* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The KIPHOS gene encoding a repressible acid
Fatty acid synthesis wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Citric acid cycle wikipedia , lookup
Gene nomenclature wikipedia , lookup
Metalloprotein wikipedia , lookup
Western blot wikipedia , lookup
Magnesium transporter wikipedia , lookup
Proteolysis wikipedia , lookup
Genetic code wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Expression vector wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Gene regulatory network wikipedia , lookup
Butyric acid wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Specialized pro-resolving mediators wikipedia , lookup
Biochemistry wikipedia , lookup
Biosynthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Silencer (genetics) wikipedia , lookup
MicrObiology (1997), 143, 2615-2625 Printed in Great Britain The KIPHOS gene encoding a repressible acid phosphatase in the yeast KIUyyveromyces Iactis: cloning, sequencing and transcriptional analysis of the gene, and purification and properties of the enzyme Encarnacidn FermiMn and Angel Domlnguez Author for correspondence: Angel Dominguez. Tel: +34 23 294677. Fax: +34 23 224876. e-mail : [email protected] Departamento de Microbiologla y Genetical Universidad de Salamanca, 37071 Salamanca, Spain A secreted phosphate-repressible acid phosphatase from Kluywemmyces lactis has been purified and the N-terminal region and an internal peptide have been sequenced. Using synthetic oligodeoxyribonucleotidesbased on the sequenced regions, the genomic sequence, KlPH05, encoding the protein has been isolated. The deduced protein, named KIPhoSp, consists of 469 amino acids and has a molecular mass of 52520 Da (in agreement with the data obtained after treatment of the protein with endoglycosidase H). The purified enzyme shows size heterogeneity, with an apparent molecular mass in the range 90-200 kDa due to the carbohydrate content (10 putative glycosylation sites were identified in the sequence). A 16 amino acid sequence at the N-terminus is similar t o previously identified signal peptides in other fungal secretory proteins. The putative signal peptide is removed during secretion since it is absent in the mature secreted acid phosphatase. The gene can be induced 400400-fold by phosphate starvation. Consensus signals corresponding to those described for Sacchammyces cerevisiae PHOlQI and PHO2-binding sites are found in the 5’ region. Northern blot analysis of total cellular RNA indicates that the KlPH05 gene codes for a 1.8 kb transcript and that its expression is regulated a t the transcriptional level. Chromosomal hybridization indicated that the gene is located on chromosome II. The KlPH05 gene of K. lactis is able t o functionally complement a ph05 mutation of Sacch. cerevisiae. Southern blot experiments, using the KlPH05 gene as probe, show that some K. lactis reference strains lack repressible acid phosphatase, revealing a different gene organization for this kind of multigene family of proteins as compared to Sacch. cerevisiae. Keywords : Kluyverornyces lactis, acid phosphatase, transcriptional regulation INTRODUCTION The acid phosphatase system in yeasts and fungi of different genera varies in the number of genes involved and also in the way these are regulated. In Saccharomyces cerevisiae, four genes encoding phosphatases Abbreviation: Endo H, endoglycosidase H. The EMBL accession number for the sequence reported in this paper is 233995. ~~ 0002-1648 0 1997 SGM with an acidic optimum pH have been isolated and sequenced (namely P H 0 3 , PHO5, P H 0 1 1 and P H 0 1 2 ) . The proteins are secreted from the yeast cells and are predominantly found between the cytoplasmic membrane and the cell wall. Three of these genes, PHO.5 (which encodes the major acid phosphatase, located on chromosome II), PHO11 (located on chromosome I) and PH012 (located on chromosome VIII), whose products have amino acid sequences very similar to Pho5p - they only differ in four amino acids - are phosphate-repressible and the other one, P H 0 3 , which is tightly linked to P H 0 5 , is thiamin-repressible (for reviews see Schwein- ~ Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2615 E. F E R M I N A N a n d A. D O M I N G U E Z gruber, 1987; Vogel & Hinnen, 1990; Johnston & Carlson, 1992). In the fission yeast Schizosaccharomyces pombe, two acid phosphatases encoded by two genes, phol and pho4, have been cloned and sequenced. The major acid phosphatase is encoded by phol and its expression is repressed by orthophosphate in the medium as occurs with the PHO5 gene of Sacch. cereuisiae. However, the phol gene can only be induced 2-3-fold in response to phosphate starvation (Elliott et al., 1986), whereas for the PHO5 gene of Sacch. cereuisiae induction ranged from 1.50-fold (Mizunaga, 1979) to 1000-fold (Oshima, 1982). An acid phosphatase showing 100-fold induction has also been isolated from Pichia pastoris (Payne et al., 1995). The Schiz. pombe pho4 gene is also regulated by thiamin but the overall similarity with the P H 0 3 of Sacch. cereuisiae is only 27 70and no obvious consensus regions can be detected (Yang & Schweingruber, 1990). Secreted repressible acid phosphatases from fungi have been cloned and sequenced in Aspergillus niger ( p a c A ; MacRae et al., 1988), Penicillium chrysogenum (phoA; Haas et al., 1992) and Aspergillus niger var awamori ( a p h ;Piddington et al., 1993). No significant amino acid sequence homologies among the acid phosphatases have been described (Piddington et al., 1993). The P H 0 5 promoter of Sacch. cereuisiae, whose expression can be regulated by the supply of inorganic phosphate in the culture medium, has been used for heterologous gene expression. Using this system, several proteins, including hirudin and tissue-type plasminogen activator (t-PA) (Hinnen et al., 1989), have been successfully produced. The dairy yeast Kluyueromyces lactis has been developed as an efficient system for high-level production of foreign proteins (Buckholz & Gleeson, 1991 ;Fleer et al., 1991; Swinkels et al., 1993). Major advantages of this organism are its impressive secretory capacity, its excellent large-scale fermentative characteristics, its food-grade status, and the availability of both episomal and integrative expression vectors (Chen et al., 1988). In this paper we describe the purification and cloning of a phosphate-repressible acid phosphatase of K . lactis, compare the enzyme synthesized and secreted with acid phosphatases produced by Sacch. cereuisiae and Schiz. pombe, and report a transcriptional analysis and a description of the genomic organization of the acid phosphatases in 2359/152 and 2360/7, the two K . lactis strains used in many laboratories. METHODS Strains and media. A description of the plasmids and genotypes of the yeast strains used in this study is given in Table 1. Yeasts were maintained on slants of YED medium (1'/o yeast extract, 1o/' glucose, 2 % agar). Yeast cultures were grown at 28 "C in 1000 ml Erlenmeyer flasks containing 300 ml medium in a gyratory shaker at 250 r.p.m. on minimal liquid medium (MM) [0.7'/0 yeast nitrogen base (Difco), 1 % glucose ; Wickerham, 19461. Media were supplemented with uracil, leucine, methionine, arginine and lysine, each at 50 pg 2616 ml-', as required. As derepression medium we used M M in which the phosphate concentration was lowered to 10 mg 1-' (low-Pimedium). The medium was buffered with 0.05 M citric acid/sodium citrate, p H 4.3. Enzyme purification. Derepressed cells were harvested from the low-Pi medium by centrifugation and washed twice with 0.01 M citric acid/sodium citrate buffer, p H 4.3. All enzyme purification steps were done at 4 "C unless otherwise stated. T o avoid proteolytic degradation, all buffers were supplemented with a mixture of proteinase inhibitors containing PMSF at 3.5 mg ml-' and pepstatin, antipain, leupeptin and chymostatin at 20 pg ml-l each. Packed cells (approximately 90 g wet weight from 42000 ml medium) were resuspended in citric acid/sodium citrate, pH 4.3. Equal volumes of yeast cell suspension and glass beads (0454.50 mm diameter) were broken by mechanical shaking in a Braun MSK homogenizer. This treatment disrupted >98% of the cells as judged by light microscopic examination. The glass beads were removed by washing the broken cell suspension through a coarse sintered-glass filter. Cell debris was removed by centrifugation at 3000 g for 10 min and at 40000 g for 45 min. The supernatant fraction served as the starting material for enzyme purification. This fraction was brought to 30 '/o saturation by the slow addition of powdered ammonium sulphate, stirred gently for 3 h, and centrifuged at 25000g for 30 min. The resulting supernatant was taken to 60% saturation with ammonium sulphate, stirred for 3 h and centrifuged as before. The supernatant fluid was concentrated and dialysed against the same buffer. DEAE-Sephacel chromatography. Soluble supernatant was adsorbed onto a 1.3 x 42 cm column bed of DEAE-Sephacel. The column was eluted first with 240 ml 0.01 M Tris buffer, pH 7.5, and then with 100 ml of a linear gradient of 0 4 . 3 M NaCl in the same buffer. Fractions were collected and those rich in enzyme activity were pooled, concentrated and dialysed against the citric acid/sodium citrate buffer. Biogel A 5-M chromatography. The material collected from the DEAE-Sephacel column was loaded onto a 2 x 170 cm column of Biogel A 5-M. The proteins were eluted with 2 1 0-05 M citric acid/sodium citrate buffer pH 4-3 with 0.1 M NaCl at a flow rate of 10 ml h-' and 2.5 ml fractions were collected. FPLC. The material collected from the Biogel A 5-M column was further purified by FPLC (Pharmacia LKB) with a Mono Q HR 5/5 column (Pharmacia LKB Biotechnology) with an NaCl gradient (30-50'/0) in Tris/HCl buffer 0.02 M p H 7.6. Fractions were collected and dialysed against 0.05 M citric acid/sodium citrate buffer p H 4.3. Enzyme activity. Acid phosphatase activity was assayed with p-nitrophenyl phosphate (PNPP; Sigma). The assay mixture was composed of 250 pl enzyme sample, 125 pl 0.36 M citric acid/sodium citrate buffer pH 4.3, and 75 pl 0.04 M PNPP solution. The reaction was initiated by the addition of the substrate and terminated by the addition of 750 pl 0.1 M NaOH. One unit of activity was defined as the amount of enzyme which released 1 nmol p-nitrophenol in 1 min at 30 "C. Protein assays. Protein was determined colorimetrically by the Lowry method, with bovine serum albumin as a standard. A,,,.was used to monitor the protein content of column fractions. Endo /?