Download Spinalin, a new glycine- and histidine

1545
Journal of Cell Science 111, 1545-1554 (1998)
Printed in Great Britain © The Company of Biologists Limited 1998
JCS4535
Spinalin, a new glycine- and histidine-rich protein in spines of Hydra
nematocysts
Alexander W. Koch1, Thomas W. Holstein2, Carola Mala3, Eva Kurz3, Jürgen Engel1 and Charles N. David3,*
1Department of Biophysical Chemistry, Biozentrum, University of Basel, Klingelbergstrasse 70, 4056 Basel, Switzerland
2Cell and Developmental Biology, J. W. Goethe-University, Theodor-Stern-Kai 7/75, 60590 Frankfurt am Main, Germany
3Zoological Institut, University of Munich, Luisenstrasse 14, 80333 Munich, Germany
*Author for correspondence (e-mail: [email protected])
Accepted 20 March; published on WWW 14 May 1998
SUMMARY
Here we present the cloning, expression and
immunocytochemical localization of a novel 24 kDa
protein, designated spinalin, which is present in the spines
and operculum of Hydra nematocysts. Spinalin cDNA
clones were identified by in situ hybridization to
differentiating nematocytes. Sequencing of a full-length
clone revealed the presence of an N-terminal signal peptide,
suggesting that the mature protein is sorted via the
endoplasmic reticulum to the post-Golgi vacuole in which
the nematocyst is formed. The N-terminal region of
spinalin (154 residues) is very rich in glycines (48 residues)
and histidines (33 residues). A central region of 35 residues
contains 19 glycines, occurring mainly as pairs. For both
regions a polyglycine-like structure is likely and this may
be stabilized by hydrogen bond-mediated chain association.
Similar sequences found in loricrins, cytokeratins and
avian keratins are postulated to participate in formation of
supramolecular structures. Spinalin is terminated by a
basic region (6 lysines out of 15 residues) and an acidic
region (9 glutamates and 9 aspartates out of 32 residues).
Western blot analysis with a polyclonal antibody generated
against a recombinant 19 kDa fragment of spinalin showed
that spinalin is localized in nematocysts. Following
dissociation of the nematocyst’s capsule wall with DTT,
spinalin was found in the insoluble fraction containing
spines and the operculum. Immunocytochemical analysis
of developing nematocysts revealed that spinalin first
appears in the matrix but then is transferred through the
capsule wall at the end of morphogenesis to form spines on
the external surface of the inverted tubule and the
operculum.
INTRODUCTION
which punches a hole in the prey’s integument. Nematocyst
discharge is driven by the very high osmotic pressure (15 MPa;
Weber, 1989) in the resting capsule, which results from the
high concentration of poly-γ-glutamic acid and the
corresponding cations in the matrix (Weber, 1990, 1991).
The high osmotic pressure in capsules and the extraordinary
speed of the evagination process suggest that the capsule wall
must have a high tensile strength. Although the structure of the
wall is not known in detail, recent work has demonstrated the
presence of unusual, small, collagen-like proteins in the wall
(Kurz et al., 1991; Engel, 1997) and high-resolution electron
microscopy has indicated that these are probably organized in
collagen-like fibrils (Holstein et al., 1994). Nothing is known
about the structure of the other parts of the nematocyst such as
the tubule, spines or operculum, and no other nematocystspecific genes have been isolated or characterized yet.
The aim of the present study was to investigate another
nematocyst-specific protein, which we have named spinalin.
Spinalin is not homologous to any protein in the databases but
does have regions with partial homology to loricrins (Mehrel
et al., 1990; Steinert et al., 1991) and avian keratins (Whitbread
et al., 1991). Both proteins are involved in forming cellular
Nematocytes (cnidocytes, ‘stinging cells’) are highly
specialized cells characteristic of the phylum Cnidaria. The
cells harbor a specialized organelle, the nematocyst, which
serves various functions such as defense, the capture of prey
and locomotion (Weill, 1934; Mariscal, 1974). Nematocysts
consist of a capsule with a stiff wall and an internal tubule
which is coiled, pleated and barbed with spines. More than 25
morphologically different nematocyst types have been
described and all of them are able to ‘discharge’ after
appropriate stimulation (Weill, 1934; Mariscal, 1974). During
the discharge the long barbed tubule is everted in one of the
fastest known processes in living systems (Tardent and
Holstein, 1982). High-speed cinematography has revealed that
the initial steps in the eversion of the tubule take less than 10
microseconds and that the spine-bearing part of the tubule is
accelerated by up to 40,000 g (Holstein and Tardent, 1984).
Spines serve different functions depending on the nematocyst
type but all seem to have a high mechanical strength. In
particular, stylets, the large spines of stenoteles, have to
withstand extreme mechanical stress, since they form the tip
Key words: Hydra, Nematocyst, Nematocyte, Spinalin.
1546 A. W. Koch and others
products that tolerate high mechanical stress, i.e. the cornified
epidermal cell envelope in the case of loricrins, and keratinized
epithelial derivatives (claws, nails) in the case of avian keratins.
A truncated form of spinalin, named spinalin19K, was
recombinantly expressed in Escherichia coli. Using a
polyclonal antibody generated against spinalin19K we were
able to localize the mature protein to the spines and operculum
of nematocyst capsules, both structures having high
mechanical strength.
MATERIALS AND METHODS
Hydra strains and culture conditions
Hydra magnipapillata strain sf-1 was used for all experiments. This
strain contains temperature-sensitive interstitial cells, which can be
removed by warming cultures to 28°C (Sugiyama and Fujisawa, l977).
Mass cultures were maintained in M solution at 18°C (Loomis and
Lenhoff, 1956) and fed daily with Artemia nauplii. Animals were
starved for 24 hours before experiments.
cDNA library and differential screening
A cDNA library was prepared in lambda gt10 using poly(A)+ RNA
isolated from cell fractions enriched for the interstitial cell lineage
(Kurz et al., 1991). These cells are smaller than epithelial cells and
can be enriched by low-speed sedimentation from suspensions of
dissociated Hydra cells (Greber et al., 1992). The cDNA library was
differentially screened using radioactively labeled cDNA probes
prepared from poly(A)+ RNA isolated from temperature-shocked sf1 (epithelial cell probe) or from an interstitial cell-enriched fraction
(interstitial cell probe) as previously described (Kurz et al., 1991).
Approximately 13% of clones were interstitial cell-specific; 1% of
these clones (6 of 590 isolated clones) represent the spinalin sequence
described here.
