes 4–6), consistent with the data
shown in Figure 6(D). These results strongly suggested that in
ZPEG101 Mut234 was defective in not only the impaired import
of catalase, but also PTS1 proteins. In the immunoprecipitation
assay, wild-type Pex5pL–HA, but not Mut234, was observed to
co-immunoprecipitate with FLAG–Pex13p expressed in CHOK1 cells (Figure 7C, lanes 1–6), whereas both the wild-type
Pex5pL–HA and Mut234 were equally co-immunoprecipitated
c The Authors Journal compilation c 2013 Biochemical Society
204
Figure 7
R. Natsuyama, K. Okumoto and Y. Fujiki
Pex5p–Pex13p interaction is required for import of PTS1 protein, but not for PTS2 protein
(A) Pex5pL(Mut234) restores Pex14p level, but does not restore the import defect of AOx, a PTS1 protein in ZPEG101. pex5 ZP105 (lanes 1–3) and pex5 ZPEG101 cells (lanes 4–6) were transfected
with the wild-type PEX5L (WT)–HA and PEX5L(Mut234)–HA and analysed by immunoblotting with the antibodies indicated on the left-hand side. (B) Pex5pL(Mut234) complements the import
defects of PTS2 protein, not PTS1 protein and catalase, in ZPEG101. ZPEG101 cells were transfected with PEX5L (WT)–HA (a, d and g), PEX5L(Mut234)–HA (b, e and h), and a mock plasmid
(c, f and i), and immunostained with antibodies against catalase (a–c), AOx (d–f) and thiolase (g–i) as in Figure 1(A). Scale bar, 10 μm. (C) Interaction of Pex5pL with Pex13p and Pex14p. FL-PEX13
and FL-PEX14 were co-transfected into 207P7 cells with PEX5L(WT)–HA , PEX5L(Mut234)–HA and a mock plasmid. Cells were analysed by immunoprecipitation (IP) with anti-FLAG IgG-agarose
(lanes 4–6 and 10–12) and by immunoblotting using antibodies against HA and FLAG. Input (5 %) was loaded in lanes 1–3 and 7–9.
c The Authors Journal compilation c 2013 Biochemical Society
A novel CHO mutant lacking Pex5p
with FLAG–Pex14p (Figure 7C, lanes 7–12). These results
suggest that mutations in WXXXF/Y motif 2–4 abrogated the
interaction of Pex5p with Pex13p, but not with Pex14p in vivo,
in a good agreement with the findings by pull-down assay using
the GST (glutathione transferase) fusion protein of Mut234 [12].
Taken together, re-verifying Mut234 in ZPEG101 absent from
Pex5p revealed that the Pex5p–Pex13p interaction is essential for
import of PTS1 proteins as well as catalase, but not for that of
PTS2 proteins.
DISCUSSION
In the present study, we isolated another pex5 CHO mutant,
ZPEG101, defective in the import of both PTS1 and PTS2
proteins like ZP105 [10]. ZPEG101 is distinct from other
known pex5 mutants in the level of its Pex5p expression;
Pex5p is not detectable and the level of its receptor Pex14p
is severely reduced (Figure 3A). In ZPEG101, a homozygous
frame-shift mutation of PEX5 gives rise to an 85-amino-acid
long premature, and apparently unstable, Pex5p (Figure 2
and Supplementary Figure S1). In ZP105 and ZP139, low,
but significant, amounts of Pex5p, which harbour a missense
mutation in the first and sixth TPR motifs respectively
[10], are discernible (Figure 3A). Pex5p mutants lacking the
C-terminal region such as Pex5p(1-243) are expressed at the
same level as the wild-type Pex5p and are indeed sufficient
for PTS2 protein import [12]. Accordingly, it is more probable
that a lower level of Pex5p expression in ZP105 and ZP139
is sufficient for sustaining Pex14p stability. Therefore ZPEG101 is
the first pex5 CHO mutant that shows a barely detectable Pex14p
level and no detectable Pex5p.