-N-acetylglucosaminidaseH (Endo H) treatment. Purified enzyme samples were incubated with Endo H for the Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 T h e acid phosphatase system of K . lactis Table 1. Plasmids and strains used Strain or plasmid Plasmids pSKl pEF5 Description or genotype K . lactis expression vector based on the integrative vector YIp5 of Sacch. cerevisiae with the replication origins pKDl of K . drosophilarum and 2p of Sacch. cerevisiae, carrying URA3 2.5 kb HpaII fragment carrying KlPHO5 in pSKl Sacch. cerevisiae Source or reference Bianchi et al. (1987) This work ACX1-2A ura3-52 leu2-212 trpl-1 pho3 phoS Lopez (1989) K . lactis CBS2359 CBS2360 23591152 236017 MD2/1 23591152F MATa MATa MATa metAl-I MATa lysA MATa uraA lysA argA k: ki rag2 pKD1+ MATa metAl-1 ura3-20 CBS CBS Goffrini et al. (1989) Goffrini et al. (1989) Goffrini et al. (1989) This work F- hsdS2O recA13 aral4 proA2 lacy1 galK2 rpsLB20(Smr)xyl-5 mtl-1 supE44 I hsdR mcrB araD139 A(araABCleu)769 AlacX74 galU galK rpsL thi supE44 AlacU169 (480 lacZAM15) hsdRl7 recA endA gyrA96 thi-1 relAl F': traD36 proAl3 ladq lacZAM15 A(1ac-proAB) thi supE A(sr1-recA), 306: :TnlO(Tet') Boyer & Roulland-Dussoix (1969) E. coli HBlOl MC1061 DH5a MV1190 Meissner et al. (1987) Hanahan (1983) Bio-Rad desired times at 37 "C in 0.05 M acetic acid/sodium acetate buffer, pH 5.6, containing 1 mM PMSF and 10 pM pepstatin. Biosystems microbore HPLC and were sequenced on an Applied Biosystems model 47312 instrument. Electrophoresis, electroblotting and immunological detection. Slab gel electrophoresis was performed essentially as described by Laemmli (1970). Nondenaturing PAGE was carried out in a similar way, except that SDS was omitted. Electrotransfer of proteins to nitrocellulose membranes and immunological reactions were performed according to Towbin et al. (1979) and Erickson et al. (1982). DNA manipulations.Total DNA from K . lactis was prepared as described for filamentous fungi by Raeder & Broda (1985). The media and procedures used for yeast transformation have already been described (Sherman et al., 1977; Becker & Guarente, 1991; Sinchez et af., 1993). Protein stains. Gel slabs were stained for protein by the silver staining method of Morrissey (1981) and for enzyme activity as described by Dimond et al. (1983). Carbohydrate content. Samples were assayed for carbohydrate content by the phenol/sulphuric acid method of Dubois et al. (1956) with mannose as standard. Cyanogen bromide digestion. Protein samples (10 pg) were incubated with 100 pl 5 O/O 2-mercaptoethanol in water for 10 min at ambient temperature. Then 200 pl70 OO/ formic acid containing approximately 4 mg cyanogen bromide ml-l was added and the sample was incubated overnight in the dark at ambient temperature. It was then dried in a Speed-Vac. The blots were extracted by sequential addition of three aliquots of 100 pl acetonitrile for 10 min each, after which the eluted material was removed. The three extracts were combined, dried in the Speed-Vac and dissolved in 100 p10.1 O h trifluoroacetic acid. The peptides were separated on an Applied Restriction enzyme digestions and DNA ligations were performed according to the recommendations of the manufacturers. Plasmid DNA was isolated from Escherichia coli by standard procedures (Sambrook et al., 1989). DNA fragments to be used as probes were labelled by random priming with digoxigenin-dUTP (Boehringer Mannheim) and used according to the instructions of the manufacturer. RNA preparationsand Northern analysis. RNA was prepared from exponentially growing cultures on YED and M M by the method of Percival-Smith & Segall (1984). Prehybridization, hybridization and primer extension were performed as described by Sambrook et al. (1989). A synthetic oligonucleotide (5'-3') complementary to nucleotide positions 22 to 49 of the KlPHO5 gene sequence was employed. In all Northern analysis experiments, the RNA concentration was normalized using hybridization of the ACT1 transcripts from K . lactis. + + PCR amplifications. PCR experiments were performed using Taq DNA polymerase as recommended by the supplier (Perkin Elmer Cetus). A 900 bp fragment was amplified by oligomers Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2617 E. F E R M I N A N a n d A. D O M I N G U E Z 1 [5'-GCN CCN AT(TAC) TCN AA(AG) GA(TC) AA(TC) GGN ACN-3'1 and 2 [5'-NGG (AG)TT NCC NGC NCC (TC)CT (TC)CT (AG)TA (AC)AA-3'1. The PCR conditions used to amplify K . l a d s DNA were as follows: 10 ng total DNA from strain 2359/152 was mixed with 50 pmol of each primer in a final reaction volume of 50 p1 and subjected to 30 amplification cycles (95 "C, 1 min; 42 OC, 1 min; 72 "C, 1 min). Sequence analysis of the KPHOS locus. The DNA restriction fragment harbouring the K l P H 0 5 gene fragment was subcloned into the pBluescript plasmids (SK' and KS', Stratagene) and a nested set of closely spaced deletions was created using exonuclease 111 (Henikoff, 1987). Templates were sequenced on both strands with Sequenase enzyme (Boehringer) using the dideoxynucleotide chain-termination sequencing reactions (Sanger et af., 1977). The products of the sequencing reactions were resolved on buffer gradient polyacrylamide-urea sequencing gels (Biggin et al., 1983) and exposed to Kodak XAR-5 X-ray film. DNA and protein sequences were analysed using the DNASIS and PROSIS programs (Pharmacia-LKB, Hitachi). The deduced amino acid sequence of the K1PHO.5 protein product was compared with the SWISS-PROT database using the FASTA program (Pearson & Lipman, 1988). Alignments of protein sequences were done with CLUSTAL programs (Higgins & Sharp, 1988). RESULTS Derepression of acid phosphatase Three strains of K. lactis (2359/152,2360/7 and MD2/1) were grown in M M to the exponential phase. A basal level of acid phosphatase activity between 1 and 3 units per 10' cells was detected. Cells were harvested, resuspended at a concentration of 2.5 x lo' cells ml-l in buffered low-Pi medium, and growth and acid phosphatase activity were determined in intact cells and in the supernatant. The results are shown in Fig. 1. No derepressible acid phosphatase activity was found in F 800 I $ 1 W 600 18 400 4 200 2 .