Molecular techniques
Commonly used recombinant techniques such as gel electrophoresis,
subcloning, growth of plasmids and bacteriophages, nucleic acid
isolation, and DNA and RNA blot analysis were carried out according
to standard protocols (Sambrook et al., 1989). DNA sequencing was
done with the dideoxy chain termination method (Sanger et al., 1977)
using sequence-specific primers.
Sequence data were analyzed with software from the Wisconsin
Package, Version 8.1 (Genetics Computer Group, Madison, WI
53711). The sequence data are available from EMBL/GenBank/DDBJ
under accession number AF043907.
Cell type separation
Intact Hydra were enzymatically dissociated into single cells and
various cell types were separated into size fractions using the
counterflow centrifugation elutriation with a Beckman J6 centrifuge
and the Beckman JE 5.0 elutriator (Greber et al., 1992). The following
size fractions were collected: 4000, 3000, 2500, 2200, 1800, 1300 and
1100 rpm at 15 ml flow rate (fractions 1-7) and 1100 rpm at 30 ml
flow rate (fraction 8). Cells were eluted with 150 ml in each fraction,
and poly(A)+ RNA was isolated using a poly(A)+ isolation kit
(Qiagen, 5911 KJ Venlo, Netherlands).
Construction of spinalin expression vectors
Spinalin cDNA cloned in a pUC19 vector (Stratagene, La Jolla, CA
92037) was used as a template for PCR amplification of spinalin
fragments. Different fragments were cloned into the expression
vectors pET-15b (Novagen, Madison, WI 53711) and pGEX
(Pharmacia, 751 82 Uppsala, Sweden), but only the spinalin19K
fragment was purified and further characterized (see Results). Plasmid
stability tests were carried out according to the manufacturer’s
suggestions (pET system manual, Novagen, Madison, WI 53711).
To prepare spinalin19K, a DNA sequence coding for residues 18207 was generated by the use of a 5′ primer introducing a NdeI site
(5′ end: CCC CAT ATG AGG CCA TGG GGA CCT GGA T ) and a
3′ primer introducing a stop codon and a BamHI site (3′ end: CCC
GGA TCC TTA ATA AAC ATG TAG ACC ACC AAC TC). The
amplified product was cloned into the NdeI/BamHI site of the pET15b expression vector, which contains an N-terminal histidine tag
followed by a thrombin recognition site (Novagen, Madison, WI
53711).
Recombinant expression and purification
The pET-15b vector encoding spinalin19K was transformed into E.
coli BL21(DE3) cells (Novagen, Madison, WI 53711) and expression
of spinalin19K was induced by IPTG. Cells were lysed by sonication
and the debris removed by centrifugation (13,000 g for 20 minutes).
To purify histidine-tagged spinalin19K crude extract was
chromatographed on a nickel sepharose column under denaturing
conditions according to the manufacturer’s instructions (Novagen,
Madison, WI 53711). Protein samples used for antibody generation
were dialyzed against TBS buffer (20 mM Tris, 150 mM NaCl, pH
7.4), containing 2 M urea. Ultrafiltration was performed with
Ultrafree-15 centrifugal filters (Millipore, Bedford, MA 01730-2271)
having a nominal molecular mass limit of 30 kDa. Spinalin19K was
recovered in the flowthrough, as judged by SDS-PAGE.
To remove the histidine tag, thrombin digestion was carried out in
cleavage buffer (20 mM Tris-HCl, pH 8.4, 150 mM NaCl, 2.5 mM
CaCl2, containing 2 M urea) at room temperature for 4 hours using 5
i.u. thrombin per mg protein. Cleavage was monitored by SDS-PAGE
as described by Laemmli (1970) using 12×13 cm slab gels. Protein
bands were visualized by Coomassie Blue staining and molecular
masses were estimated by comparing bands with molecular mass
standards (Pharmacia, range 94-14.4 kDa).
Antibodies and immunoblotting
A polyclonal antibody directed against spinalin19K was generated in
rabbits by Eurogentec Bel S.A. (4102 Ougrée, Belgium). Purified
spinalin19K, dissolved in 20 mM Tris-HCl, pH 7.4, containing 2 M
urea, was directly injected into rabbits. Immunization was carried out
following a standard protocol suggested by the manufacturer, using
100 µg of the antigen per injection.
For western blot analysis nematocyst proteins or total Hydra
proteins were dissolved in SDS-sample buffer, separated by Tricine
SDS-PAGE (Schägger and von Jagow, 1987), transferred to
nitrocellulose membranes and incubated with spinalin19K antibody
(1/1000 dilution) and a secondary goat anti-rabbit antibody coupled
to horseradish peroxidase (Bio-Rad, Hercules, CA 94547). The filters
were developed employing the ECL chemoluminescence system
(Amersham, Arlington Heights, IL 60005).
DTT treatment of isolated nematocysts
Nematocysts were isolated from whole Hydra tissue as described
previously (Kurz et al., 1991; Weber et al., 1987) and treated for 1
hour at room temperature in 100 mM Tris-HCl, pH 9.5, containing
DTT at various concentrations ranging from 65 µM to 1 mM.
Solubilized nematocyst proteins were separated from insoluble
material by centrifugation (5 minutes at 14,000 g) and analyzed by
Tricine SDS-PAGE (Schägger and von Jagow, 1987).
Immunofluorescence microscopy
Whole mount preparations
Animals were relaxed in 2% urethane in M solution for 1 minute and
fixed in Lavdovsky’s fixative for at least 24 hours (Technau and
Holstein, 1995). After washing extensively in PBS buffer (pH 7.2) the
polyps were incubated overnight in spinalin19K antibody (diluted
1:1000 in PBS/1% BSA/0.1% sodium azide). To visualize spinalin
Spinalin, a new Hydra nematocyst protein 1547
antibody, polyps were incubated for 2 hours with an FITC-conjugated
goat anti-rabbit antibody (Boehringer Mannheim Corp., D-68305
Mannheim, Germany) diluted 1:50 in PBS/1% BSA/0.1% sodium
azide.
Preparations of isolated capsules
Nematocysts were isolated as described (Kurz et al., 1991; Weber,
1989). Nematocyst suspensions were induced to discharge on gelatincoated slides by using 0.1 N NaOH (30 minutes), then treated for 1
hour with 65 µM DTT (in 100 mM Tris-HCl, pH 9.5) in order to partly
solubilize the spines, and were finally fixed in 4% formaldehyde. After
washing extensively in PBS (pH 7.2), slides were incubated overnight
in spinalin19K antibody (1:1000 in PBS/1% BSA/0.1% sodium azide),
washed and incubated with FITC-conjugated goat anti-rabbit antibody
(Boehringer; diluted 1:50 in PBS/1% BSA/0.1% sodium azide).
