Download A secondary structure motif predictive of protein localization to the

Cellular Microbiology (2000) 2(1), 35±47
A secondary structure motif predictive of protein
localization to the chlamydial inclusion membrane
J. P. Bannantine,² R. S. Grif®ths, W. Viratyosin,
W. J. Brown and D. D. Rockey*
Department of Microbiology, Oregon State University,
Corvallis, OR 97331-3804, USA.
Summary
Chlamydiae are obligate intracellular pathogens that
spend their entire growth phase sequestered in a
membrane-bound vacuole called an inclusion. A set of
chlamydial proteins, labelled Inc proteins, has been
identi®ed in the inclusion membrane (IM). The predicted IncA, IncB and IncC amino acid sequences
share very limited similarity, but a common hydrophobicity motif is present within each Inc protein. In
an effort to identify a relatively complete catalogue
of Chlamydia trachomatis proteins present in the IM of
infected cells, we have screened the genome for open
reading frames encoding this structural motif. Hydropathy plot analysis was used to screen each translated
open reading frame in the C. trachomatis genome
database. Forty-six candidate IM proteins (C-Incs) that
satis®ed the criteria of containing a bilobed hydrophobic domain of at least 50 amino acids were identi®ed. The genome of Chlamydia pneumoniae encodes
a larger collection of C-Inc proteins, and only approximately half of the C-Incs are encoded within both genomes. In order to con®rm the hydropathy plot screening
method as a valid predictor of C-Incs, antisera and/or
monoclonal antibodies were prepared against six of
the C. trachomatis C-Incs. Immuno¯uorescence microscopy of C. trachomatis-infected cells probed with
these antibodies showed that ®ve out of six C-Incs
are present in the chlamydial IM. Antisera were also
produced against C. pneumoniae p186, a protein sharing identity with Chlamydia psittaci IncA and carrying
a similar bilobed hydrophobic domain. These antisera
labelled the inclusion membrane in C. pneumoniaeinfected cells, con®rming that proteins sharing the
unique secondary structural characteristic also localize
to the inclusion membrane of C. pneumoniae. Sera from
patients with high-titre antibodies to C. trachomatis
Received 6 August, 1999; revised 2 November, 1999; accepted 8
November, 1999. ²Present address: NADC, 2300 Dayton Ave,
Ames, IA 50010, USA. *For correspondence. E-mail rockeyd@ucs.
orst.edu; Tel. (‡1) 541 737 1848; Fax (‡1) 541 737 0496.
Q 2000 Blackwell Science Ltd
were examined for reactivity with each tested C-Inc
protein. Three out of six tested C-Incs were recognized by a majority of these patient sera. Collectively,
these studies identify and characterize novel proteins
localized to the chlamydial IM and demonstrate the
existence of a potential secondary structural targeting motif for localization of chlamydial proteins to
this unique intracellular environment.
Introduction
Chlamydiae are obligate intracellular pathogens that cause a
variety of diseases in many different animal species. In the
human system, Chlamydia trachomatis causes trachoma,
the leading cause of preventable blindness worldwide
(Thylefors et al., 1995), and a collection of sexually transmitted conditions (Washington et al., 1987). Chlamydia
pneumoniae infection initiates in the respiratory tract but
has recently been implicated in a variety of chronic diseases,
including cardiovascular disease and arthritis (Saario and
Toivanen, 1993; Moling et al., 1996; Danesh et al., 1997;
Normann et al., 1998). Although the diseases caused by
chlamydiae are quite diverse, the four chlamydial species
share many common features. All chlamydiae are obligate
intracellular bacteria that develop within a membranebound vacuole called an inclusion. Infection of host cells
is mediated by the metabolically inactive elementary
body (EB). After infection, the EB differentiates into the
metabolically active but non-infectious reticulate body
(RB). Concurrent with RB growth and multiplication, the
inclusion enlarges to accommodate the increasing number
of developmental forms. Reticulate bodies are tightly
associated with the inclusion membrane (IM) throughout
their development, possibly using pores in the membrane
to access directly the cytoplasm for nutrients. Presently,
unidenti®ed signals are then sensed by the bacterium
and RBs begin to differentiate back to EBs. By 48±72 h
post infection (PI), the chlamydiae are released from
both the vacuole and the host cell, and EBs are then free
to infect another cell.
Many of the aspects of the chlamydial developmental
cycle have not been elucidated, including the nature of
the chlamydial inclusion. Intravacuolar pathogens such as
chlamydiae, Legionella, Mycobacterium and Toxoplasma
modify the vacuoles they inhabit to prevent maturation to
secondary lysosomes. Much has been learned about
36 J. P. Bannantine et al.
some of these pathogens by examining host cell markers
that co-localize with the vacuole or vacuolar membrane.
The legionellae, for example, develop within a vacuole
that displays properties of the endoplasmic reticulum
(Vogel and Isberg, 1999). Mycobacteria occupy a vacuole
that appears similar to recycling endosomes (Russell et al.,
1996). Although co-localization experiments have been a
useful technique for characterizing the parasitophorous
vacuole of these species, this approach has been less successful in the characterization of the chlamydial inclusion.
Despite a vigorous effort to identify host cell proteins that
localize to the chlamydial inclusion, no such protein has
been identi®ed in that environment (Heinzen et al.,
1996). In contrast, two lipid markers can be shown to localize
to the IM. The ¯uorescent lipid NBD-ceramide, a marker of
traf®cking within the Golgi apparatus, is found transiently
in the IM and is stably localized to the chlamydiae within
the inclusion (Hackstadt et al., 1995). Fluorescent cholesterol analogues also localize to the inclusion, and other
lipids found within the developing chlamydiae are probably
of host cell origin (Carabeo et al., 1999). Collectively,
these studies suggest that the inclusion probably acquires
lipids from several host cell sources, including exocytic
traf®cking pathways from the Golgi.
Although there are no known host cell proteins localized
to the IM, there are chlamydial proteins found in that environment. The chlamydiae produce and release a collection
of proteins, termed Inc proteins, which are localized to the
IM. Inc proteins were ®rst identi®ed in Chlamydia psittaci
and have recently been identi®ed in C. trachomatis (Rockey
et al., 1995; Bannantine et al., 1998a,b; Scidmore-Carlson
et al., 1999). The Inc proteins are the only known bacterial
proteins that reside in the membrane of a parasitophorous
vacuole, but their function is unknown. Many models can
be proposed addressing possible Inc protein function,
including participating in inclusion development, escape
from the lysosomal pathway and nutrient acquisition.