-C w vl .-w>% 3 0 .- t; a 2 4 6 8 1 0 L 12 Time (h) Fig. 1. Effect of phosphate starvation on acid phosphatase derepression. Cells were grown t o the exponential phase in MM (Pi concentration 1 g 1-l) and then resuspended (2.5 x lo7 cells ml-l) in buffered low-Pi medium (Pi concentration 10 mg I-l). Samples were removed at the times indicated and acid phosphatase activity was measured in washed cells: A,K. lactis 2359/152; K. lactis 2360/7; 0 , K. lactis M D U l . OD:, A, K. lactis 2359/152; 0, K. lactis 2360/7; 0, K, lactis M D U l . ., 2618 strains 2360/7 or MD2/1. However, in strain 2359/152 an increase in acid phosphatase activity was detected after 2 h growth; this reached a maximal value of about 600 times the basal level after 8 h. Most of the phosphatase activity (90-92 "/o) was associated with washed cells and a small amount (8-10 % ) was found in the supernatant. Our results are in agreement with those described for Sacch. cerevisiae (Schurr & Yagil, 1971), Pichia pastoris (Payne et al., 1995) and Yarrowia lipofytica (Lopez & Dominguez, 1988). In view of these findings, to purify the enzyme, K . lactis 2359/152 cells were collected after 8 h incubation in buffered low-Pi derepression medium. Purification of the enzyme Breakage of cells as described in Methods followed by centrifugation produced a distribution of activity as follows : 30 YO in the cell wall (3000 g pellet) ;5 YO in cell membranes (40000g pellet) and 65-70 % in the soluble fraction. We decided to use the last fraction as starting material. The purification steps used were similar to those described for other yeast glycoproteins such as invertase in Sacch. cerevisiae (Babczinski, 1980) or Schix. pombe (Moreno et al., 1990) or repressible acid phosphatase in Y . lipolytica (Lopez & Domhguez, 1988). The results are shown in Table 2. SDS-PAGE of the MonoQ-FPLC-eluted fractions showed by silver staining only a single diffuse band due to the sugar moiety (Fig. 2a, lane 2), a characteristic of yeast glycoproteins (Domhguez et al., 1991; Moreno et al., 1990), with an estimated molecular mass between 90 and 200 kDa. The covalent association between carbohydrate and protein was confirmed by applying the purified enzyme to a column of concanavalin A-Sepharose. All the activity was retained and could be eluted with 1 M amethylmannoside. Furthermore, the same band detected in the gels by silver staining could be detected by enzyme activity or by periodic acid/Schiff staining, again indicating the glycoprotein nature of the enzyme (not shown). After exhaustive digestion with Endo H, only one protein band, of molecular mass 52 kDa, appeared (Fig. 2a, lane 3), confirming that the heterogeneity of the enzyme is due to its carbohydrate content. This result was further confirmed by immunoblotting. Rabbit antibodies raised against the purified protein moiety of the Y . lipolytica acid phosphatase (Domhguez et al., 1991) reacted with both the complete (Fig. 2b, lane 1)and the deglycosylated protein (Fig. 2b, lane 2). Cross-reactivity of these antibodies against the acid phosphatase of Sacch. cerevisiae has also been reported by us (Lopez & Domhguez, 1988), indicating a high similarity between the protein moiety of many yeast repressible acid phosphatases. The pure enzyme showed an asymmetric pH-activity profile, with maximal activity at p H 4.3 in citric acid/ sodium citrate buffer (not shown). Thermostability experiments indicated a high degree of lability for the K . lactis acid phosphatase : 25 % and 100 Yo of the activity was lost after 30 min incubation at 30 "C and 37 "C Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 The acid phosphatase system of K . lactis Table 2. Purification of an acid phosphatase from derepressed cells of K. lactis 2359/152 Purification step Crude extract Supernatant (NH4),S04(60%) DEAE-Sephacel Biogel A 5-M Mono-Q (FPLC) Total protein (mg) 6930 1673 53 3 2 1 Total activity (units) 1247 600 842000 97 600 90 000 70000 51 200 Specific activity Purification (-fold) 180 500 1850 33 900 36 800 44 130 1 3 10 188 204 245 Yield ( OO/ 1 Carbohydrate (Yo) 100 68 8 7 6 4 - - 50 47 45 major band, approximately 0.9 kb in length, was detected upon electrophoresis of the PCR products. After sequencing, this fragment showed strong homology with the PHO5 gene of Sacch. cereuisiae. Southern analysis was performed on digested total DNA of K . lactis and probed with the PCR fragment (not shown). An approximately 2500 bp (HpaII-HpaII) fragment was used to obtain a minigenomic DNA library that was assayed for positive clones with the homologous probe. From 1023 colonies assayed, seven positive clones were detected. The insert (HpaII-HpaII) was sequenced on both strands, revealing an ORF of 1407 bp (Fig. 3). The gene was designated KIPHOS. Fig. 2. (a) SDS-PAGE of purified repressible acid phosphatase from K. lactis (KIPho5p). Lane 1, size standards; lane 2, KIPho5p after FPLC Mono Q exclusion; lane 3, KIPho5p after treatment with Endo H. (b) Blot of (a) with antiserum against the 60 kDa polypeptide of the acid phosphatase of Y. lipolytica. respectively (not shown), in agreement with the results described for the acid phosphatase of other yeasts (Dominguez et al., 1991). A Lineweaver-Burk plot for purified repressible acid phosphatase was constructed with enzyme assays performed at pH 4.3. An