Microscopy and photography
All preparations were analyzed using a Zeiss Axiovert microscope
equipped with epifluorescence, and photography was performed with
Kodak Tungsten 320 (1200 ASA). Confocal laser scanning microscopy
was performed using a Leica TCS NT confocal microscope.
Electron microscopy
Transmission electron microscopy (TEM) analysis was performed as
previously described (Holstein, 1981). For fixation the specimens
were chilled to 4°C for 1 hour, then double-fixed with 3.5%
glutaraldehyde (2-3 hours) and with 1% osmium tetroxide (1-2 hours);
the fixatives were buffered with 0.05 M collidine buffer (pH 7.2).
Specimens were embedded in epon-araldite with propylene oxide as
an infiltration solvent; serial sections (Reichert Ultracut microtome)
were stained with uranyl acetate and lead acetate, and examined with
a Zeiss EM 9S electron microscope.
Scanning electron microscopy (SEM) was performed as previously
described (Tardent and Holstein, 1982). Whole Hydra or isolated
nematocysts were fixed in 2.5% glutaraldehyde solution containing 50
µM phosphate buffer, which was also used for the post-fixation in 12% OsO2. Samples were dehydrated through a graded series of
acetone followed by critical-point drying. Specimens were sputtered
with gold and analyzed with a Cambridge S-4 scanning electron
microscope (this analysis was done in the laboratory of Prof. Pierre
Tardent, Zoological Institute, University of Zürich).
RESULTS
Isolation of the nematocyte specific cDNA for
spinalin
We identified nematocyte specific cDNAs by in situ
hybridization of individually picked clones. The clones were
derived from a cDNA library prepared from cells enriched for
the interstitial cell lineage. Interstitial cell-specific clones were
identified by differentially screening the library with interstitial
cell and epithelial cell probes. From a set of 590 interstitial
cell-specific cDNA clones, we identified six clones that crosshybridized with each other and which hybridized in situ to
clusters of differentiating nematocytes in the ectoderm
throughout the body. In northern blots these clones hybridized
to a 1000 bp transcript that was expressed in differentiating
nematocytes but not in other cell types (Fig. 1). We have named
the protein encoded by these cDNA clones spinalin, based on
its localization in the spines of nematocysts (see below).
Sequence analysis and putative domain
organization of spinalin
Fig. 2A shows the nucleotide and deduced amino acid
Fig. 1. Northern blot analysis of spinalin expression in fractionated
cells. Hydra cells were fractionated by elutriation centrifugation and
1 µg of poly(A)+ RNA from each fraction was applied to the gel.
Spinalin transcripts are enriched in fraction 2, which contains small
differentiating nematocytes and interstitial cells. The other fractions
contain mainly nerve cells (1), large differentiating nematocytes
(3/4), gland cells (5), ectodermal epithelial cells (6), endodermal
epithelial cells (7) and battery cells (8).
sequence of spinalin. There is a single open reading frame of
254 amino acids beginning at nucleotide 126. The start codon
ATG is immediately followed by a G residue and preceded at
position −3 by an A, which is in agreement with the consensus
sequence for eukaryotic translation initiation sites (Kozak,
1987). No homology to other proteins in the database (SWISSPROT; Bairoch and Apweiler, 1997) was found by amino acid
sequence comparisons using the entire spinalin sequence.
Based on features of the primary sequence and similarities of
parts of the spinalin sequence to known protein motifs we
propose the domain organization shown in Fig. 2B.
The first 17 amino acids fulfil the criteria for a signal peptide
(Von Heijne, 1986), indicating that spinalin is synthesized on
the endoplasmic reticulum and processed through the Golgi.
The presence of the leader sequence is consistent with spinalin
being a component of nematocysts, which are the major Golgi
products of differentiating nematocytes (Slautterback and
Fawcett, 1959; Holstein, 1981). Following removal of the
signal peptide, the mature protein consists of 237 amino acids
Table 1. Homologies of parts of the spinalin sequence to
protein sequences of the SWISS-PROT database*
Spinalin
region†
I
I
I
II
II
Homology to
% identity
References
Mouse type II keratin
(aa 440-562)
Human cytokeratin 9
(aa 476-612)
Mouse loricrin
(aa 154-293)
Chick claw keratin
(aa 75-104)
Chick tropoelastin
(aa 32-62)
36
Steinert et al. (1985)
36
Langbein et al. (1993)
29
Mehrel et al. (1990)
70
Whitbread et al. (1991)
48
Bressan et al. (1987)
*The FASTA program (Pearson and Lipman, 1988) was used for computer
homology searches (Wisconsin Package, Version 8.1, Genetics Computer
Group) in the SWISS-PROT database (Bairoch and Apweiler, 1997).
†Annotation according to Fig. 2B.
1548 A. W. Koch and others
A
TTTTTTTTTTTTTGTTGCAGGTGCGAAACACCACAAATGCGTCTCATTTTGCAGAAAGGATA
63 AAACTGTATTCAACAAAAGCAGCATAAGAAATATACTCGCGCCACTATCGGAGGTATTAA
123 AATATGGTGATCGCACAGGCTGCTTTAGTTCTACTTTTGGTTGCTGTTGATGCAAGGCCA
1
M V I A Q A A L V L L L V A V D A R P
183 TGGGGACCTGGATGTGCGGATGGTAGTTATGGTTATGGCGGATGCGGTCACCATCAAGCT
20 W G P G C A D G S Y G Y G G C G H H Q A
243 AACGGTTATGGCGGTGCACACCATGCTGCTGGTTGCTGCAACGGCCTAGCCCATGGCGGA
40 N G Y G G A H H A A G C C N G L A H G G
303 CATCACGGAGGAGCATACGGACAAGCTGCTCATCATGCCGGAGGATATGGTGGTGCATAC
60 H H G G A Y G Q A A H H A G G Y G G A Y
363 GGAGGCCATCATGAGGACCATGGAGAAGATGTTAAAGTAGAGACTCATGGTGTTCACCAT
80 G G H H E D H G E D V K V E T H G V H H
423 ATCGCATCTCATGGTGGTATCCATCATGAACATGGTGGACTTAGAGGAGGACATCATGGA
100 I A S H G G I H H E H G G L R G G H H G
Fig. 3. Purification of
spinalin19K monitored by
SDS-PAGE. The
recombinant protein was
expressed in E. coli with
an N-terminal histidine tag
and purified on a nickel
affinity column (lane 1).