One Inc protein, C. psittaci IncA, is exposed at the surface
of the inclusion and is phosphorylated in cells in the
absence of a chlamydial background (Rockey et al., 1997),
traits consistent with possible involvement with host cell
vesicular traf®cking events surrounding the development
of the inclusion. A similarly localized set of proteins is produced by Toxoplasma gondii, a protozoan parasite that
occupies a similarly non-acidi®ed intravacuolar environment (Lecordier et al., 1993; Beckers et al., 1994).
To date, eight different Inc proteins have been shown to
reside in the IM. This includes IncA from C. psittaci and
C. trachomatis, IncB and C from C. psittaci and Inc D± G
of C. trachomatis. The genes encoding IncA from each
species share moderate identity, but within a species
IncA, IncB and IncC share minimal similarity. The only
obvious structural trait common among the four proteins
is a bilobed hydrophobic domain of approximately 60
amino acids. This secondary structure pattern is striking,
primarily in the light of low primary sequence identity
either surrounding or within the hydrophobic domain.
The completion of the C. trachomatis and C. pneumoniae
genome sequences has created opportunities for experimentation that have been previously unavailable in the
chlamydial system. In the absence of genetic techniques
for manipulation of the chlamydial genome, it has been dif®cult to conduct detailed analysis of protein function. The
availability of the genome sequence allowed a search for
proteins that localized to the IM, based upon the presence
of this characteristic hydrophobicity motif. We investigated
whether open reading frames (ORFs) in the genome
encode proteins containing this unique secondary structure and whether those proteins are be targeted to the
IM. We therefore performed a screen of all ORFs identi®ed
from the C. trachomatis genome project and identi®ed over
40 candidate inc genes (c-incs) that encode candidate Inc
proteins (C-Incs). In this report, we describe a preliminary
characterization of these proteins and show that ®ve out of
six tested c-incs encoded proteins localized to the
chlamydial IM. Additionally, we show that C. pneumoniae
also encodes C-Incs and that one of these is localized to
the C. pneumoniae IM.
Results
Hydropathy plot screen and bioinformatics analyses
The hydropathy plots of several known IM proteins, for
both C. trachomatis and C. psittaci, are shown in Fig. 1.
Note the large bi-lobed hydrophobic domain spanning at
least 50 amino acids in each. Hydropathy plot analysis
was performed on all ORFs present in the C. trachomatis
genome. Translated sequences that contain a bi-lobed
hydrophobic stretch of at least 50 amino acids were identi®ed as C-Incs. Based on this selection criterion, 45 out of
894 ORFs were selected (Table 1). All C-Incs were subjected to gap BLAST analysis to identify similarities with
known proteins in the database. No C-Inc shared obvious
sequence similarity with known gene products. ORFs
encoding the C-Inc proteins appear to be randomly distributed throughout the genome, although two regions contained
clusters of four and seven c-inc ORFs. A four c-inc cluster
(D115 to D118) is located immediately downstream of
IncA (Fig. 2A). These ORFs encode proteins that have
recently been shown by Scidmore-Carlson et al. (1999)
to be localized to the IM. A seven c-inc cluster (D223 to
D229) is adjacent to genes encoding amino acid- and
sodium-dependent transporters (Fig. 2A and B). Immediately downstream of these transporter genes are the
C. trachomatis genes with highest sequence similarity to
C. psittaci incB and incC, genes encoding proteins known
to localize to the C. psittaci IM.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
Fig. 1. Comparison of hydropathy pro®les for the predicted amino
acid sequences of known inclusion membrane proteins. Each of
these proteins has been localized to the chlamydial inclusion
membrane using ¯uorescence microscopy with speci®c antibody
either previously (Rockey et al., 1995; Bannantine et al., 1998a,
1998b) or in this report (C. pneumoniae IncA). Pro®les were
determined using the algorithm developed by Kyte and Doolittle
(1982) with a window size of seven amino acids. The vertical axis
displays relative hydrophilicity with negative scores indicating
relative hydrophobicity. The horizontal axis indicates amino acid
number. Note that although the size of each graph is similar, the
length of the proteins are distinct. Hydrophobic regions of similar
size and shape are circled in each plot.
The recently available C. pneumoniae genome was
also searched for c-incs. A similar number of predicted
coding sequences was also identi®ed in this species
(Table 1). A comparison of the c-incs from C. pneumoniae
and C. trachomatis demonstrated that 22 of these ORFs
have apparently homologous sequences within the other
genome, whereas the remaining c-incs shared no such
identity. This is consistent with BLAST data provided at the
Chlamydia Genome Project website. In C. trachomatis,
clusters of c-incs were tightly linked to both the incA and
the incB/incC homologues, but no such arrangement
was seen in C. pneumoniae. The gene order is also not
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
37
conserved in the region surrounding C. psittaci incA relative to either sequenced genome (Bannantine et al., 1998a;
Stephens et al., 1998). The predicted sequences of both
C. trachomatis and C. pneumoniae IncA are more similar
to C. psittaci IncA than to each other.
To examine the possibility that the characteristic hydrophobicity pro®le was generally present within bacterial
genomes, a similar search was undertaken on the 587
unknown ORFs contained within the Mycobacterium tuberculosis genome (Cole et al., 1998). Some of these predicted
proteins shared moderate similarity with the C-Inc hydrophobicity motif, but this was commonly found in proteins
with a largely hydrophobic overall structure (examples
include RV010c, Rv0093c, RV0996 and Rv1233c). None
of these sequences shares a clear structural relationship
with the C-Inc hydrophobicity motif.
Although C-Incs collectively share a very distinctive secondary structural characteristic, as a group the actual primary sequence identity is minimal. Phylogenetic analyses,
using programs available through the GCG software package (Wisconsin Package, SEQLAB, SEQWEB) were universally
unsuccessful at assessing the global genetic relationships
of the C-Incs. This was true for analyses of complete protein sequences, analyses of only the predicted hydrophobic motifs or analyses of the genes remaining after removal
of the bilobed hydrophobic region. In some cases, however, there are clear examples of relationships among individual C-Incs between and/or within a species (Table 1).