In addition to the complementarity in the defects in PMP
import in ZPEG101, the lower protein level of Pex14p is
restored by Pex5pL expression (Figures 4B and 6D), clearly
indicating that Pex5p is responsible for the Pex14p stability in
peroxisomes. Pex5pL interacts with Pex14p via seven WXXXF/Y
motifs [11,12]. In the present study using various Pex5pL
mutants, the WXXXF/Y motifs 1–4 are dispensable for stabilizing
Pex14p in ZPEG101 (Figure 6D), whereas these motifs are
the main binding sites to Pex14p in vitro and are required
for the complementation of the impaired matrix protein import
(Figure 6C) [12]. Moreover, to maintain a normal level of
Pex14p, the WXXXF/Y motif 5 of Pex5pL is also essential
(Figure 6D), which is another strong Pex14p-binding site with
unknown function [11,12]. Pex5pS, devoid of a Pex5pL-specific
WXXXF/Y motif 5-containing insertion, likewise shows less,
but significant, Pex14p-stabilizing activity via WXXXF/Y motifs
1 and 7 (Figure 6E). We interpret these results to mean that
Pex14p stability, predominantly sustained by the WXXXF/Y
motif 5 of Pex5pL, is compensated for by binding to Pex5pS
via WXXXF/Y motifs 1 and 7. This is in good agreement with
the finding that the level of Pex14p is not affected in another
recently isolated pex5 CHO mutant, ZPEG241, which expresses
Pex5pS and not Pex5pL [35]. Thus these data clarify the novel
function of Pex5pL via the WXXXF/Y motif 5 in mammalian
cells, in addition to the essential role of WXXXF/Y motifs 1–
3 in the complementing activity (Figures 6C and 6D). Pex5pLspecific insertion is required for the binding of Pex5pL to Pex7p
and the peroxisomal import of PTS2 proteins [10,13]. Therefore
it is probable that Pex5pL forms a WXXXF/Y motif 5-mediated
more stable complex with Pex14p during the translocation of
PTS2 proteins, whereas the Pex5pS–Pex14p complex is distinctly
and transiently assembled during the import of PTS1 proteins.
Moreover, Pex14p level may be reduced in PEX5-knockout mice
[36], similar to PEX5-depleted HeLa cells (Figure 3B) and
205
ZPEG101 (Figure 3A). The number of WXXXF/Y motifs and
the function are varied in species (for a review see [37]). For
example, a reduced level of Pex14p was not observed in pex5null mutant Saccharomyces cerevisiae [38]. S. cerevisiae Pex5p
possesses two distinct binding sites for Pex14p: the inverted
WXXXF motif for the Pex14p-N region [39] and another potential
site that has not been fully elucidated for the Pex14p-C region
[40,41]. The mammal-specific instability of Pex14p in Pex5pdeficient cells is attributed to the WXXXF/Y motif-dependent
Pex5p–Pex14p interaction, which is different from the mode of
interaction in yeast ([11,12], and the present study). Alternatively,
in pex5-null yeast mutants Pex14p may be anchored to the
membrane and stabilized by Pex8p and Pex17p, two yeastspecific peroxins that interact with Pex14p in peroxisomes [16].
Therefore WXXXF/Y motifs 1–4 in mammalian Pex5pL are
likely to be a core element essential for peroxisomal protein
import and WXXXF/Y motifs 5–7 confer additional functions
such as maintaining Pex14p stability, which is acquired during
the evolution. Indeed WXXXF/Y motif 5 was not essential for
the restoration of PMP import (Figure 6C) and its targeting to
peroxisomes (Supplementary Figure S2, g and h). Consistent with
our notion, it is noteworthy that the WXXXF/Y motif 6 of human
Pex5pL was recently shown to have an important role in the import
of catalase into peroxisomes [42].