Samples used for antibody
generation were further
purified by ultrafiltration
(lane 2). The histidine tag
was removed by thrombin
digestion to prepare
spinalin19K (lane 3).
483 GCTTACGGAGGACATGGAGCTCATGAGGCAGGTAACTTTGGTCATGTTCATGGCGGACAC
120 A Y G G H G A H E A G N F G H V H G G H
543 TATGGATTAGGTGGAAATCATTATGGTGGCTCCGATTACGGACATGGACACCATGGTGGG
140 Y G L G G N H Y G G S D Y G H G H H G G
603 TATGTGCATGAGCCTTGTCACACTCCATGCCACACTGTTGGTGGATGTGGTGGATGTGGT
160 Y V H E P C H T P C H T V G G C G G C G
663 GGTTATGGACATCTTGGTGGTGTTGGTGGATATGGAACAGGTCTTGGTGGAGTTGGTGGA
180 G Y G H L G G V G G Y G T G L G G V G G
723 GTTGGTGGTCTACATGTTTATAAAAAAGAAACCGTGAAAGGAAAAAAAGTTCAACAAGTT
200 V G G L H V Y K K E T V K G K K V Q Q V
783 ACAAAAGCCGAGGAGGAGAATGAAGATGATGATGATGACGAATCTGAAGATGCTGAAGCT
220 T K A E E E N E D D D D D E S E D A E A
843 GAAAGTGGAAATAGTAGTGATGAAGACATGCCAAATGGAGGTGATTAAATTCAACCTGTA
240 E S G N S S D E D M P N G G D ***
903 AACTCATATATGTATATATAGAATTTTTATTTTGACAATGTAGCATTGTCCCTGTGAAAA
963 ATGGAATAAATTAATATAAAA
B
17
R18
I
II
154
35
V172
III
16
K207 E223
IV
32
D254
Fig. 2. Spinalin sequence and putative domain organization.
(A) Nucleotide and deduced amino acid sequence of Hydra spinalin
cDNA. The stop codon is indicated by asterisks. The glycine- and
histidine-rich region is single-underlined and the putative
polyglycine type II helix is double-underlined. Cysteines are
indicated in bold letters. (B) Putative domain organization of
spinalin. The first 17 amino acids constitute a signal peptide for
translation on the endoplasmic reticulum. The boxed areas represent
the proposed domain structure of the mature protein. Borders of the
domains are indicated by arrows and the number for the first amino
acid of a domain. The putative domains are: a glycine- and histidinerich region (I), a polyglycine type II helical region (II), a lysine-rich
region (III) and an acid ‘tail’ (IV). Cysteine residues are indicated by
solid vertical bars.
and has a calculated molecular mass of 23.7 kDa. It can be
divided into four distinct regions. The first part of the sequence
(region I, 154 residues) is glycine- and histidine-rich (31 and
21 mol%, respectively). For this region, sequence homologies
to mouse loricrin and the C-terminal regions of different
cytokeratins were found (Table 1).
Region I is followed by a sequence of 35 amino acids (region
II) in which, with only few exceptions, two of three amino
acids are glycines. This sequence could adopt a polyglycine
type II (PGII) conformation with three residues (a, b, c) per
turn, where large, hydrophobic residues are located in a
positions and glycine residues in b and c positions
(Ramachandran et al., 1966; Traub and Yonath, 1966; Lotz and
Keith, 1971). This region reveals sequence homology to the
glycine-rich regions of chick claw keratin and to chick elastin
(Table 1).
Region II is succeeded by a stretch of 16 amino acids (region
III) with a high content of lysine residues and with weak
homology to histone sequences (not shown). The last 32
residues (region IV) represent a region with a high content of
negatively charged residues designated as the acid tail.
Recombinant expression of spinalin fragments
Full-length spinalin could not be overexpressed in E. coli.
Although different expression vectors and different conditions
were tried, plasmid instability was observed in all cases (see
Materials and Methods), which is an indication that the
spinalin gene product is toxic for the host cells. Since our aim
was to prepare antibodies against spinalin, we also tried to
express fragments of the spinalin sequence. Fragments that
included the lysine-rich region (region III) could not be
expressed in E. coli. However, a large fragment comprising
regions I and II, designated spinalin19K, could be successfully
overexpressed with a histidine tag for affinity purification. The
protein was localized in inclusion bodies and could be purified
under denaturing conditions using nickel sepharose affinity
chromatography (Fig. 3, lane 1). The histidine-tagged
spinalin19K was soluble in TBS buffer containing 2 M urea.
It was further purified by ultrafiltration and directly used for
antibody production (Fig. 3, lane 2). The histidine tag was
cleaved by thrombin to prepare spinalin19K (Fig. 3, lane 3).
Solubility tests revealed that spinalin19K tends to aggregate at
urea concentrations below 2 M and pH higher than 5, but that
the protein is partly soluble in 1 M urea at pH 7.4.
Spinalin is present in mature nematocysts
In western blots of total Hydra protein the spinalin19K
antibody reacted specifically with a protein of apparent
molecular mass 24 kDa, which is the expected size of the
mature spinalin polypeptide (Fig. 4A, lane 1). Purified
Spinalin, a new Hydra nematocyst protein 1549
Fig. 4. Western blot and SDSPAGE analysis of spinalin.
(A) Western blot. Samples were
solubilized in SDS sample buffer,
separated by Tricine SDS-PAGE,
transferred to nitrocellulose
membranes and immunostained
with rabbit anti-spinalin19K
antibody. Lane 1, total Hydra
protein (not DTT-treated); lane 2,
purified nematocysts (DTTtreated); lane 3, supernatant of
DTT-treated nematocysts; lane 4,
pellet of DTT treated nematocysts.
(B) Coomassie Blue-stained gel.
Lanes 1- 4 correspond to the lanes
in (A). Samples were treated in the
same way but approximately five
times more protein was applied to
the gel for Coomassie Blue
staining than for western blotting.
nematocysts also contained spinalin (Fig. 4A, lane 2). To
determine which structures in nematocysts contain spinalin,
purified nematocysts were dissolved in 1 mM DTT under
conditions that solubilized the capsule wall but left the stylets
and operculum intact. SDS-PAGE confirmed that most
nematocyst proteins were in the soluble fraction (Fig. 4B, lane
3) while about 10% of the nematocyst proteins remained
insoluble and could be pelleted from the DTT suspension (Fig.
4B, lane 4). Western blotting revealed that the 24 kDa spinalin
polypeptide was exclusively present in the pellet fraction (Fig.