For example, C. trachomatis ORF D484 encodes a protein
with high similarity to C. pneumoniae p602. Clustal analysis of these proteins demonstrates 67% identity and 81%
similarity over the length of the proteins. A representative
example of C-Inc similarity between the two species, as
well as evidence of c-inc gene duplication, is provided by
C. trachomatis p058 and proteins encoded by C. pneumoniae
ORFs P107, P367, P369 and P370. Although the identity
is not as high as that shared by D484/P602, these proteins
are quite similar, especially at their carboxy termini
(Fig. 3B). One of these proteins (C. pneumoniae p107) is
shorter than the others and lacks the characteristic hydrophobicity motif (Fig. 3A). A ®nal example of c-Inc duplication is seen in C. pneumoniae ORFs P007±P0011, P1054
and P1055. Each of these orfs encodes highly similar gene
products, and one (p009) lacks the hydrophobicity motif.
This group of genes is not represented in C. trachomatis.
Collectively, these analyses demonstrate that selected
C-Inc proteins share identity between species, and that
this similarity can occur between both C-Inc and non-CInc sequences.
Selection of C-Incs for production of antisera
In order to determine whether the hydrophobicity motif
was a predictor of localization to the IM, antisera against
38 J. P. Bannantine et al.
Table 1. Candidate inc genes identi®ed by
hydrophilicity pro®le within each sequenced
chlamydial genome.
Candidate ORFs showing conservation
between the species
C. trachomatis
484
728
195
565
005
383
288
058
006
850
101
232
058
618
483
233
442
058
058
440
449
345
119 (IncA)
C. pneumoniae
602
869
288
822
443
480
065
369
442
1008
312
291
370
753
601
292
556
524
367
554
565
026
186
Candidate ORFs unique to each species
e-value
85
5.2 e
1.8 e 50
2.7 e 42
2.2 e 30
2 e 26
2.5 e 20
1.5 e 15
1.7 e 13
7.4 e 12
2.9 e 12
1.4 e 12
4.2 e 10
2 e 10
2 e 10
4.1 e 08
1.5 e 07
1.2 e 07
7 e 06
2 e 05
1.2 e 06
0.00045
0.0021
0.002
C. trachomatis
C. pneumoniae
036
115
116
117
118
134
135
164
192
196
214
223
224
225
226
227
228
229
300
357
358
789
813
007
008
010
011
041
043
045
067
124
126
130
131
132
146
147
164
166
169
174
215
216
225
240
266
267
277
284
285
352
354
355
357
365
366
371
372
375
431
432
439
440
585
829
830
1054
1055
241
Boldface identifies ORFs examined in this work.
six C-Incs were produced. Hydrophilicity pro®les for each
selected protein are shown in Fig. 2B and C. Open reading
frame D233 encodes the C. trachomatis gene with highest
similarity to C. psittaci IncC and was selected based on
this similarity. Open reading frame D442 was selected
because this protein has previously been identi®ed as a
cysteine- or sulphur-rich protein (crp/srp), but this designation and its role in chlamydial biology are unclear
(Clarke et al., 1988; Lambden et al., 1990; de la Maza
et al., 1991). The remaining four ORFs were chosen at
random, with an attempt to provide a cross-section of the
C-Inc proteins. ORFs D223 and D229 are c-incs that
¯ank the seven-gene cluster shown in Fig. 2A. Open reading frame D288 encodes a large protein that contains two
independent hydrophobic domains and has structural
characteristics of two tandem IncA-like proteins joined tail
to head. Open reading frame D484 also encodes a protein
structurally similar to IncA, but the predicted protein
Fig. 2. Characterization of two c-inc clusters
present in the C. trachomatis genome.
A. ORF maps of two 10 kb segments of the
C. trachomatis genome labelled contig 2.3
and contig 3.5. Open reading frames encoding
C-Incs include D115 to D118 from contig 2.3
and D223 to D229 from contig 3.5. Note the
close proximity of IncA, B and C to each of
the respective C-Inc clusters.
B. Hydropathy plots of C. trachomatis C-Incs
used for production of speci®c antibody. Note
that each protein contains a large bi-lobed
hydrophobic domain similar to that seen for
the proteins shown in Fig. 1.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
39
Fig. 3. Comparisons of predicted proteins
encoded by C. trachomatis D058 and
C. pneumoniae P107, P367, P369 and P370.
A. Hydrophilicity pro®les for three of these
predicted proteins. All but C. pneumoniae
p107 have predicted sequences that contain
the characteristic C-Inc hydrophobicity motif.
Note the scale differences for each plot.
B. Clustal similarity comparisons using
truncated sequences of each protein. Protein
identity and amino acid position are indicated
to the left of each line.
possesses a more hydrophobic pro®le over the entire protein sequence.
Polyclonal antibodies against each of these six proteins
were produced in rabbits, mice or guinea pigs. These sera
were each checked for reactivity with the appropriate protein expressed in Escherichia coli (not shown). The sera
were then used as a probe of C. trachomatis-infected
HeLa cells ®xed with either methanol or paraformaldehyde. Antisera against C. trachomatis IncA and monoclonal antibody (mAb) against the chlamydial HSP60 protein
were used as controls to demonstrate staining of the IM
or the intracellular developmental forms respectively
(Fig. 4A and B). Using this assay, ®ve out of the six tested
C-Inc proteins were shown to reside in the IM. These
include the C. trachomatis IncC homologue p233, the crp
protein (p442) and three previously unexamined proteins
encoded by ORFs D223, D229 and D288. Two of these
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
proteins, IncC and p288, could not be localized to the IM
after ®xation with methanol. Fixation with paraformaldehyde followed by permeablization with Triton X-100 was
used to show their localization to the IM. Under these conditions, both IncC (p233) and p288 were shown to localize
to discrete patches within the IM (Fig. 4E and F).
Antisera to p223 also labelled C. trachomatis L2 inclusions in a unique pattern (Fig. 4D). The distinction between
IncA and p223 localization is evident in cells doubly
labelled with anti-IncA and anti-p223 (Fig. 5). Antibody
directed at p223 revealed a distinct patchy staining pattern, relative to the uniform pattern observed for IncA.