How Pex5pL regulates the level of Pex14p remains to be
defined. Almost all PMPs including Pex14p are imported by
the Pex19p-dependent Class I pathway, where the PMP receptor
Pex19p binds PMPs in the cytosol and translocates them into
peroxisomes [30,31]. In Pex5p-deficient ZPEG101 cells, about
50 % of the newly synthesized Pex14p is localized in peroxisomes
with the remainder apparently residing in the cytosol, in contrast
with Pex14p which is exclusively localized to the peroxisomes
in CHO-K1 cells (Figure 5B). Moreover, Pex14p localized to the
peroxisomes in ZPEG101 is more sensitive to the high-salt wash
compared with Pex14p in CHO-K1 (Figure 5C). These results
suggest that in ZPEG101 the less efficient integration of Pex5p
into the peroxisomal membrane or Pex14p-containing membrane
protein complexes [33,43] leads to a lower level of Pex14p. In
the shuttling of Pex5p between peroxisomes and the cytosol
in normal mammalian cells, Pex5p initially forms ∼ 800-kDa
complexes with Pex14p and Pex13p upon peroxisomal import
[18]. In yeast, an ion-conducting channel activity was recently
reported on a similar complex mainly consisting of Pex5p and
Pex14p in the peroxisomal membrane, implicating a peroxisomal
import pore [44]. Therefore it is more probable that peroxisomelocalized Pex5p functions in maintaining the level of Pex14p via
the WXXXF/Y motif 5.
Otera et al. [12] reported that the interaction of Pex5pL with
the N-terminal region of Pex13p via WXXXF/Y motifs 2–4 was
required for the import of catalase, but not for that of PTS1 and
PTS2 proteins in mammalian cells, on the basis that the Mut234
mutant of Pex5pL, defective in the interaction with Pex13p,
restored the impaired import of PTS1 and PTS2 proteins and
not catalase in ZP105. In the present study, we re-evaluated
Mut234 with the Pex5p-less mutant cell line ZPEG101. The
import defect of PTS1 proteins as well as catalase was not restored
by Mut234 expression in ZPEG101 (Figures 7A and 7B), thereby
suggesting an essential role of the Pex5p–Pex13p interaction in the
import of PTS1 protein and catalase. A present explanation for
the different phenotype of Mut234 in the two pex5 mutants ZP105
and ZPEG101 may include the presence of a mutated form of
Pex5p at a low level in ZP105, in contrast with no discernible
Pex5p in ZPEG101 (Figure 3A). It is more likely to be in ZP105
that a small amount of endogenous Pex5p harbouring a mutation
in the TPR motif 1 [10] and exogenously expressed Mut234
c The Authors Journal compilation c 2013 Biochemical Society
206
R. Natsuyama, K. Okumoto and Y. Fujiki
mutually complement their respective defect in the cargo protein
import by forming a hetero-oligomer [13,45]. This interpretation
is in good agreement with the data that Mut234 alone does not
re-establish the peroxisomal import of PTS1 proteins and catalase
in ZPEG101 (Figures 6C and 7B). PTS1-cargo-loaded Pex5p is
initially targeted to peroxisomes via the binding to Pex14p and
is translocated to the ∼ 800-kDa complexes including Pex13p
[18]. Therefore interaction of Pex5p with Pex13p might play
an important role in the formation of the initial translocation
machinery in PTS1 protein import. In contrast with PTS1 protein
import, Pex5p–Pex13p interaction is dispensable for PTS2
protein import (Figure 7B) [12]. Pex5pL specifically associates
with the PTS2 receptor Pex7p and mediates the targeting of
the Pex7p–PTS2 protein complex into peroxisomes by docking
to Pex14p [13–15]. However, after localization of Pex7p to
the peroxisomes, the interaction of Pex7p with Pex13p is not
mediated by Pex5pL [15]. Therefore these reports and the results
of the present study (Figure 7B) strongly suggested that after the
targeting of Pex7p–PTS2 protein complex to the peroxisomes,
PTS2 protein is translocated into the peroxisome matrix in a
manner independent of Pex5p–Pex13p interaction. This is in good
agreement with the differential import of PTS1 and PTS2 proteins
in in vitro transport system [46]. A Pex14p mutant lacking affinity
to Pex13p has no complementing activity for the impaired import
of PTS1 and PTS2 proteins in the pex14 CHO mutant ZP161 [43],
strongly suggesting that the binding of Pex13p to Pex14p, and not
Pex5p, is essential for PTS2 protein import. Interaction of Pex5p
with Pex13p is also conserved in S. cerevisiae [47,48] and Pichia
pastoris [49]. However, yeast Pex5p binds to Pex13p at the SH3
domain [47–49] and not at the N-terminal region that is defined
in mammalian cells [12]. Molecular mechanisms underlying the
dynamic formation and function of complexes including Pex5p,
Pex14p and Pex13p remain to be investigated in more details [50].