4A, lane 4). Microscopic examination demonstrated the
presence of stylets (particularly large spines formed in
stenotele nematocysts) and opercula as well as amorphous
debris in the DTT pellet (T. W. Holstein, unpublished data).
These results indicate that spinalin constitutes a DTT-insoluble
component of nematocysts and suggest that it is present in
stylets or operculum.
Localization of spinalin within developing
nematocysts
We used the spinalin19K antibody to localize spinalin in
nematocytes at different stages of nematocyst morphogenesis.
In whole mounts of Hydra, nests of differentiating nematocytes
were immunostained throughout the gastric region (Fig. 5A).
Higher magnification images showed that the antibody stained
all nematocyte types and that staining was confined to the
developing nematocysts. Nests of desmonemes and isorhizas
stained more strongly than nests of stenoteles (Fig. 5B-D).
Staining first appeared in immature nematocysts 2-4 µm in
length and increased in intensity as cysts increased in size.
Following synthesis of the capsule, the ‘preinverted’ tubule is
formed as a long thin protrusion from the apical end of the
capsule (Holstein, 1981). This preinverted tubule was also
strongly stained by the spinalin antibody (Fig. 5B,C). In both
the tubule and the capsule, spinalin staining appeared to be
confined to the matrix, whereas the capsule wall was not
stained.
Following completion of the tubule, it inverts and is
sequestered within the capsule (Holstein, 1981). Spinalin
staining at this stage was still confined to the matrix. The lumen
of the inverted tubule, which corresponds to space outside the
capsule, was clearly unstained as revealed by appropriately
oriented optical sections taken with a confocal microscope
shortly after inversion of the tubule (not shown).
During the next stages of capsule maturation spinalin staining
disappeared progressively from the matrix, became
concentrated along the inverted tubule, and then appeared to
pass through the tubule wall to fill the lumen of the tubule. This
process was not well visualized in the smaller nematocyst types
but could be clearly seen in developing stenoteles because of
their relatively large size. Fig. 5D shows a stenotele at this stage
of development. The stylets (large spines) have developed
within the lumen of the inverted tubule and can be seen to form
a prominent structure in the center of the capsule. Optical
sections of immunostained preparations, taken with a confocal
microscope, demonstrated that the stylets are strongly stained
by spinalin antibody and that staining has disappeared from the
matrix of the capsule at this stage (Fig. 6). This suggests that
spinalin is ‘transferred’ from the matrix of the capsule to the
lumen of the inverted tubule where stylets develop. Shortly
thereafter spinalin immunostaining disappeared completely.
Spinalin protein was, however, still present, as shown by
western blotting of mature nematocysts (Fig. 4A).
TEM images of sections through the center of stenoteles
reveal the structure of the stylets in more detail. Stylets appear
to be formed as a series of laminar structures projecting into
the lumen from the wall of the inverted tubule (Fig. 7A). These
lamina are 20-25 nm thick and exhibit a distinct substructure
with an outer electron-dense layer (4-5 nm thick) enclosing an
inner textured core (15-20 nm thick). Transverse sections
through the developing stylet apparatus indicate that the stylets
and spines are formed in three sectors spaced around the inner
circumference of the inverted tubule and that they consist of a
clearly demarcated series of lamina (Fig. 7C). Continued
development, however, leads to a dramatic condensation of the
lamina to form the mature stylet structure shown in cross
section in Fig. 7D and in the DIC image in Fig. 7B. This
extreme condensation is consistent with the observation that
mature stylets could be pelleted from suspensions of DTTdissociated capsules (see above).
1550 A. W. Koch and others
Fig. 5. Immunolocalization of spinalin
in Hydra. Whole mounts of Hydra
were stained with spinalin19K
polyclonal antibody. (A) Head and
upper gastric region: nests of
differentiating nematocytes are stained
in the gastric region. (B) Nest of
differentiating desmonemes: matrix
and preinverted tubule (arrow) are
stained. (C) Nest of differentiating
isorhizas: matrix and preinverted
tubule (arrow) are stained. (D) Nest of
stenoteles at a late stage of
morphogenesis after inversion of the
tubule; only the operculum and stylet
(arrow) are stained. Bars, 200 µm (A);
10 µm (B-D).
similar to those observed in developing spines (Fig 7A,C,D).
At later stages, these structures are no longer visible, probably
due to condensation similar to that observed during spine
formation. Fig. 6 shows a reconstruction of serial optical
sections through two stenoteles at the stage of operculum
formation. A ring of spinalin staining is present at the site of
operculum formation (Fig. 6B), suggesting that spinalin was
transferred from the capsule matrix through the wall of the
inverted tubule to the site of operculum formation at the apical
end of the capsule. This process would initially form a ring,
which would fill up to become a cap as a result of further
extrusion of spinalin. The cap is brightly stained at this stage
but loses immunoreactivity as the capsules mature.
Fig. 6. Confocal images of two stenotele nematocysts
immunostained with spinalin antibody. (A) Apical end of nematocyst
is oriented toward top. Stained structures correspond to operculum
(top) and stylet (center). The matrix surrounding the stylet is
unstained. (B) Nematocyst is tipped slightly, permitting a view into
incomplete operculum. Bar, 5 µm.
Operculum formation
The operculum of nematocysts is formed after inversion of the
tubule by a process which appears to be very similar to spine
formation (Holstein, 1981). In particular, TEM images indicate
the presence of laminar structures in the developing operculum
Localization of spinalin in stylets/spines of
discharged nematocysts
Stylets and spines are most clearly visualized in SEM images
of discharged nematocysts. Fig. 8 shows such images for
desmonemes, stenoteles and isorhizas. The spines of
desmonemes are long thin structures which become oriented
down the central axis of the tight coil formed by the tubule
following discharge of the nematocyst (Fig. 8A,B). Stenoteles
have three large stylets and a series of smaller spines or
lamellae located at the base of the everted tubule (Fig. 8C); the
tubule appears to be free of spines (not shown). By comparison,
in atrichous isorhizas the entire length of the tubule is covered
with the small barbs or spines (Fig. 8D).
Western blotting (Fig. 4A) indicated the presence of spinalin
in mature nematocysts despite the lack of spinalin
immunoreactivity. This suggests that spinalin epitopes are
Spinalin, a new Hydra nematocyst protein 1551
Fig. 7. TEM of stylets and spines in stenotele
nematocysts. (A) Differentiating stenotele
shown in longitudinal section. Note the
laminar structures consisting of distinct
layers 20-25 nm thick. The approximate
positions of the cross-sections shown in C
and D are indicated. (B) DIC micrograph of
mature stenotele nematocyst: the stylets are
visible in the center of the capsule. (C) Cross
section showing spines in a developing
stenotele at the same stage as in A. (D) Cross
section of a mature stenotele (equivalent to
B) showing spines (spi) in the center and
highly compacted stylets (sti) on the outside.