The unique labelling pattern observed with anti-p223 antisera was examined in more detail, using mAb anti-p223
and anti-HSP60 in double-label ¯uorescence microscopy.
Each of two anti-p223 mAbs labelled the IM similarly to the
polyclonal anti-p223. Laser confocal microscopic analysis
40 J. P. Bannantine et al.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
41
Fig. 5. C. trachomatis-infected cell ®xed with methanol and doubly labelled with anti-IncA (A) and anti-p223 (B) antisera. This image highlights
the distinctions evident between the staining with anti-IncA and anti-p223.
of C. trachomatis-infected cells probed with these antibodies showed that the patches in the IM occupied by
p223 were largely devoid of contact with chlamydial developmental forms (Fig. 6). This was true of cells ®xed with
both paraformaldehyde and methanol. An analysis of
p223 localization throughout chlamydial development
was also undertaken. This protein began to accumulate
on the membrane of inclusions containing approximately
eight or more RB (< 8±10 h post infection; not shown).
Antigen localization observed at these early time points
was similar to that shown in Fig. 4.
Antisera to one C-Inc, p484, did not label the IM of either
early or late inclusions ®xed with either paraformaldehyde
or methanol. The labelling of this antigen showed distribution in the developmental forms within the inclusion
(Fig. 4H). Of all the C-Incs, p484 shows the highest similarity with a corresponding protein in the C. pneumoniae genome sequence. Because of this similarity, anti-p484 was
examined for reactivity with C. pneumoniae-infected cells.
Cross-reactivity was not strong, but the antisera weakly
localized at or around the inclusion membrane in this
species (not shown).
The sequencing of the C. pneumoniae genome also identi®ed a gene encoding a protein (p186) sharing < 21±23%
identity with both C. trachomatis and C. psittaci IncA.
Each previously identi®ed IncA has been shown to reside
within the inclusion membrane of infected cells; (Rockey
et al., 1995; Bannantine et al., 1998a). As can be seen in
Table 1, C. pneumoniae p186 was also identi®ed in the
initial hydrophobicity screening process, as it possesses
the characteristic hydrophobicity motif present in each
known Inc protein. Antisera were produced against
p186 and used in ¯uorescent microscopic analysis of
C. pneumoniae-infected cells ®xed with methanol 44 h
post infection. The antisera clearly label the inclusion membrane in these cells, in contrast to anti-HSP60, which labelled
the developmental forms within the inclusion (Fig. 7). Additionally, antigenic ®bres were observed extending away
from the inclusion in these cells (not shown), consistent
with results seen with both C. psittaci and C. trachomatis
IncA. These data demonstrated that proteins of chlamydial
origin are found in the C. pneumoniae inclusion membrane, and provide more evidence that the hydrophobicity
domain is characteristic of proteins in the chlamydial IM.
Recognition of C-Incs by human sera
To examine the immunogenicity of the selected C-Incs in
patients diagnosed and treated for a sexually transmitted
C. trachomatis infection, immunoblots were produced and
probed with sera collected from Chlamydia-infected
patients. Recognition of the C-Inc fusion proteins was different for each antigen. IncA, as has been shown previously
(Bannantine et al., 1998a), was recognized by several of
these patients. P223, p229 and p442 (crp) were also recognized by over a half of these patients. The remaining
Fig. 4. Immuno¯uorescence microscopy of C. trachomatis-infected cells probed with antisera against each tested C-Inc. Panels A and B
represent a cell doubly labelled with anti-IncA (A) and HSP 60 (B) and demonstrate the characteristic labelling evident for known Inc proteins.
Each subsequent panel represents cells singly labelled with each anti-C-Inc antisera. C, p229; D, p223; E, p228; F, p233; G, p442; H, p484.
Arrows indicate the inclusion membrane in E, F and G. Bar in H represents 10 microns for each image.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
42 J. P. Bannantine et al.
Fig. 6 Laser confocal microscopic images
of methanol-®xed cells infected with
C. trachomatis. Cells were doubly labelled
with anti-p223 (red) and anti-HSP60
(green). Notice the localization of p223 to
areas of the inclusion apparently devoid of
contact with chlamydial developmental
forms.
antigens were not consistently recognized by antibodies
within these sera and/or control sera were positive with
the antigen. High-titre antisera from two patients who
had recovered from C. pneumoniae infection were also
negative against the C-Inc proteins (Fig. 8). Therefore,
similarly to the situation observed with guinea pigs experimentally infected with C. psittaci (Bannantine et al.,
1998a), some Inc proteins are antigenic in the context of
infection whereas others are not.
Discussion
Many aspects of the molecular and cellular biology surrounding the interaction of chlamydiae with their host cell
are currently unclear. A major area of interest surrounds
the interaction between the chlamydial inclusion and the
host intracellular environment. The inclusion interacts with
the Golgi apparatus as the transfer of ¯uorescent lipid
analogues is traf®cked from the Golgi to the inclusion.
This transfer is energy dependent and requires chlamydial
protein synthesis (Hackstadt et al., 1995, 1996), but the
molecules that participate in these interactions are unknown.
It is likely that proteins at the surface of the inclusion
mediate some form of vesicular transport to the inclusion.
The Inc proteins of C. psittaci and C. trachomatis are
candidates for these processes.
A valuable resource for chlamydiologists has been
the recent completion of the genome sequences for
C. trachomatis and C. pneumoniae. The genome project
is critical to our understanding of chlamydial biology and
has opened avenues of research that were previously
unavailable. The present study is an example of the utility
of the databases. Without their availability the identi®cation of the large number of c-incs from each species
would not have been possible. Within each species, the
C-Incs occupy a signi®cant fraction of the genome ±
Fig. 7. Double-label ¯uorescence microscopy of C. pneumoniae-infected HeLa cells ®xed with methanol 44 h PI. Cells were labelled with
anti-HSP60 (A) and anti-C. pneumoniae IncA (B). Note that IncA is distributed to the margins of the chlamydial inclusion, similarly to as seen
with C. psittaci strain GPIC (Rockey et al., 1995) and C. trachomatis (Fig. 4, A). Bar indicates 10 microns.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
Fig. 8. Immunoblot analysis of puri®ed C-Inc-MBP fusion proteins
probed with a collection of sera from 13 Chlamydia-infected
patients, two C. pneumoniae-infected patients, and two negative
control patients. The results for IncA have previously been reported
(Bannantine et al., 1998a).