Pex5p-less ZPEG101 would be useful for addressing such issues.
AUTHOR CONTRIBUTION
Kanji Okumoto and Yukio Fujiki designed the research; Ryuichi Natsuyama and Kanji
Okumoto performed the research; Ryuichi Natsuyama, Kanji Okumoto and Yukio Fujiki
analysed the data; and Ryuichi Natsuyama, Kanji Okumoto and Yukio Fujiki wrote the
paper.
ACKNOWLEDGEMENTS
We thank M. Nishi for the Figure illustrations, S. Okuno for technical assistance and the
other members of our laboratory for discussions.
FUNDING
This work was supported, in part, by the Science and Technology Agency of Japan, Grantsin-Aid for Scientific Research [grant numbers 19058011, 20370039 and 24247038 (to
Y.F.)], The Global COE Program from The Ministry of Education, Culture, Sports, Science,
and Technology of Japan and the Takeda Science Foundation and Japan Foundation for
Applied Enzymology.
REFERENCES
1 Wanders, R. J. A. and Waterham, H. R. (2006) Biochemistry of mammalian peroxisomes
revisited. Annu. Rev. Biochem. 75, 295–332
2 Fujiki, Y., Okumoto, K., Kinoshita, N. and Ghaedi, K. (2006) Lessons from
peroxisome-deficient Chinese hamster ovary (CHO) cell mutants. Biochim. Biophys. Acta
1763, 1374–1381
3 Steinberg, S. J., Dodt, G., Raymond, G. V., Braverman, N. E., Moser, A. B. and Moser, H.
W. (2006) Peroxisome biogenesis disorders. Biochim. Biophys. Acta 1763, 1733–1748
c The Authors Journal compilation c 2013 Biochemical Society
4 Platta, H. W. and Erdmann, R. (2007) The peroxisomal protein import machinery. FEBS
Lett. 581, 2811–2819
5 Gould, S. J., Keller, G.-A., Hosken, N., Wilkinson, J. and Subramani, S. (1989) A
conserved tripeptide sorts proteins to peroxisomes. J. Cell Biol. 108, 1657–1664
6 Miyazawa, S., Osumi, T., Hashimoto, T., Ohno, K., Miura, S. and Fujiki, Y. (1989)
Peroxisome targeting signal of rat liver acyl-coenzyme A oxidase resides at the carboxy
terminus. Mol. Cell. Biol. 9, 83–91
7 Swinkels, B. W., Gould, S. J., Bodnar, A. G., Rachubinski, R. A. and Subramani, S. (1991)
A novel, cleavable peroxisomal targeting signal at the amino-terminus of the rat
3-ketoacyl-CoA thiolase. EMBO J. 10, 3255–3262
8 Osumi, T., Tsukamoto, T., Hata, S., Yokota, S., Miura, S., Fujiki, Y., Hijikata, M., Miyazawa,
S. and Hashimoto, T. (1991) Amino-terminal presequence of the precursor of peroxisomal
3-ketoacyl-CoA thiolase is a cleavable signal peptide for peroxisomal targeting. Biochem.