Bars, 1 µm (A); 5 µm (B); 500 nm (C,D).
masked during formation of spines. To test this idea we
searched for a method to restore immunoreactivity to mature
capsules and thus directly demonstrate the presence of spinalin
in spines. We used discharged nematocysts for these
experiments because they permit good visualization of spines.
To reduce the extent of condensation of spinalin-containing
structures we treated capsules with 0.1 M NaOH and 65 µM
DTT (see Materials and Methods). Both treatments were
insufficient to dissolve capsules but they did restore spinalin
immunoreactivity. The stylets and spines of stenoteles were
clearly stained; the capsule and tubule were not stained (Fig.
9A,A′). The tightly coiled tubule of discharged desmonemes
was strongly stained by spinalin antibody; the capsule wall was
unstained (Fig. 9B,B′). In isorhizas the entire length of the
everted tubule was stained whereas the capsule wall was
unstained (Fig. 9B,B′). Although the barbs were difficult to
resolve by light microscopy, the pattern of immunoreactivity
along the tubule of the discharged isorhiza suggests that only
the barbs were stained.
DISCUSSION
Structure of nematocysts
The cnidarian nematocyst is one of the most complex secretory
products produced by an animal cell (Holstein, 1981;
Hessinger and Lenhoff, 1988). Despite a wide diversity of
morphological types, the basic structure of all nematocysts is
the same: an inner and outer capsule wall, an inverted tubule
armed with spines, and an operculum or opercular flaps. When
1552 A. W. Koch and others
Fig. 8. SEM images of spines in discharged nematocysts.
(A,B) Discharged desmonemes. Spines are long thin structures
protruding from the center of the coiled tubule. The two desmonemes
shown in (A) are wrapped around a bristle. (C) Discharged stenotele
showing the apical end of the capsule and the base of the everted
tubule. Three stylets project from the base of the tubule; distal to the
stylets are lamellae or small spines. (D) Discharged holotrichous
isorhiza. Small barbs or spines decorate the surface of the everted
tubule; the capsule is located toward the bottom of the micrograph.
Bars, 2 µm (A); 1.5 µm (B); 2 µm (C); 0.5 µm (D).
the nematocyst discharges, the inverted tubule everts and the
spines are exposed on the outer surface.
SDS-PAGE analysis indicates that Hydra nematocysts
consist of a complex mixture of proteins varying from 12 to
200 kDa in size (Kurz et al., 1991). Most of the proteins larger
than 40 kDa can be removed from nematocysts by treatment
with Pronase or dilute DTT. Capsules remain intact and are still
refractile in phase contrast under these conditions, although the
outer wall is removed by these treatments (Kurz et al., 1991).
Atomic force microscopy has demonstrated that the inner wall
consists of bundles of fibrils (Holstein et al., 1994) and it has
been proposed that these fibrils are polymers of small 12-15
kDa collagen-like proteins (mini-collagens), which are major
components of the capsule wall (Kurz et al., 1991; see also
Fig. 9. Immunolocalization of spinalin in discharged nematocysts.
Isolated nematocysts were treated with 0.1 N NaOH and 65 µM DTT
to induce nematocyst discharge and partial denaturation of the
spines. Samples were dried on slides and immunostained with
spinalin antibody. Phase contrast micrographs (A,B) and
immunofluorescence micrographs (A′,B′) show staining of the spines
in a discharged stenotele (A,A′) and in two desmonemes and a
holotrichous isorhiza (B,B′). No staining was observed with
undischarged, isolated capsules (data not shown). Bar, 20 µm.
Blanquet and Lenhoff, 1966). Mini-collagens are encoded by
a family of nematocyte-specific genes which were first
identified in Hydra but have more recently also been found in
a reef-building coral, another member of the Cnidaria (Wang
et al., 1995).
The present experiments have identified a novel 24 kDa
protein, spinalin, as an additional component of nematocysts
and have shown that it is a constituent of stylets, spines and
opercula. The open reading frame includes a signal peptide at
the N terminus, indicating that spinalin is synthesized on the
endoplasmic reticulum, processed through the Golgi and sorted
to the developing nematocyst capsule. Immunocytochemistry
with a polyclonal antibody prepared against a 19 kDa fragment
of spinalin confirmed these conclusions. The antibody
recognized a single protein of 24 kDa in extracts of whole
Hydra and in extracts of purified nematocysts. When purified
capsules were dissociated with DTT and separated by
centrifugation into soluble and insoluble fractions, spinalin was
only found in the insoluble fraction, which contained stylets
Spinalin, a new Hydra nematocyst protein 1553
and opercula (Fig. 4). Immunofluorescence images confirmed
that spinalin is a part of these structures (Figs 5, 6 and 9).
Structure and function of spinalin
Spinalin shows no overall similarity to other proteins in the
databases. Nevertheless, parts of the sequence have features
characteristic of particular secondary structures. The Nterminal half of spinalin shows sequence similarity to loricrins
(Mehrel et al., 1990; Steinert et al., 1991) and to the glycinerich C-terminal parts of cytokeratins (Steinert et al., 1985,
1991). Loricrins are involved in shaping the cornified cell
envelope of epidermal keratinocytes; the terminal parts of
cytokeratins are important for bundling keratin filaments by
non-covalent supramolecular interactions and by disulfide
cross-linking (Steinert et al., 1991). Spinalin, loricrins and the
bundling regions of cytokeratins share a high glycine content
and other sequence similarities. For loricrins and the terminal
parts of cytokeratins ‘glycine loop’ structures were postulated
(Steinert et al., 1991). ‘Glycine loops’ are defined by the form
X(Y)n, where X is an aromatic or long-chain aliphatic residue
and Y is usually glycine, although polar residues like serine,
asparagine, arginine and cysteine may also occur. The value of
n can range from 1 to 35 and ‘glycine loop’ regions are thought
to be formed when several such X(Y)n quasi repeats are
tandemly arranged (Steinert et al., 1991). Region I of spinalin
fulfils these defining characteristics for ‘glycine loop’ domains,
although the high content of histidine in this region of spinalin
is unusual. Very recently it has been proposed that related
histidine- and glycine-rich regions may be involved in Zn2+ and
pH-dependent supramolecular self-association (Coyne et al.,
1997).