2.7% for C. trachomatis and 5.5% for C. pneumoniae.
These genes represent a much higher percentage of the
chlamydial unidenti®ed predicted protein sequences. Analysis of the global sequence databases also indicates that
the C-Incs are unique ± they appear to be chlamydia
speci®c in their distribution.
The most obvious trait shared by the known Inc proteins
is a bilobed hydrophobic domain of < 60 amino acids. This
motif is perplexing because of its apparent lack of a primary amino acid sequence signature. This lack of similarity
was emphasized in the present study. Statistical phylogenetic analyses failed to identify signi®cant relationships
among the different C-Inc protein sequences, including
both those proteins shown to reside in the IM and those
that have not yet been tested. Even in the case of Incs
that are otherwise quite similar, the identity within the
hydrophobic domains is often not strong. This lack of similarity at the primary sequence level suggests that secondary structure constraints may be the driving force behind
retention of this region; the primary sequence may serve
only as a means to frame the hydrophobic domains.
The large group of c-incs are not the only unique gene
family identi®ed in the chlamydiae. A collection of clustered
genes encoding several large putative membrane proteins
(Pmps) has also been identi®ed, by both screening conventional expression libraries and using a genomics analysis
(Grimwood et al., 1998; Longbottom et al., 1998; Stephens
et al., 1998). Chlamydia trachomatis has a total of nine
genes encoding Pmps scattered throughout the genome,
whereas the C. pneumoniae genome encodes 20 Pmps.
Although there are apparent examples of highly related
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
43
Pmp sequences within each chlamydial species, as a family
they share relatively limited primary sequence identity.
These proteins are instead grouped on the basis of size,
gene clustering and by the presence of several copies
each of distinctive four amino acid repeat sequences.
The data surrounding c-inc and pmp sequences indicate
that large gene `families' exist in the chlamydiae, even
under the constraints of a small genome. In the case of
both gene groups, the similarity is not based on high primary
sequence identity, but instead on more cryptic patterns
associated with short amino acid repeats or secondary
structure characteristics.
This study identi®ed over 40 C-Inc proteins from each
chlamydial species. When six C. trachomatis C-Inc
sequences were chosen for analysis, ®ve were shown to
reside in the IM. The tested C-Incs lack signi®cant primary
identity, but each contains the unique bilobed hydrophobic
domain. Based on these results, we propose that this
hydrophilicity motif can be used as a predictor of localization to the IM. However, the distribution of each C-Inc
within the inclusion was not uniform. p223 was shown to
be present in discrete patches at the surface of the inclusion, whereas IncA in the same cells was shown to be uniformly distributed around the inclusion surface. Two other
tested C-Incs, p233 and p288, also localized uniquely to
patches in the IM. Although efforts were made to minimize
the possibility, differences in localization in the IM may be
artifactual and introduced by the ®xation process. One
result that is apparently not an artifact is the lack of p484
localization to the IM. This protein was localized to developmental forms in C. trachomatis inclusions, regardless
of the ®xation used. This fact demonstrates that the hydrophilicity motif is not necessarily an absolute predictor of IM
localization and that other unidenti®ed structural constraints
may come into play as well. D484 encodes a protein with a
generally more hydrophobic nature and it is possible this
may affect its localization.
Comparative analysis of the two sequenced genomes
allowed the identi®cation of C-Incs sharing identity between
the two species. Some C-Incs were highly similar, such as
C. trachomatis p484 and C. pneumoniae p602. Within
C. trachomatis, p484 could not be localized to the inclusion
membrane and the situation with p565 is not clear. These
analyses have also demonstrated that the family of c-inc
sequences has been expanded in C. pneumoniae, similarly
to what has been seen for the pmp genes. The data in
Table 1 show that there are at least 60 c-incs in C. pneumoniae, over 20 more than are found in C. trachomatis. In
some cases, this expansion was apparently facilitated by
multiple gene duplications (p367±370; p007±p0011). Analysis of the C. pneumoniae genome sequence also facilitated
the identi®cation of C. pneumoniae IncA (p186), and we
used this sequence to produce anti-C. pneumoniae IncAantisera. These antisera uniformly labelled the inclusion
44 J. P. Bannantine et al.
membrane in ®xed, C. pneumoniae-infected cells, and
demonstrated conclusively that this species also encodes
proteins localized to the inclusion membrane in a similar
fashion to that seen in the other chlamydial species. Protein p186 also contains the characteristic bi-lobed hydrophobic domain, supporting the conclusion that this trait
may be a predictor of localization to the IM.
Chlamydia psittaci IncA and IncC were initially detected
by sera from C. psittaci-infected guinea pigs (Rockey et al.,
1995; Bannantine et al., 1998a). Chlamydia trachomatis
IncA is also recognized by a majority of sera from
C. trachomatis-infected humans as well as experimentally
infected primates (Bannantine et al., 1998b). Antibodies to
linear Inc protein epitopes are not, however, universal.
C. psittaci IncB was identi®ed as an IM-localized protein
because it is encoded immediately adjacent to IncC and
because it possesses a similar hydrophobic domain
(Bannantine et al., 1998a). The fact that three out of four
known Inc proteins were immunogenic in the context of
infection led us to determine whether the C-Incs tested in
this work were immunogenic in humans after natural
C. trachomatis infection. The results paralleled those
observed in the guinea pigs. Linear epitopes of three out
of ®ve identi®ed Inc proteins (p223, p229 and p442/crp)
were recognized by a majority of these antisera whereas
the other Incs (p233/IncC and p288) were not. Therefore,
different Incs are recognized differently by both animals
and humans after experimental or natural infection.
Although several Inc proteins are localized to the IM, virtually nothing is known of their function. C. psittaci IncA is
a serine/threonine phosphoprotein that contacts the cytosol of the host cell (Rockey et al., 1997), and nothing is
known of other Incs except that they localize to the IM. The
mechanisms used by chlamydiae to target the Inc proteins
to the IM are also uninvestigated. None of the demonstrated
Incs has classical amino-terminal secretory signals and
therefore it is likely that they are secreted by other means.
Selected genes of type III secretory processes have homologues in the chlamydial genome (Hsia et al., 1997) and
therefore it is possible that Inc proteins may be effector proteins transported out of the chlamydial RB via these means.