apparent K , value of 3 x M for p-nitrophenyl phosphate as substrate was determined. Molecular cloning of the KIPHOS gene The purified protein (digested with Endo H) was separated by SDS-PAGE and electroblotted onto ProBlott membrane. A 167 pmol sample of the purifed protein (10 pg) was subjected to Edman degradation to obtain the first 15 N-terminal residues of the mature product, NH,-APISKDNGTVCYALN. Another sample was digested with cyanogen bromide and the peptides separated by reverse-phase HPLC; one of them (that eluting at 21.4 min) was analysed for nine residues. A sequence of NH,-FYRRGAGNP was obtained. Degenerate oligonucleotides based on both peptides were synthesized and used as primers in PCR to amplify the region of the yeast genomic DNA flanked by them. A Analysis of KIPHOS flanking sequences The nucleotide sequence surrounding the putative initiation codon conformed to the consensus for translation initiation in yeasts, with a conserved A at positions - 1 and -3 (Cigan & Donahue, 1987; Kozak, 1987). A TATA element in the 5’ untranslated region of the KlPHOS gene was found at position -134 relative to the A of the initiation codon, preceded (at -214) by a CAAT box (see Fig. 3). In yeast TATA boxes have been found at positions varying from -30 to -300 upstream from the translation start (Breathnach & Chambon, 1981; Kim et al., 1986). Vogel et al. (1989) identified two upstream activating sequences involved in transcriptional regulation of the phosphate-repressible Sacch. cereuisiae acid phosphatase gene PH05. The yeast gene sequence CACGT(G/T) is the target for binding a putative P H 0 4 regulatory factor. We found such a sequence in the 5’ flanking region of the K. lactis acid phosphatase gene at -430 and - 192 relative to the first nucleotide of the ATG start codon (Fig. 3). Also, a region with a symmetric axis - ACTTTCTAAGAAAGT - between the two PH04-binding sites could be defined (positions -319 to -305). Both the spacing and the symmetry resemble those described for the PH02-binding site in Sacch. cereuisiae (Vogel et al., 1989). In yeast, the TAA ... TAGT/TATGT ...TTT transcription termination motif (Zaret & Sherman, 1982) is found at the 3’ end of most genes so far published. These motifs were also observed at the 3’ end of the KlPH0.5 gene (Fig. 3, open circles). Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2619 E. F E R M I N A N a n d A. D O M I N G U E Z -771 CCGGCMCCATCATCATATCAAAGCCCAAAACGGAAAAGCTCAACGGTTCATAGCATCCACGTCTTTCCTTT -100 -699 TCCGCTACCTCGGTGTCGTTTATGTTCTTGCACACCCTAATATTGAACCTTACACGCTGCATATAAAAACTC -628 -621 TTCATTGTTAATTCCTTAGTTTCCGCACAGACAAAGCACTGGAAGTGTGAAACACGCTGTTTTGTTTTTATG -556 -555 CTAACACATCGGCAGTAAGGGTTCAGATGCGAATTGAACGCTTTTCCCTCGGAAOGGGTCTCAGGACATGGA -404 -483 CTGCCGTTGAGTGCCMACTGCTTCGTCTAAGTGGTTTGAATCCTACTTGACACACMTMCATACGGCATTCG -412 -411 AGTATTTTCAGGOTCGTTGCATTTTGAAAAAGGAACACTGAATTTGCAGATCAGAAAAGCTCTGTMGGTTG -340 -339 CAAAACTCGCTTTCTCTGATACTT~CTAAMAAAMTGCGGCTGTAAAATAAAGCCGACTGCTCGAGCCCTTTA -268 -a67 G A C T A T A T T C T C G A A T A T C G A T T A G A T G A T G G A A A T T C G T T G G A G G A T A C C G C ~ T A A T G C T A A A T G A C-196 AC -195 T C G C A C ~ T M T A G T G C C T T C A T C G A G A T G A G T T C A G A T G T A T G A A C A G A C A G A A A T T T G G C A T ~ A G A A C -124 CG -123 1 -51 CATCACACAAGTCATGAGACAAGGTTTACTGATGATCCTTCATTACAACAATAGAAGGTATTATTCAATTGC v 9 net L O U ser 11. L ~ U ATG CTA TCT ATT C T G V I ATAAAAATGAAGCAGATCAAAAACGCAGGTTCAAACAAGCTCAGGTTAATA 4 .. -52 5 15 Leu Gly Leu Leu S e r Leu S e r Gly Thr H L S A l a A l a Pro 11. S e r Lys A s p A s n TTG COT TTA TTA T C A C T A T C A GCC ACC C A T GCG G C T C C T ATT TCA AAC GAT AAC 26 39 Gly Thr Val Cye Tyr A l a Leu Asn Aan S.r Thr Thr Asp Glu S e r Ile P h e 5.1 TOT TAT GCC C T C AAC AAC ACT ACC A C A CAC CAI T C C A T C TTT T C C 41 123 42 124 Leu Leu A s n Cly G l n Cly Pro Hi8 Tyr A s p Tyr P r o Gln S e r Phe Gly 11. P r o CTT rrc AAC OGT C A A GGT ccc CAC TIC GAT r A c C C A IA C TCG TTT COG A T C C C A 59 117 60 178 Val Clu Val Pro A s p C l n Cys Thr Val Clu His Val Gln net Leu A l a A r g H i s CTA GAA m c C C A GAC CAG TGC ACA c m GAA CAT GTC CAA ATC T T G GCA AGA CAT 71 231 78 232 Gly G l U A S 9 TYr Pro Thr Al. S e r LyS Cly LyS Leu M e t 11. A l a Leu Trp Asp CCA G A G AGA TAT CCA ACT GCA TCA AAG GOT MA c m ATC ATT GCA CTA TOG G A T 95 285 96 286 Lys Leu Lys G l u Phe G l n Gly Gln Tyr Asn A s p Pro Leu Glu V a l Phe A s n A s p AAA TTG AAC GAG TTC CAG GGT C I A TAT AAC CAT CCT TTG C A I CTT TTC AAT GAT 113 339 114 340 Tyr Glu Phe ?he V a l Ser Amn Thr Ly. Tyr Phe ASP Gln Leu Thr Asn S e r Thr TAT GAG TTT TTT CTG TCA AAC A C A AAG TAC T T C C A C CAA TTG ACT AAT TCT A C C 131 393 132 394 A s p Val A s p Pro S e r h s n Pro Tyr A l a Gly Ala LYS Thr h l a Gln H i s L ~ cly U GAT GTA C A C CCT TCC A A T CCT TAC GCA GGT G C A A A G ACC G C T CAI C A T rrc CCC 149 4 1 150 448 LY. MA TCC A A C CCA GTC TTT 501 161 168 502 Thr ser S e r S e r Gly Arg Val H l a Cln Thr A l a LYS Tyr V a l Val Ser S e r Leu ACC TCC ACC TCA COG AGA CTC chr C I A ACT ccc AAA r A c GTA GTT TCA TCT TTG 1 58 55 186 556 C l u Clu G l u Leu A m p 110 G l n Leu A s p Leu Gln I10 I l e Gln Glu Amn G l u Thr GAA GAA GAA CTT CAC ATT C I A c r T GAT c T r C I A ATT ATT C A A CAI AAT GAG A C C 203 609 S e r Oly A l s Aan S e x Lou Thr P r o A l a A s 9 S e r CYa Met Thr Tyr Ann G l y Asp T C C TGT ATG A C A T A C AAT GOT GAC 221 663 222 664 Leu cly A s p c l u Tyr Phe G l u A s n A l a Thr Leu P r o Tyr Leu Thr Asp 11- Lys CTT GGT GAC GAG T A C TTC GAA