Biophys. Res. Commun. 181, 947–954
9 Dodt, G., Braverman, N., Wong, C. S., Moser, A., Moser, H. W., Watkins, P., Valle, D. and
Gould, S. J. (1995) Mutations in the PTS1 receptor gene, PXR1, define complementation
group 2 of the peroxisome biogenesis disorders. Nat. Genet. 9, 115–125
10 Otera, H., Okumoto, K., Tateishi, K., Ikoma, Y., Matsuda, E., Nishimura, M., Tsukamoto, T.,
Osumi, T., Ohashi, K., Higuchi, O. and Fujiki, Y. (1998) Peroxisome targeting signal type 1
(PTS1) receptor is involved in import of both PTS1 and PTS2: studies with
PEX5 -defective CHO cell mutants. Mol. Cell. Biol. 18, 388–399
11 Saidowsky, J., Dodt, G., Kirchberg, K., Wegner, A., Nastainczyk, W., Kunau, W.-H. and
Schliebs, W. (2001) The di-aromatic pentapeptide repeats of the human peroxisome
import receptor PEX5 are separate high affinity binding sites for the peroxisomal
membrane protein PEX14. J. Biol. Chem. 276, 34524–34529
12 Otera, H., Setoguchi, K., Hamasaki, M., Kumashiro, T., Shimizu, N. and Fujiki, Y. (2002)
Peroxisomal targeting signal receptor Pex5p interacts with cargoes and import machinery
components in a spatiotemporally differentiated manner: conserved Pex5p WXXXF/Y
motifs are critical for matrix protein import. Mol. Cell. Biol. 22, 1639–1655
13 Otera, H., Harano, T., Honsho, M., Ghaedi, K., Mukai, S., Tanaka, A., Kawai, A., Shimizu,
N. and Fujiki, Y. (2000) The mammalian peroxin Pex5pL, the longer isoform of the mobile
PTS1-transporter, translocates Pex7p–PTS2 protein complex into peroxisomes via its
initial docking site, Pex14p. J. Biol. Chem. 275, 21703–21714
14 Matsumura, T., Otera, H. and Fujiki, Y. (2000) Disruption of interaction of the longer
isoform of Pex5p, Pex5pL, with Pex7p abolishes the PTS2 protein import in mammals:
study with a novel PEX5 -impaired Chinese hamster ovary cell mutant. J. Biol. Chem.
275, 21715–21721
15 Mukai, S. and Fujiki, Y. (2006) Molecular mechanisms of import of peroxisome-targeting
signal type 2 (PTS2) proteins by PTS2 receptor Pex7p and PTS1 receptor Pex5pL. J. Biol.
Chem. 281, 37311–37320
16 Agne, B., Meindl, N. M., Niederhoff, K., Einwaechter, H., Rehling, P., Sickmann, A., Meyer,
H. E., Girzalsky, W. and Kunau, W.-H. (2003) Pex8p: an intraperoxisomal organizer of the
peroxisomal import machinery. Mol. Cell. 11, 635–646
17 Platta, H. W., Grunau, S., Rosenkranz, K., Girzalsky, W. and Erdmann, R. (2005)
Functional role of the AAA peroxins in dislocation of the cycling PTS1 receptor back to
the cytosol. Nat. Cell Biol. 7, 817–822
18 Miyata, N. and Fujiki, Y. (2005) Shuttling mechanism of peroxisome targeting signal
type 1 receptor, Pex5: ATP-independent import and ATP-dependent export. Mol. Cell.
Biol. 25, 10822–10832
19 Tsukamoto, T., Yokota, S. and Fujiki, Y. (1990) Isolation and characterization of Chinese
hamster ovary cell mutants defective in assembly of peroxisomes. J. Cell Biol. 110,
651–660
20 Toyama, R., Mukai, S., Itagaki, A., Tamura, S., Shimozawa, N., Suzuki, Y., Kondo, N.,
Wanders, R. J. A. and Fujiki, Y. (1999) Isolation, characterization, and mutation analysis
of PEX13 -defective Chinese hamster ovary cell mutants. Hum. Mol. Genet. 8, 1673–1681
21 Shimizu, N., Itoh, R., Hirono, Y., Otera, H., Ghaedi, K., Tateishi, K., Tamura, S., Okumoto,
K., Harano, T., Mukai, S. and Fujiki, Y. (1999) The peroxin Pex14p: cDNA cloning by
functional complementation on a Chinese hamster ovary cell mutant, characterization,
and functional analysis. J. Biol. Chem. 274, 12593–12604
22 Kawajiri, K., Harano, T. and Omura, T. (1977) Biogenesis of the mitochondrial matrix
enzyme, glutamate dehydrogenase, in rat liver cells. I. Subcellular localization,
biosynthesis, and intracellular translocation of glutamate dehydrogenase. J. Biochem. 82,
1403–1416
23 Okumoto, K., Abe, I. and Fujiki, Y. (2000) Molecular anatomy of the peroxin Pex12p: RING
finger domain is essential for Pex12p function and interacts with the peroxisome targeting
signal type 1-receptor Pex5p and a RING peroxin, Pex10p. J. Biol. Chem. 275,
25700–25710
24 Tsukamoto, T., Bogaki, A., Okumoto, K., Tateishi, K., Fujiki, Y., Shimozawa, N., Suzuki, Y.,
Kondo, N. and Osumi, T. (1997) Isolation of a new peroxisome deficient CHO cell mutant
defective in peroxisome targeting signal-1 receptor. Biochem. Biophys. Res. Commun.