There is evidence that at least one Inc protein (C. trachomatis IncA) may have a function in chlamydial development.
A collection of naturally occurring C. trachomatis isolates
encoding mutant Inc A proteins (Suchland et al., 1999).
IncA was not detected in these mutants, either by immunoblot or by ¯uorescence microscopy. Each mutant was
identi®ed by the identi®cation of a defect in the fusion of
C. trachomatis inclusions with one another. The genes
encoding two mutant Inc proteins have been sequenced,
and each encodes proteins with lesions within the ®rst
lobe of the hydrophobic domain. This suggests the domain
is important to IncA function but leaves open several possibilities for its role in chlamydial biology.
The large number of C-Inc proteins allows for the possibility that the chlamydiae have an extraordinary repertoire
of unique proteins in contact with the cytosol of the
infected cell, but their function remains elusive. Inclusion
membrane proteins are probably important in some aspect
of communication with the host cell cytoplasmic environment. This may include aspects of intracellular vesicular
traf®cking, establishment or maintenance of the inclusion
and/or nutrient acquisition. The size and shape of the
bilobed domain present in all C-Incs, combined with the
work of Suchland et al. (1999) described above, leads to
speculation regarding the function of the domain. It is possible that the hydrophobicity motif is associated with Inc protein localization; one lobe of the motif may be embedded in
the chlamydial cell wall whereas the other may be in the
IM. These proteins may then serve to anchor the pathogen to the IM, facilitating direct contact between the reticulate body and the IM as well as providing molecular contact
between the RB and the cytosol. Further experimentation
will be directed at biochemical and, possibly, genetic
experiments designed to elucidate Inc protein transport/
localization within the chlamydial inclusion. We also anticipate that these studies will address possible functions of
this large variety of proteins localized to the chlamydial
inclusion membrane.
Experimental procedures
Chlamydiae and culture conditions
Chlamydia trachomatis strain LGV 434 (serotype L2) and C.
pneumoniae strain TW-183 were cultured in HeLa cells
grown in minimal essential medium (MEM) plus 10% fetal
calf serum and 1 mg ml 1 gentamicin (MEM-10), unless otherwise indicated. Puri®ed chlamydiae were prepared as has
been described by Caldwell et al. (1981). All chlamydiae
were stored at 808C in SPG buffer (0.25 M sucrose, 10 mM
sodium phosphate, 5 mM L-glutamic acid pH 7.2) prior to
use. Infected cells to be used for microscopy were produced
by inoculating chlamydiae at a multiplicity of infection (MOI) of
0.1 onto semicon¯uent cells cultured on sterile glass coverslips. Chlamydiae diluted in Hanks' balanced salt solution
(HBSS) were added to cells and incubated for 1 h at room temperature with gentle rocking. Inoculae were removed and cells
cultured in MEM-10 for between 30 and 40 h. Monolayers were
then ®xed with absolute methanol for 10 min or 4% paraformaldehyde/PBS for 1 h and subsequently stored at 48C in phosphate-buffered saline (PBS) prior to use. Cells ®xed with
paraformaldehyde were permeablized with 0.1% Triton X100 (Pierce Chemical Co.) in PBS for 2 min and washed
twice with PBS prior to blocking and incubating with antibody.
Sequence analysis/bioinformatics analysis
Sequence analysis was performed on ORFs identi®ed from
the C. trachomatis and C. pneumoniae genome databases
(Stephens et al., 1998; available at http://chlamydia-www.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
berkeley.edu:4231/). All ORF designations are consistent
with those de®ned in these databases. Proteins encoded
by each c-inc are indicated with a lower case `p' designation (i.e. ORF D223 encodes p233). Hydropathy plot
and Clustal analyses were conducted using MACVECTORTM
6.0 (Oxford Molecular). Hydropathy was calculated using
KYTE-DOOLITLE algorithms and a window of seven (Kyte and
Doolittle, 1982). Repetitive examination of individual ORFs
was facilitated using QUICKEYS software (CESoftware). Homology searches of Inc proteins were performed using the gap
BLAST algorithm (available at http://www.ncbi.nlm.nih. gov/
BLAST; Altschul et al., 1997). The BLAST 2 sequences program
was used to evaluate the similarity between C. trachomatis
and C. pneumoniae IncA (Tatusova and Madden, 1999).
Antigens, antisera and mAbs
Candidate inc genes were ampli®ed using primers indicated in
Table 2. In some cases (indicated in Table 2), the 58 end of the
gene was deleted because full-length constructs were apparently toxic to E. coli. The ampli®cation products were cloned
into pMAL-c2 (New England Biolabs) and overexpressed in E.
coli. In each case, the puri®ed fusion product, including the maltose-binding protein fusion partner, was used as the antigen for
immunization. Controls included antisera raised against puri®ed
maltose-binding protein. The immunization of rabbits, guinea
pigs or mice was performed as has been previously described
(Rockey et al., 1995; Bannantine et al., 1998a).
Monoclonal antibodies against one C-Inc protein, p223, were
produced with the assistance of the Monoclonal Antibody Facility of the University of Oregon. Mice immunized with p223 were
sacri®ced and splenic lymphocytes collected. These cells were
fused to SP/2 myeloma cells, using a modi®cation of standard
hybridoma production techniques (Marusich, 1988). Because
of solubility problems associated with the MBP/p223 fusion
protein, each well was screened by immunoblot, using MBP/
p223 as the antigen. Positive cell lines were cloned and
mAbs harvested from hybridoma culture supernatants. Two
clones, 12 E7 (IgG1,k) and 20 F12 (IgG2a,k), were used in
these studies. Hybridoma supernatant from clone A57 B9
(IgG1,k), a clone producing a mAb directed at the chlamydial
HSP 60 protein, was produced and collected using methods
described by Yuan et al. (1992). Appropriate secondary antibodies were purchased from Pierce or acquired from the Southern Biotechnology Associates. Methods used for production
of antisera were examined and approved by the Oregon
State University Animal Care and Use Committee.
45
Human sera that demonstrated high titres to C. trachomatis
or C. pneumoniae using a microimmuno¯uorescence assay
were selected from stored frozen specimens at the University
of Washington. Serum samples with high titres against
C. pneumoniae did not have detectable antibody directed at
C. trachomatis-speci®c antigens. Using microimmuno¯uorescence, negative control antisera were chosen based on nonreactivity with chlamydiae.