A A T GCC ACA CTA C C A TAT TTA ACT CAT ATC AAA 23 7 1 97 240 718 A s n A r g T r p net Lys Lys Asn Ser A a n Leu Asn Leu Thr Leu G l u H i s Asp Asp AAC AGA TCC ATG A M AAG A A C TCT AAC T T G A A T C T A ACT TTG GAG C A T G A T GAC 2 7 57 71 1 21 52 8 Ile Glu Leu Leu Val A s 9 Tr9 Cys Ala Phe C l u Thr Asn Val Lys Gly Ser S e r ATC GAA CTG TTG GTG G A C TGC r m GCC rTT GAA A C C AAT cTr MA GGT ACT r c A 215 825 276 826 A l a V a l Cy. A s p Leu Phe G l u A r g Asn A 8 p Leu Val A l a Tyr S e r Tyr Tyr A l a GCC GTT r c c GAT CTC TTT GAG CGC M T GAC T T G CTT c c r TAT TCC T A T TAC G C A 293 819 294 880 Amn Val A m Asn Phe Tyr A r g A r g Gly A l a Cly Aan Pro net S e r Ann Pro 11. AAT GTG AAT A A C r T c TAC AGO ACA GGG GCT CGT A A T C C T ATG r c c AAT CCA ArT 311 933 312 934 Gly S e r Val Leu Val A m n Ala Ser Tyr A s n Leu Leu Thr Gln A l s A s p G l u Leu ccr TCA GTG TTC GTC MC ccc T C T T A C A A T cTr TTG A C A CM GCT OAT GM rrc 329 981 33 9 8 08 A n 9 Aan LYE GAC AAC AAG Val T r p Leu S e r Phe S e r H i s Asp Thr A a p 11. G l n G l n Phe 11. m c TOG CTT TCA Trc TCT C A T G A C A C C GAT A T C C A A CAA TTC A m 347 1041 6 16 70 24 204 610 1042 348 GCC A C A C T C T Y r Il* A l a TYK A s n Tyr Cly Asp Leu Phe S*r A s p S e r A s n Pro Val Phe TAC ATT GCT TCA GOT GCA AAC r A c AAC T A C COG G A T r c c CTT CTG Trr ACC C C T CCA GAT ACT GAC Asp A a n GlY V a l Thr C l U T Y K Ser L8U A s p Gln V a l TCA CCC C T T CGT TTG A T C G A C A A C CGC G T C A C T G A G TAT T C T CTC GAT C A A GTT S*T A l I LOU GlY Leu 11. . 1149 383 TTC Phe Thr G l u Lya Leu Lys C y s Gly Asn A l a Ser T Y K V a l Arg Tyr I l e 11. Asn ACT GAA AAA TTG AAO TGT GGA AAT GCC T C T T A T CTT CGT TAT ATT A T C A A C 1203 401 1 402 204 A s p Val I l e 11. Pro V A l Pro Cly C y s Thr S e r Gly Pro Gly Phe S e r C y s Pro GAT GTG ATT ATT CCA GTT CCA GCT TGC A C C T c A G G T CCA CGG rTr TCC TOT CCT 1 42 15 91 420 iaso Glu A s p Phe Amp A S P Tyr 11. Thr Asn A r g L e u Asn Gly I l e A s p Tyr V a l A r c GAG OAC TTT CAC CAT TAC ATC A C A AAC ACA TTC A A T GGC ATT GAC TAT GTT 431 1311 11 35 80 4 13 438 12 Asp Phe G l n Aan 11. 10 36 9 55 Gln Cln L e u Sar Trp V a l Thr Pro Mat Cly Cly A r g 11. ATC CAC CAA C T A ACT TOG GTC A C G CCT ATG GGA GGT C G T A T C 10 366 96 GAT TTC C A A AAC 11. S e r S e r Cys Glu V a l C l n G l n Val S e r Asn Thr Thr C l u Leu Thr Phe Tyr Trp TCC ACT TGC CIA GTT C A A CAG crc r c T A A C A C C A C C CAI CTT ACT rrc r A c TGG 455 1365 1366 A s p Tyr Asn Glu GAC T A C A A T O M V a l G l u Tyz A m Cly P r o Val Ser Aen Lys * * * GTC GAG T A C AAC GOT CCC G T T ACT AAC AhG TAA G T C T C A T A C C G A 1422 1423 CTCTATTMCAGTCATTGAGTTCAAAGATGTTGGGCTTTTTTTTCCCCGACCCTGCTAAGCATTTCTAATAC 1494 1495 CCCATCTGAACCATCTTTTTTGTATACATGGAAGTTGAATATCCAAAAAAATCCCATTATTTCGTTCTTGAG 1566 CACTCGCCGAGTAOGCAGTTAcATGTATTGTGGccATAGTcTcTTGGTTcGTAcTTcA~~~AGTTAAAGAGc 000 00000 1638 456 1561 1639 TTTTTAAAGTTTATACCAAGAGGTCTGATATCGTTAATATCCAAGGAATTTACAGCATTGCTTCTTTCTCCG 1111 G 469 Translation of the K l P H 0 5 ORF would yield a 469 amino acid polypeptide, moderately hydrophilic, with a predicted molecular mass of 52522 Da and an isoelectric point of 4.17. A codon bias value of 0.23 was calculated (according to Bennetzen & Hall, 1982) which corresponds to a protein of low expression. When compared with the protein sequences available in the databases, the K l P H 0 5 product, KlPhoSp, exhibited a significant degree of similarity with ScPhoSp (39% identical amino acids, 18 % conservative substitutions) and ScPho3p of Sacch. cereuisiae (38 ‘/o identical amino acids, 18 % conservative substitutions) (Arima et al., 1983; Bajwa et al., 1984) and, to a lesser extent, with the Pholp of Schiz. pombe (Elliot et al., 1986) or P. pastoris (Payne et al., 1995). The consensus signature RHGXRXP, described by Piddington et al. (1993), is found between amino acids 76 and 82 in KlPhoSp. Hydropathy analysis of the product inferred from the PHO5 nucleotide sequence (Fig. 3), based on the calculations of Kyte & Doolittle (1982), revealed a predominantly hydrophilic polypetide with a hydrophobic N-terminal region. The extent of a putative signal sequence at the N-terminus was predicted following the proposal of von Heijne (1986). The most likely cleavage site would correspond to the peptide bond between Ala-16 and Ala-17, defining a signal segment of 16 amino acids sharing common structural features with known secretory signal sequences. Cleavage of this leader has been demonstrated, because the N-terminus of the mature protein identified by conventional amino acid sequence corresponds exactly to amino acids 17-31 relative to the initiation codon. The protein carries 10 potential sites for N-glycosylation and, similarly, 12 glycosylation sites are found in the Sacch. cereuisiae acid phosphatases (Arima et al., 1983; Bajwa et al., 1984). Currently we do not know whether all these acceptor sites bear oligosaccharide chains Nglycosidically attached to the asparagine residue, although Riederer 8c Hinnen (1991) have described that in Sacch. cereuisiae all 12 sequons are glycosylated. 1710 ....................................................................................................................................... Fig. 3. Nucleotide sequence of the K. Iactis KIPHOS gene region isolated from strain 2359/152. The sequence of one DNA strand and the deduced amino acid sequence for acid phosphatase are shown. Nucleotides are numbered from the 5’ end of the sequenced fragment to the 3‘ end. Amino acids are numbered from the first putative ATG in the large ORF. The peptides obtained from the protein sequence that were used for the oligodeoxyribonucleotide design are underlined. V, V, Positions of the major and minor transcription starts. The arrow represents the first amino acid of the mature protein. 