230, 402–406
A novel CHO mutant lacking Pex5p
25 Tamura, S., Okumoto, K., Toyama, R., Shimozawa, N., Tsukamoto, T., Suzuki, Y., Osumi,
T., Kondo, N. and Fujiki, Y. (1998) Human PEX1 cloned by functional complementation on
a CHO cell mutant is responsible for peroxisome-deficient Zellweger syndrome of
complementation group I. Proc. Natl. Acad. Sci. U.S.A. 95, 4350–4355
26 Ghaedi, K. and Fujiki, Y. (2008) A new method for isolation of CHO cell mutants defective
in peroxisome assembly, using ICR191 as a potent mutagenic agent. Cell. Biochem.
Funct. 26, 684–691
27 Okumoto, K., Misono, S., Miyata, N., Matsumoto, Y., Mukai, S. and Fujiki, Y. (2011)
Cysteine ubiquitination of PTS1-receptor Pex5p regulates Pex5p recycling. Traffic 12,
1067–1083
28 Vercesi, A. E., Bernardes, C. F., Hoffmann, M. E., Gadelha, F. R. and Docampo, R. (1991)
Digitonin permeabilization does not affect mitochondrial function and allows the
determination of the mitochondrial membrane potential of Trypanosoma cruzi in situ. J.
Biol. Chem. 266, 14431–14434
29 Morand, O. H., Allen, L.-A. H., Zoeller, R. A. and Raetz, C. R. H. (1990) A rapid selection
for animal cell mutants with defective peroxisomes. Biochim. Biophys. Acta 1034,
132–141
30 Fujiki, Y., Matsuzono, Y., Matsuzaki, T. and Fransen, M. (2006) Import of peroxisomal
membrane proteins: the interplay of Pex3p- and Pex19p-mediated interactions. Biochim.
Biophys. Acta 1763, 1639–1646
31 Fujiki, Y., Yagita, Y. and Matsuzaki, T. (2012) Peroxisome biogenesis disorders: molecular
basis for impaired peroxisomal membrane assembly in metabolic functions and
biogenesis of peroxisomes in health and disease. Biochim. Biophys. Acta 1822,
1337–1342
32 Gouveia, A. M. M., Reguenga, C., Oliveira, M. E. M., Sa-Miranda, C. and Azevedo,
J. E. (2000) Characterization of peroxisomal Pex5p from rat liver. Pex5p in the
Pex5p–Pex14p membrane complex is a transmembrane protein. J. Biol. Chem. 275,
32444–32451
33 Reguenga, C., Oliveira, M. E. M., Gouveia, A. M. M., Sá-Miranda, C. and Azevedo, J. E.
(2001) Characterization of the mammalian peroxisomal import machinery: Pex2p, Pex5p,
Pex12p, and Pex14p are subunits of the same protein assembly. J. Biol. Chem. 276,
29935–29942
34 Su, J. R., Takeda, K., Tamura, S., Fujiki, Y. and Miki, K. (2009) Crystal structure of the
conserved N-terminal domain of the peroxisomal matrix-protein-import receptor, Pex14p.