Immuno¯uorescence microscopy and immunoblotting
Chlamydia-infected cells, cultured and ®xed as described
above, were immunostained for localization of speci®c
antigens within infected cells. For these assays, all polyclonal
antisera were diluted 1:100 in PBS containing 2% (w/v) BSA
(PBS-BSA), followed by ¯uorescein- or rhodamine-conjugated
secondary antibodies diluted in PBS-BSA. Staining was
visualized using either a Leitz laser scanning confocal microscope or a Zeiss epi¯uorescence microscope. Hybridoma
supernatants were diluted 1:10 in BSA-PBS prior to incubation
on cells. Digital images collected on the confocal microscope
were processed through Adobe PHOTOSHOP and CANVAS graphics
software (Deneba). Images were collected on the standard
microscope using TMAX ®lm (Kodak).
Electrophoresis and immunoblotting were conducted using
described procedures (Rockey et al., 1995), with the following
modi®cations. Comparisons of the reactivity of human sera
with a single antigen were conducted using a slot-blotting
apparatus (Bio-Rad). Lysates of puri®ed fusion proteins
were electrophoresed through preparative 12% polyacrylamide gels and transferred to nitrocellulose. These ®lters
were placed into a blocking solution (PBS-BSA plus 0.1%
Tween-20; TPBS-BSA) for 1 h. After blocking, the ®lters were
placed into the slot-blot device. Puri®ed MBP was used as a
control in these immunoblots. Each human serum sample
was diluted 1:10 in TPBS-BSA and added to independent
slots. After 2 h of incubation with gentle rocking, blots were
washed three times with TPBS and incubated in 35S protein
A (100±150 nCi ml 1; Amersham) for 1 h. Blots were washed
three times in TPBS, dried and placed on autoradiography
®lm at room temperature for 16 h. Films were scanned into
Adobe PHOTOSHOP for image processing.
Acknowledgements
We thank Walter Stamm, Bob Suchland and Linda Cles of the
Table 2. Olignucleotides used for preparation of c-inc/malE hybrid genes for production of fusion proteins.
Target ORF
58-Oligonucleotide
38-Oligonucleotide
Gene region
C. trachomatis
D119
D223
D442
D229
D233
D288
D484
AGCCATAGGATCTGGTTTCAGCGA
ATGGTGAGTTTAGCATTAGGGA
ATGAGCACTGTACCCGTTGTT
ATGAGCTGTTCTAATATTAAT
ATGACGTACTCTATATCCGAT
CGAAAACAAAAACAACTAGAAGAG
ATAGTGCCTCCCTACGACTCTATC
GCGCGGATCCTAGGAGCTTTTTGTAGAGGGTGA
GCGCGGGATCCTACACCCGAGAGCCGTAATTGAA
GCGCGGATCCTCATTGGGTCTGATCCACCAG
GCGCGGATCCTTATTTTTTACGACGGGATGCCTG
GCGCAAGCTTAGCTTACATATAAAGTTTG
GCACAAGCTTAATGCACTCTCCACAAATCTTCTAA
GCGCGCAAACTTCTATTTAGCTACTACTACCCCGTAGAA
Full length
Full length
Full length
Full length
Full length
316±1452
433±1014
GCGCGGATCCTTACTGACCTCCTG
Full length
C. pneumoniae
P186
GCGCGGAATTCATAAGTGGAGGAGAAG
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
46 J. P. Bannantine et al.
University of Washington for productive discussions and technical
assistance during the course of this project. Discussions with
Steve Giovannoni of Oregon State University were valuable in
the genomics analyses. This work was supported by PHS grant
AI42869-01 to D.D.R. and the O.S.U. Department of Microbiology
Tartar scholarship Fund. Oregon Agricultural Experiment Station
Technical Paper # 11544.
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,
Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs.
Nucleic Acids Res 25: 3389±3402.
Bannantine, J.P., and Rockey, D.D. (1999) Use of a primate
model system to identify Chlamydia trachomatis protein antigens recognized uniquely in the context of infection. Microbiology 145: 2077±2085.
Bannantine, J.P., Stamm, W.E., Suchland, R.J., and Rockey,
D.D. (1998b) Chlamydia trachomatis IncA is localized to the
inclusion membrane and is recognized by antisera from
infected humans and primates. Infect Immun 66: 6017±6021.
Beckers, C.J., Dubremetz, J.F., Mercereau-Puijalon, O.,
and Joiner, K.A. (1994) The Toxoplasma gondii rhoptry
protein ROP 2 is inserted into the parasitophorous vacuole
membrane, surrounding the intracellular parasite, and is
exposed to the host cell cytoplasm. J Cell Biol 127: 947±961.
Caldwell, H.D., Kromhout, J., and Schachter, J. (1981) Puri®cation and partial characterization of the major outer membrane
protein of Chlamydia trachomatis. Infect Imuun 31: 1161±1176.
Carabeo, R.A., Mead, D.J., and Hackstadt, T. (1999) Traf®cking
of cholestrol to the chlamydial inclusion in HeLa cells. Abstr.
from A Cell Biology Approach to Microbial Pathogenesis. April
25±28, Portland, OR.
Clarke, I.N., Ward, M.E., and Lambden, P.R. (1988) Molecular cloning and sequence analysis of a developmentally regulated
cysteine-rich outer membrane protein from Chlamydia trachomatis. Gene 71: 307±314.
Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D.. et al. (1998) Deciphering the biology of Mycobacterium
tuberculosis from the complete genome sequence. Nature 393:
537±544.
Danesh, J., Collins, R., and Peto, R. (1997) Chronic infections and
coronary heart disease: is there a link? Lancet 350: 430±436.
Grimwood, J., Mitchell, W., Stephens, R.S. (1998) Phylogenetic
analysis of a multigene family conserved between Chlamydia
trachomatis and Chlamydia pneumoniae. In: Chlamydial Infections: Proceedings of the Ninth International Symposium on
Human Chlamydial Infection. R.S. Stephens, G.I. Byrne, G.
Christiansen, I.N. Clarke, J.T. Grayston, R.G. Rank, G.L. Ridgway et al., (eds). San Francisco, CA: pp. 263±266.