0 , Potential N-glycosylation sites. In the 5’-flanking region, consensus TATA and CAAT elements are underlined. The putative sites for binding regulatory proteins (similar to those described for binding of PH04 and PH02 in Sacch. cerevisiae) are shown in bold letters. In the 3’-flanking region, sequences matching the consensus transcription termination signals are indicated by 0. 2620 Analysis of the KlPhoSp sequence Transcription of the KIPHOS gene Northern blotting using the 1500 bp BamHI-BglII fragment as probe revealed a single band of about 1.8 kb in RNA from K . lactis 2359/152 (see Fig. 5 ) . This observation suggests that in our conditions the BamHIBglII fragment does not include another transcriptional unit. KlPH0.5 transcription start sites were determined by extending a 32P-labelledsynthetic primer with reverse transcriptase following hybridization to poly(A)+RNA. T w o major and three minor cDNA products were obtained, indicating that the initiation of transcription preferentially takes place at the C and G residues -34 and -40 bases upstream from the predicted start of translation (Fig. 4). Three faint bands also appeared at -35, -46 and -53, taking ATG as position 1. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 + The acid phosphatase system of K . factis 5 ) , coinciding with maximum enzyme activity (see Fig. 1). No activity could be detected in cells grown in normal M M (lane 6). T o control the integrity of the RNA isolated under different conditions, the same blot was hybridized to a fragment containing the actin gene; the corresponding transcripts were visible at approximately equal intensities in all the gel lines. Expression of KIPHOS in Sacch. cerevisiae Fig, 4. Transcript mapping by primer extension. A synthetic oligonucleotide complementary to the sense strand of the KPHOS gene between +24 and +48 was labelled at the 5’end (lo5c.p.m., 0.125pmol) and annealed to 3.5 pg poly(A)+ RNA. The primer was then elongated with murine reverse transcriptase (Amersham) and the extended products (lane 2) were resolved on a sequencing gel alongside the sequencing ladder of the noncoding strand (lanes A, C, G, T) obtained using the same oligonucleotide as a primer. Lane 1, control (tRNA). ................................................................................................................................................. Fig. 5. Northern blot analysis of KIPH05 mRNA levels as a function of the derepression time. Total RNA was isolated from cells grown under derepression conditions in low-Pi medium (see Fig 1). Samples of 15 pg RNA taken after 0, 2, 4, 6 and 8 h (lanes 1, 2, 3, 4 and 5, respectively) and after 8 h in high-Pi medium (lane 6) were hybridized with a K I f H 0 5 fragment as probe (top) or with an ACT1 gene fragment (actin probe, bottom) kindly provided by M. Wesolowski-Louvel. Expression of KIPHOS during induction conditions We have shown that the production of acid phosphatase by K . lactis must be derepressed. We used a BamHI-BglII fragment of 1500 bp as probe in Northern blot analysis to measure the time course of PHO5 expression in lowPi medium (Fig. 5). Only one band appeared and this revealed a temporal pattern of expression similar to those described for Sacch. cerevisiae. As shown in Fig. 5 , PHO5 transcripts were absent when the cells were first shifted to the low-Pi medium (time 0) and expression of the P H 0 5 gene was first detected 4 h after the transfer to the low-Pi medium (lane 3). The amount of transcripts reached a maximum level between 6 and 8 h (lanes 4 and I f structural homology is indeed indicative of functional homology, the functional PHO5 homologue from K . lactis should be expressed in Sacch. cereuisiae. An HpaII-HpaII DNA fragment of 2-5 kb (see Table l), which contains the entire P H 0 5 gene, was cloned in pSKl (Bianchi et al., 1987) giving rise to pEF5 (Table 1). This plasmid, together with pSKl (as control), was used to transform the Sacch. cerevisiae strain ACX1-2A (ura3-25 leu2-112 trpl pho3 phos), selected by us after ascus digestion of a diploid strain derived from a cross between AH220 and TD29 (Lopez, 1989). The desired transformants were selected on the basis of their expected Ura+ phenotype. From an estimated 10 Ura+ transformants obtained with pSK1, none was rho+, as could be expected. Of 10 Ura+ transformants obtained with pEF.5, all were Pho+, indicating that the PHO5 gene from K . lactis was functionally expressed in Sacch. cerevisiae and thus complementing the phos mutation. Acid phosphatase activity was also repressible by orthophosphate. To confirm our results, plasmid segregation experiments were carried out as previously described (Sanchez et al., 1993). In all cases (50 transformants selected randomly), loss of the Ura+ character was accompanied by loss of the Pho+ character, confirming the functionality of the PHO5 gene of K . lactis in Sacch. cereuisiae. Mapping of the KIPHOS locus in several K. lactis strains In standard Sacch. cereuisiae strains several repressible and one constitutive acid phosphatase have been described to be located on different chromosomes (Steensma et al., 1989). T o see whether a multigene family of acid phosphatases scattered on different chromosomes