Proc. Natl. Acad. Sci. U.S.A. 106, 417–421
35 Honsho, M., Hashiguchi, Y., Ghaedi, K. and Fujiki, Y. (2011) Interaction defect of the
medium isoform of PTS1-receptor Pex5p with PTS2-receptor Pex7p abrogates the PTS2
protein import into peroxisomes in mammals. J. Biochem. 149, 203–210
36 Baes, M., Gressens, P., Baumgart, E., Carmeliet, P., Casteels, M., Fransen, M., Evrard, P.,
Fahimi, D., Declercq, P. E., Collen, D. et al. (1997) A mouse model for Zellweger
syndrome. Nat. Genet. 17, 49–57
207
37 Stanley, W. A. and Wilmanns, M. (2006) Dynamic architecture of the peroxisomal import
receptor Pex5p. Biochim. Biophys. Acta 1763, 1592–1598
38 Girzalsky, W., Rehling, P., Stein, K., Kipper, J., Blank, L., Kunau, W.-H. and Erdmann, R.
(1999) Involvement of Pex13p in Pex14p localization and peroxisomal targeting signal
2-dependent protein import into peroxisomes. J. Cell Biol. 144, 1151–1162
39 Kerssen, D., Hambruch, E., Klaas, W., Platta, H. W., de Kruijff, B., Erdmann, R., Kunau,
W.-H. and Schliebs, W. (2006) Membrane association of the cycling peroxisome import
receptor Pex5p. J. Biol. Chem. 281, 27003–27015
40 Niederhoff, K., Meindl-Beinker, N. M., Kerssen, D., Perband, U., Schaefer, A., Schliebs, W.
and Kunau, W.-H. (2005) Yeast Pex14p possesses two functionally distinct Pex5p and
one Pex7p binding sites. J. Biol. Chem. 280, 35571–35578
41 Williams, C., van den Berg, M. and Distel, B. (2005) Saccharomyces cerevisiae Pex14p
contains two independent Pex5p binding sites, which are both essential for PTS1 protein
import. FEBS Lett. 579, 3416–3420
42 Freitas, M. O., Francisco, T., Rodrigues, T. A., Alencastre, I. S., Pinto, M. P., Grou, C. P.,
Carvalho, A. F., Fransen, M., Sá-Miranda, C. and Azevedo, J. E. (2011) PEX5 protein
binds monomeric catalase blocking its tetramerization and releases it upon binding the
N-terminal domain of PEX14. J. Biol. Chem. 286, 40509–40519
43 Itoh, R. and Fujiki, Y. (2006) Functional domains and dynamic assembly of the peroxin
Pex14p, the entry site of matrix proteins. J. Biol. Chem. 281, 10196–10205
44 Meinecke, M., Cizmowski, C., Schliebs, W., Krüger, V., Beck, S., Wagner, R. and Erdmann,
R. (2010) The peroxisomal importomer constitutes a large and highly dynamic pore. Nat.
Cell Biol. 12, 273–277
45 Schliebs, W., Saidowsky, J., Angianian, B., Dodt, G., Herberg, F. W. and Kunau, W.-H.
(1999) Recombinant human peroxisomal targeting signal receptor PEX5. Structural basis
for interaction of PEX5 with PEX14. J. Biol. Chem. 274, 5666–5673
46 Miyata, N., Hosoi, K., Mukai, S. and Fujiki, Y. (2009) In vitro import of
peroxisome-targeting signal 2 (PTS2) receptor Pex7p into peroxisomes. Biochim.
Biophys. Acta 1793, 860–870
47 Bottger, G., Barnett, P., Klein, A. T. J., Kragt, A., Tabak, H. F. and Distel, B. (2000)
Saccharomyces cerevisiae PTS1 receptor Pex5p interacts with the SH3 domain of the
peroxisomal membrane protein Pex13p in an unconventional, non-PXXP-related manner.