Hackstadt, T., Scidmore, M.A., and Rockey, D.D. (1995) Lipid
metabolism in Chlamydia trachomatis-infected cells: directed
traf®cking of Golgi-derived sphingolipids to the chlamydial
inclusion. Proc Natl Acad Sci U A 92: 4877±4881.
Hackstadt, T., Rockey, D.D., Heinzen, R.A., and Scidmore, M.A.
(1996) Chlamydia trachomatis interrupts an exocytic pathway
to acquire endogenously synthesized sphingomyelin in transit
from the Golgi apparatus to the plasma membrane. EMBO J
15: 964±977.
Heinzen, R.A., Scidmore, M.A., Rockey, D.D., and Hackstadt, T.
(1996) Differential interaction with endocytic and exocytic pathways distinguish parasitophorous vacuoles of Coxiella burnetii
and Chlamydia trachomatis. Infect Immun 64: 796±809.
Hsia, R.C., Pannekoek, Y., Ingerowski, E., and Bavoil, P.M.
(1997) Type III secretion genes identify a putative virulence
locus of Chlamydia. Mol Microbiol 25: 351±359.
Kyte, J., and Doolittle, R.F. (1982) A simple method for
displaying the hydropathic character of a protein. J Mol Biol
157: 105±132.
Lambden, P.R., Everson, J.S., Ward, M.E., and Clarke, I.N.
(1990) Sulfur-rich proteins of Chlamydia trachomatis: developmentally regulated transcription of polycistronic mRNA from
tandem promoters. Gene 87: 105±112.
Lecordier, L., Mercier, C., Torpier, G., Tourvieille, B., Darcy, F.,
Liu, J.L., et al. (1993) Molecular structure of a Toxoplasma
gondii dense granule antigen (GRA 5) associated with the
parasitophorous vacuole membrane. Mol Biochem Parasitol
59: 143±153.
Longbottom, D., Russell, M., Dunbar, S.M., Jones, G.E., and
Herring, A.J. (1998) Molecular cloning and characterization
of the genes coding for the highly immunogenic cluster of
90-kilodalton envelope proteins from the Chlamydia psittaci
subtype that causes abortion in sheep. Infect Immun 66:
1317±1324.
Marusich, M.F. (1988) Ef®cient hybridoma production using
previously frozen splenocytes. J Immunol Methods 114:
155±159.
de la Maza, L.M., Fielder, T.J., Carlson, E.J., Markoff, B.A., and
Peterson, E.M. (1991) Sequence diversity of the 60-kilodalton
protein and of a putative 15-kilodalton protein between the trachoma and lymphogranuloma venereum biovars of Chlamydia
trachomatis. Infect Immun 59: 1196±1201.
Moling, O., Pegoretti, S., Rielli, M., Rimenti, G., Vedovelli, C.,
Pristera, R., and Mian, P. (1996) Chlamydia pneumoniae ±
reactive arthritis and persistent infection. Br J Rheumatol 35:
1189±1190.
Normann, E., Gnarpe, J., Gnarpe, H., and Wettergren, B. (1998)
Chlamydia pneumoniae in children with acute respiratory tract
infections. Acta Paediatr 87: 23±27.
Rockey, D.D., Heinzen, R.A., and Hackstadt, T. (1995) Cloning
and characterization of a Chlamydia psittaci gene coding for
a protein localized in the inclusion membrane of infected
cells. Mol Microbiol 15: 617±626.
Rockey, D.D., Grosenbach, D., Hruby, D.E., Peacock, M.G.,
Heinzen, R.A., and Hackstadt, T. (1997) Chlamydia psittaci
IncA is phosphorylated by the host cell and is exposed on
the cytoplasmic face of the developing inclusion. Mol Microbiol
24: 217±228.
Russell, D.G., Dant, J., and Sturgill-Koszycki, S. (1996) Mycobacterium avium- and Mycobacterium tuberculosis-containing
vacuoles are dynamic, fusion-competent vesicles that are
accessible to glycosphingolipids from the host cell plasmalemma. J Immunol 156: 4764±4773.
Saario, R., and Toivanen, A. (1993) Chlamydia pneumoniae as
a cause of reactive arthritis. Br J Rheumatol 32: 1112.
Scidmore-Carlson, M.A., Shaw, E.I., Dooley, C.A., Fischer, E.R.,
and Hackstadt, T. (1999) Identi®cation and characterization of
a Chlamydia trachomatis early operon encoding four novel
inclusion membrane proteins. Mol Microbiol 33: 753±765.
Stephens, R.S., Kalman, S., Lammel, C., Fan, J., Marathe, R.,
Aravind, L., et al. (1998) Genome sequence of an obligate
intracellular pathogen of humans: Chlamydia trachomatis.
Science
Suchland, R.J., Rockey, D.D., Bannantine, J.P., and
Stamm, W.E. (2000) Clinical isolates of Chlamydia trachomatis
that occupy nonfusogenic inclusions lack IncA, a protein localized to the inclusion membrane. Infect Immun 68: issue 1.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
Chlamydial hydrophobicity motif
Tatusova, T.A., and Madden, T.L. (1999) BLAST 2 Sequences, a
new tool for comparing protein and nucleotide sequences.
FEMS Microbiol Lett 174: 247±250.
Thylefors, B., Negrel, A.D., Pararajasegaram, R., and Dadzie,
K.Y. (1995) Global data on blindness. Bull World Health
Organ 73: 115±121.
Vogel, J.P., and Isberg, R.R. (1999) Cell biology of Legionella
pneumophila. Curr Opin Microbiol 2: 30±34.
Q 2000 Blackwell Science Ltd, Cellular Microbiology, 2, 35±47
47
Washington, A.E., Johnson, R.E., and Sanders, Jr, L.L. (1987)
Chlamydia trachomatis infections in the United States. What
are they costing us? JAMA 257: 2070±2072.
Yuan, Y., Lyng, K., Zhang, Y.X., Rockey, D.D., and Morrison, R.P.
(1992) Monoclonal antibodies de®ne genus-speci®c, species-speci®c, and cross-reactive epitopes of the chlamydial 60 kilodalton
heat shock protein (hsp60): speci®c immunodetection and
puri®cation of chlamydial hsp60. Infect Immun 60: 2288±2296.