Region II has an even higher glycine content (54%) and
contains a large number of Gly-Gly-X triplets, where X stands
for long chain aliphatic or aromatic residues. Such sequences
can adopt a polyglycine II conformation, which is a left-handed
helix with three residues per turn (Rich and Crick, 1961; Lotz
and Keith, 1971; Navarro et al., 1995). Such Gly-Gly-X triplets
occur in avian keratins, which are highly abundant in claws and
scales (Whitbread et al., 1991). Both ‘glycine loop’ domains
and polyglycine II helices have been proposed to associate by
hydrogen bond formation and to play a role in organizing
higher-order structures (Steinert et al., 1991; Traub and Yonath,
1966). In the case of spinalin, the polyglycine-like structure of
regions I and II might be also stabilized by disulfide formation
between the eight cysteines in these regions.
The 19 kDa fragment of spinalin comprising regions I and
II was found to be insoluble under physiological condidition.
This behavior is similar to observations made on loricrins and
cytokeratins and is consistent with the high association
potential predicted from the spinalin19K sequence. At 1-2 M
urea spinalin19K becomes soluble, although circular dichroism
measurements (A. W. Koch, unpublished data) suggest that it
is still partly folded under these conditions. Association of such
partially folded structures could be the mechanism by which
spinalin molecules form higher order structures. More
conformational data, however, are needed to unravel the details
of spinalin association.
Electron micrographs (Fig. 7) suggest that spines are very
densely packed structures. The observation that spinalin
immunoreactivity disappears during spine formation also
supports this conclusion. Tight packing and network
formation are probably important for the function of spines.
Stylets, the large spines in stenoteles, are needed to puncture
the cuticle of prey organisms when capsules discharge
(Tardent and Holstein, 1982), while spines in desmonemes
and isorhizas appear to function as barbs binding the
discharged nematocyst to prey or to the substrate. These
results, together with observations on the structure and
function of loricrins, cytokeratins and avian keratins (see
above), suggest that polyglycine-like structures may be
particularly well adapted to formation of organelles having a
high mechanical strength.
Morphogenesis of nematocyst capsules and
formation of stylets
Immunocytochemical staining of Hydra polyps demonstrated
that spinalin first appears in developing nematocysts in the
body column at an intermediate stage of differentiation.
Spinalin is homogeneously distributed in the matrix at this
stage and also extends into the tubule when it forms on the
apical end of the capsule (Fig. 5B,C). Following inversion of
the tubule into the capsule, spinalin becomes concentrated in
the lumen of the inverted tubule, which corresponds
topologically to the external surface of the everted tubule.
Spines develop on this external surface (Holstein, 1981). At the
apical end of the capsule spinalin also appears to be transferred
from the matrix to the outside of the tubule in order to form
the operculum.
Upon further maturation, spinalin staining ceases in both the
operculum and the spines, although western blot analysis
demonstrated that spinalin continues to be present in these
structures (Fig. 4A). We interpret this loss of immunoreactivity
in the mature operculum and spines as an indication of extreme
condensation of spinalin in these structures. This suggestion is
supported by the observation that spinalin immunoreactivity
could be restored by mildly denaturing conditions (Fig. 9).
The mechanism by which spinalin is transferred through the
tubule wall is not known. However, the wall at this stage is still
‘soft’, since it can be deformed during the process of fixation.
At a slightly later stage the wall becomes rigid and is no longer
deformed by fixation. At this stage the capsule wall also
becomes impermeable to polypeptides since poly-γ-glutamate
polymers are retained inside capsules (Weber, 1990). Even at
this stage, however, the wall can and does stretch with the
increase in osmotic pressure which results from the synthesis
of poly-γ-glutamate in the matrix (Weber, 1990, T. W. Holstein
and C. N. David, unpublished results).
It is interesting to note that a similar pattern of staining has
been observed for the H22 antigen during capsule formation.
The monoclonal antibody H22 recognizes a 100 kDa protein
in the outer capsule wall (Kurz et al., 1991). Like spinalin, the
H22 antigen first appears in the matrix and then moves through
the inner capsule wall to form the outer wall (T. W. Holstein,
unpublished results). Some of the H22 antigen also appears to
move through the wall of the tubule and to become localized
in spines.
The relationship between spinalin structure and spine
morphogenesis requires further investigation. Although the
spines of stenoteles, desmonemes and isorhizas are quite
different in shape (Fig. 8), they all contain spinalin (Fig. 9).
Whether other proteins are also present in spines and contribute
to formation of these different shapes is not clear from the
1554 A. W. Koch and others
present experiments. However, an attractive alternative
hypothesis is that differences in the folding of the inverted
tubule in different nematocyst types affect the transfer of
spinalin across the tubule wall and hence the morphology of
spines. Which molecular features of spinalin are important for
spine morphogenesis is also unclear. At present we can only
speculate that the highly charged regions III and IV might be
involved in solubilization of the protein when transported to or
located in the matrix while the glycine- and histidine-rich
region I might be involved in pH- or Zn2+-dependent assembly
of higher order structures. Changes in pH have indeed been
observed during capsule morphogenesis (Gunzl, 1968) and
could regulate such processes.
We are very grateful to Dr A. Brancaccio for stimulating
discussions and helpful suggestions. We thank Timo Zimmermann for
help with image processing and Petra Snyder for technical assistance
with the cell type separation and immunocytochemistry. This work
was supported by the Deutsche Forschungsgemeinschaft and the
Swiss National Science Foundation.
REFERENCES
Bairoch, A. and Apweiler, R. (1997). The SWISS-PROT protein sequence
data bank and its supplement TrEMBL. Nucleic Acids Res. 25, 31-36.
Blanquet, R. and Lenhoff, H. M. (1966). Disulfide-linked collagenous
protein of nematocyst capsules. Science 145, 152-153.
Bressan, G. M., Argos, P. and Stanley, K. K. (1987). Repeating structure of
chick tropoelastin revealed by complementary DNA cloning. Biochemistry
26, 1497-1503.
Coyne, K. J., Qin, X.-X. and Waite, J. H. (1997). Extensible collagen in
mussel byssus: a natural block copolymer. Science 277, 1830-1832.
Engel, J. (1997). Versatile collagens in invertebrates. Science 277, 1785-1786.
Greber, M. J., David, C. N. and Holstein, T. W. (1992). A quantitative
method for separation of living Hydra cells. Roux’s Arch. Dev. Biol. 201,
296-300.
Gunzl, H. (1968). Über die Reifung der Nesselkapseln bei Dipurena reesi
Vannucci (Hydrozoa). Zeitsch. f. Zellforsch. 89, 509-518.