Mol. Biol. Cell 11, 3963–3976
48 Barnett, P., Bottger, G., Klein, A. T. J., Tabak, H. F. and Distel, B. (2000) The peroxisomal
membrane protein Pex13p shows a novel mode of SH3 interaction. EMBO J. 19,
6382–6391
49 Gould, S. J., Kalish, J. E., Morrell, J. C., Bjorkman, J., Urquhart, A. J. and Crane, D. I.
(1996) Pex13p is an SH3 protein of the peroxisome membrane and a docking factor for
the predominantly cytoplasmic PTS1 receptor. J. Cell Biol. 135, 85–95
50 Wolf, J., Schliebs, W. and Erdmann, R. (2010) Peroxisomes as dynamic organelles:
peroxisomal matrix protein import. FEBS J. 277, 3268–3278
Received 5 June 2012/24 September 2012; accepted 26 September 2012
Published as BJ Immediate Publication 26 September 2012, doi:10.1042/BJ20120911
c The Authors Journal compilation c 2013 Biochemical Society
Biochem. J. (2013) 449, 195–207 (Printed in Great Britain)
doi:10.1042/BJ20120911
SUPPLEMENTARY ONLINE DATA
Pex5p stabilizes Pex14p: a study using a newly isolated pex5 CHO cell
mutant, ZPEG101
Ryuichi NATSUYAMA*, Kanji OKUMOTO*† and Yukio FUJIKI*†1
*Graduate School of Systems Life Sciences, Faculty of Sciences, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan, and †Department of
Biology, Faculty of Sciences, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan
Figure S1
Pex5pZPEG101 is undetectable upon its overexpression
Expression and complementation activity of Pex5pZPEG101 . ZPEG101 cells were transfected with
wild-type His-PEX5L–HA (lane 1), His-PEX5LZPEG101 –HA (lane 2) or a mock plasmid (lane 3). At
24 h after transfection, cells were lysed and analysed by immunoblotting using antibodies against
His (upper panel) and LDH (lower panel). Arrowhead indicates His-Pex5pL–HA. Molecular mass
markers are shown on the left-hand side in kDa.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2013 Biochemical Society
R. Natsuyama, K. Okumoto and Y. Fujiki
Figure S2
WXXXF/Y motifs 1–3 and 5 are required for the peroxisomal localization of Pex5p
ZPEG101 cells were transfected with various PEX5L–HA mutants. At 24 h after the transfection, cells were permeabilized with digitonin to remove the cytosol and dual immunostained with antibodies
against HA (a, c, e, g, i, k, m and o) and PMP70 (b, d, f, h, j, l, n and p), as in Figure 4(A) of the main text. Wt, wild-type.
c The Authors Journal compilation c 2013 Biochemical Society
A novel CHO mutant lacking Pex5p
Figure S4 Pex5pL(Mut234), a Pex5pL mutant defective in the binding to
Pex13p, restores import of PTS1 and PTS2 proteins in ZP105
Figure S3 N-terminal 243 amino-acids of Pex5pL, Pex5pL(1-243), is not
sufficient for stabilization of Pex14p
ZPEG101 was transfected with plasmids each encoding wild-type Pex5pL-FLAG (Full length;
lane 1), Pex5pL(1-305) (lane 2), Pex5pL(1-243) (lane 3) and Pex5pL(306-632) (lane 4), plus
a mock plasmid (lane 5). At 24 h after the transfection, cells were lysed and analysed by
immunoblotting with antibodies against Pex14p, FLAG and LDH as in Figure 3(A) of the main
text.
ZP105 cells transfected with wild-type PEX5L–HA (a, d and g), PEX5L(Mut234)–HA (b, e and
h), and a mock plasmid (c, f and i) were immunostained with antibodies to catalase (a–c), AOx
(d–f) and thiolase (g–i) as in Figure 7(B) of the main text. Note that in contrast with ZPEG101,
Pex5pL(Mut234) complemented the import defects of PTS1 and PTS2 proteins in ZP105, but
not catalase [1]. Scale bar, 10 μm.
REFERENCE
1 Otera, H., Setoguchi, K., Hamasaki, M., Kumashiro, T., Shimizu, N. and Fujiki, Y. (2002)
Peroxisomal targeting signal receptor Pex5p interacts with cargoes and import machinery
components in a spatiotemporally differentiated manner: conserved Pex5p WXXXF/Y
motifs are critical for matrix protein import. Mol. Cell. Biol. 22, 1639–1655
Received 5 June 2012/24 September 2012; accepted 26 September 2012
Published as BJ Immediate Publication 26 September 2012, doi:10.1042/BJ20120911
c The Authors Journal compilation c 2013 Biochemical Society