Download DNA sequencing

DNA sequencing
© 2016 Paul Billiet ODWS
Frederick Sanger
Nobel prize for chemistry
1958
(for his work on proteins)
 “Dideoxy” technique for
DNA sequencing.

© 2016 Paul Billiet ODWS
Dideoxyribonucleic acid







DNA uses deoxyribose
To replicate DNA you need nucleotides with
deoxyribose
Deoxyribonucleoside triphosphates = dNTPs
There are four types (dATP, dCTP, dGTP and
dTTP)
If a modified sugar is used replication stops
Modified sugar = dideoxyribose = ddNTP
ddNTPs can be made for each of the bases
(ddATP, ddCTP etc).
© 2016 Paul Billiet ODWS
Dideoxycytidine triphosphate
(ddCTP)
© 2016 Paul Billiet ODWS
“Russian Roulette” replication





Extract DNA to be sequenced
Add supplies of the four dNTPs
Split sample in four tubes
Add DNA polymerase and one of the ddNTPs
Replication will stop after a random number of
base pairs at the point where a ddNTP is inserted.
© 2016 Paul Billiet ODWS
Gel electrophoresis
ddNTP produces a test tube with a mixture of
DNA molecules that are different lengths
 Wherever the ddNTP of that type (A, C, T or
G) is inserted
 They can be separated by gel electrophoresis.

© 2016 Paul Billiet ODWS
ELECTROPHORESIS
The migration of electrically charged particles in
colloidal solution towards the oppositely charged
electrode
© 2016 Paul Billiet ODWS
Similar to electrolysis
Solution of NaCl
CATHODE -
+ ANODE
Na+
Cl-
CATION ANION
© 2016 Paul Billiet ODWS
Gel electrophoresis of proteins
and DNA
The process of electrophoresis of large
molecules such as proteins and nucleic acids is
carried out on gels
 No water currents in gels
 Correct buffering conditions can be carefully
controlled
 Permits high resolution separation of very small
samples.

© 2016 Paul Billiet ODWS
DNA
DNA is analysed on agarose gels which have big
spaces to allow larger molecules of DNA to
separate
 Each nucleotide on the DNA molecule
carries a negative charge
 DNA molecules only move from the
negative cathode to the positive anode.

© 2016 Paul Billiet ODWS
DNA
As the negative charge increases with size, big
DNA molecules would move more quickly
 But bigger molecules move more slowly through
the gel
 Gives a steady and fine separation of DNA
molecules by size
 Molecules which differ by only one nucleotide in
their length can be separated.

© 2016 Paul Billiet ODWS
Analysis
The analysis of the gel by staining,
spectroscopy or autoradiography
 This reveals bands in the gel where the DNA
fragments are located
 Reference molecules are run in the gel at the
same time so that the molecules in the
mixture can be identified.

© 2016 Paul Billiet ODWS
Gel electrophoresis
Agarose Gel
CATHODE
Wells for the
mixture
Marker molecule
indicates the
front
+
ANODE
Buffer solution
DNA fregments separating by size
© 2016 Paul Billiet ODWS
DNA sequence





Run a gel with four columns
One from each tube treated
with a different type of
ddNTP (A, C, T or G)
The lengths of the fragments
can be compared for each of
ddNTPs
Read from bottom to top
(why?)
What is your sequence?
© 2016 Paul Billiet ODWS
Answers
Bottom is the shortest so the beginning of the sequence
TACGAGATATATGGCGTTAATACGATATATTGGAACTT
C
© 2016 Paul Billiet ODWS
Sequencing today





Uses fluorescent dyes not autoradiography
One colour for each ddNTP
Faster, cheaper, safer
Automated
Sequencing whole genomes becomes a reality.
© 2016 Paul Billiet ODWS
Up to 30 bases per second