Hessinger, D. A. and Lenhoff, H. M. (1988). The Biology of Nematocysts.
Academic Press, San Diego. 593 pp.
Holstein, T. W. (1981). The morphogenesis of nematocytes in Hydra and
Forskålia: An ultrastructural study. J. Ultrastruct. Res. 75, 276-290.
Holstein, T. W. and Tardent, P. (1984). An ultrahigh-speed analysis of
exocytosis: nematocyst discharge. Science 223, 830-832.
Holstein, T. W., Benoit, M., von Herder, G., Wanner, G., David, C. N. and
Gaub, H. E. (1994). Fibrous mini-collagens in Hydra nematocytes. Science
265, 402-404.
Kozak, M. (1987). An analysis of 5′-noncoding sequences from 699 vertebrate
messenger RNAs. Nucleic Acid Res. 15, 8125-8148.
Kurz, E. M., Holstein, T. W., Petri, B. M., Engel, J. and David, C. N. (1991).
Mini-collagens in Hydra nematocytes. J. Cell Biol. 115, 1159-1169.
Langbein, L., Heid, H. W., Moll, I. and Franke, W. W. (1993). Molecular
characterization of the body site-specific human epidermal cytokeratin 9:
cDNA cloning, amino acid sequence, and tissue specificity of gene
expression. Differentiation 55, 57-71.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227, 680-685.
Loomis, W. F. and Lenhoff, H. M. (1956). Growth and sexual differentiation
of Hydra in mass culture. J. Exp. Zool. 132, 555-574.
Lotz, B. and Keith, H. D. (1971). The crystal structures of poly(LAla-GlyGly-Gly)II and poly(LAla-Gly-Gly)II. J. Mol. Biol. 61,195-200.
Mariscal, R. N. (1974). Nematocysts. In Coelenterate Biology. Reviews and
New Perspectives (ed. L. Muscatine and H. M. Lenhoff), pp. 129-178,
Academic Press, New York.
Mehrel, T., Hohl, D., Rothnagel, J. A., Longley, M. A., Bundman, D.,
Cheng, C., Lichti, U., Bisher, M. E., Steven, A. C., Steinert, P. M., Yuspa,
S. H. and Roop, D. R. (1990). Identification of a major keratinocyte cell
envelope protein, loricrin. Cell 61, 1103-1112.
Navarro, E., Tereshko, V., Subirana, J. A. and Puiggali, J. (1995).
Incorporation of diacids into the polyglycine II structure: model studies.
Biopolymers 36, 711-722.
Pearson, W. R. and Lipman, D. J. (1988). Improved tools for biological
sequence comparison. Proc. Nat. Acad. Sci. USA 85, 2444-2448.
Ramachandran, G. N., Sasisekharan, V. and Ramakrishan, C. (1966).
Molecular structure of polyglycine II. Biochim. Biophys. Acta. 112, 168170.
Rich, A. and Crick, F. H. C. (1961). The molecular structure of collagen. J.
Mol. Biol. 3, 483-506.
Sambrook, J., Fritsch, D. M. and Maniatis, T. (1989). Molecular Cloning:
A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York.
Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with
chain termination inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467.
Schägger, H. and von Jagow, G. (1987). Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range
from 1-100 kDa. Anal. Biochem. 166, 368-379.
Slautterback, D. B. and Fawcett, D. W. (1959). The development of the
cnidoblasts of Hydra: an electron microscopy study of cell differentiation.
J. Biophys. Biochem. Cytol. 5, 441-451.
Steinert, P. M., Parry, D. A., Idler, W. W., Johnson, L. D., Steven, A. C.
and Roop, D. R. (1985). Amino acid sequences of mouse and human
epidermal type II keratins of Mr 67,000 provide a systematic basis for the
structural and functional diversity of the end domains of keratin intermediate
filament subunits. J. Biol. Chem. 260, 7142-7149.
Steinert, P. M., Mack, J. W., Korge, B. P., Gan, S.-Q., Haynes, S. R. and
Steven, A. C. (1991). Glycine loops in proteins: their occurrence in certain
intermediate filament chains, loricrins and single-stranded RNA binding
proteins. Int. J. Biol. Macromol. 13, 130-139.
Studier, F. W. and Moffatt, B.-M. (1986). Use of bacteriophage T7
polymerase to direct selective high-level expression of cloned genes. J. Mol.
Biol. 189, 113-130.
Sugiyama, T. and Fujisawa, T. (l977). Genetic analysis of developmental
mechanisms in Hydra. Sexual reproduction of Hydra magnipapillata and
isolation of mutants. Dev. Growth Diff. 19, 187-200.
Tardent, P. and Holstein, T. W. (1982). Morphology and morphodynamics
of stenotele nematocyst in Hydra attenuata. Cell Tissue Res. 224, 269-290.
Technau, U. and Holstein, T. W. (1995). Head formation in Hydra is different
at apical and basal levels. Development 121, 1273-1282.
Traub, W. and Yonath, A. (1966). Polymers of tripeptides as collagen models.
J. Mol. Biol. 16, 404-414.
Von Heijne, G. (1986). A new method for predicting signal sequence cleavage
sites. Nucleic Acids Res. 14, 4683-4690.
Wang, W., Omori, M., Hayashibara, T., Shimoike, K., Hatta, M.,
Sugiyama, T. and Fujisawa, T. (1995). Isolation and purification of a minicollagen encoding a nematocyst capsule protein from a reef-building coral,
Acropora donei. Gene 152, 195-200.
Weber, J. (1989). Nematocysts (stinging capsules of Cnidaria) as Donnanpotential-dominated osmotic system. Eur. J. Biochem. 184, 465-476.
Weber, J. (1990). Poly(γ-glutamic acid)s are the major constituents of
nematocysts in Hydra (Hydrozoa, Cnidaria). J. Biol. Chem. 265, 9664-9669.
Weber, J. (1991). A novel kind of polyanions as principal components of
cnidarian nematocysts. Comp. Biochem. Physiol. 98A, 285-291.
Weber, J., Klug, M. and Tardent, P. (1987). Some physical and chemical
properties of purified nematocysts of Hydra attenuata Pall. (Hydrozoa,
Cnidaria). Comp. Biochem. Physiol. 88B, 855-862.
Weill, R. (1934). Contribution à l’étude des cnidaires et des leurs
nématocystes. Trav. Sta. Zool. Wimereux 10-11, 1-701.
Whitbread, L. A., Gregg, K. and Rogers, G. E. (1991). The structure and
expression of a gene encoding chick claw keratin. Gene 101, 223-229.