also exists in K . lactis, the KlPHO.5 locus was mapped in the standard strain CBS2359 (Workshop Biology of Kluyueromyces I I , Rome, 1989). First, we examined Southern blots of yeast chromosomes separated by CHEF (Wesolowski-Louvel & Fukuhara, 1995) using the cloned KlPH05 as probe. Only one band (even after long autoradiographic exposures) located on chromosome I1 appeared (Fig. 6), indicating that either several (all?) acid phosphatases are located on this chromosome or that in K . lactis only one repressible acid p hosp hat ase exists. T o confirm these experiments, and since no repressible acid phosphatase could be detected in K . lactis strains 2360/7 and MD2/1, we performed Southern blot experiments using the same probe on genomic DNA Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2621 E. F E R M I N A N a n d A. D O M I N G U E Z 5.5 kb appeared in strain 2359/152. As no EcoRI restriction site was found in all 3555 bp extended HpaII-BamHI (-771 bp upstream of the ATG and 1377 bp after the TAA) fragments sequenced by us (not shown), we propose that this fragment encodes the repressible acid phosphatase. Thus, the only rational explanation for all our results is the existence of another constitutive acid phosphatase in the three K. factis strains analysed and also located on chromosome 11. DISCUSSION Fig. 6. CHEF gel and hybridization determining the location of KIPHO5 on the electrophoretic karyotype. (a) CHEF gel illustrating separation of chromosomes for strain 2359/152; chromosomes IV and 111 are not resolved. (b) An identical gel blotted and hybridized with the BamHI-Bglll fragment of KIPHOS as probe. ........................... ...................................................................................................................... Fig. 7. Southern blot analysis of the KIPHOS locus in three K. lactis strains. Genomic DNA prepared as described in Methods was digested with CIal (lanes 1, 4 and 7), BamHl (lanes 2, 5 and 8) or EcoRl (lanes 3, 6 and 9). After transfer to Hybond N membrane filters (Amersham), the DNA was probed with the BamHI-Bglll fragment. Size standards are indicated on the left. prepared as described in Methods (Fig. 7). The DNA was digested with ClaI (lanes 1 , 4 and 7), BamHI (lanes 2 , 5 and 8) or EcoRI (lanes 3 , 6 and 9). Surprisingly, the same fragments were recognized in all the strains with either ClaI or BamHI and only one extra fragment of 2622 Because of its distinctive physiological properties, K . lactis has become an important alternative to the classical Sacch. cereuisiae and we therefore decided to study the phosphate assimilation system in this yeast. Our first results showed that two strains used in many laboratories - K . lactis 2359/152 and K . lactis 2360/7 show different behaviour in low-Pi medium. No repressible acid phosphatase could be detected in strain 2360/7 while a repressible activity, which increased with incubation time in a similar way to the results described for Sacch. cereuisiae or Y . lipolytica (Bostian et al., 1980; Lopez & Dominguez, 1988), was found in strain 2359/152. The same results were obtained with strains CBS2359 and CBS2360 (unpublished results). Although several acid phosphatase genes have been isolated from yeasts and fungi (Arima et al., 1983; Bajwa et al., 1984; Elliot et al., 1986; Yang & Schweingruber, 1990; MacRae et af., 1988;Haas et a!., 1992;Piddington et a!., 1993) no significant homology has been detected between the proteins (Piddington et al., 1993). Thus, in order to clone the gene we decided to purify the protein. The purified protein gave a single smeared wide band on SDS-PAGE, similar to those described for acid phosphatases from other yeast and for yeast secretory glycoproteins in general. The molecular mass estimated by SDS-PAGE was 90-200 kDa. Treatment with Endo H produced a sharp band of 52kDa, again of comparable size to the deglycosylated band of the acid phosphatase of Sacch. cereuisiae (Bostian et al., 1980). Characteristics such as K , values, heat denaturation and isoelectric point were similar to those described for other yeast acid phosphatases. Additionally, the enzyme shows cross-reactivity with antibodies obtained against the protein moiety of the repressible acid phosphatase from Y . lipolytica (Dominguez et al., 1991), indicating that all these proteins share common epitopes. We obtained the sequences of the N-terminus and of an internal peptide, designed degenerate oligonucleotides, and isolated by PCR a DNA fragment that after sequencing was used as probe to isolate genomic clones from a mini yeast genomic DNA library. The sequences of selected clones identified a complete ORF and surrounding sequences. The ORF, designated KlPHO5, contains the original peptide sequences and encodes a protein, KlPhoSp, whose predicted size agrees well with its apparent size in SDS-polyacrylamide gel (469 aa, 52500 Da). The DNA sequence predicts a signal peptide of 16 amino acid with an Ala-Ala processing site. The Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 The acid phosphatase system of K . lactis next 15 amino acids - 17 to 31 - correspond exactly to those obtained after sequencing the N-terminal portion of the mature enzyme, indicating that the wild-type KlPhoSp is synthesized as a precursor that is proteolytically processed to produce the mature form as has been shown for Sacch. cerevisiae acid phosphatase (Haguenauer-Tsapis & Hinnen, 1984). The enzyme also has ten glycosylation sites. Comparison of the protein sequence with the ScPhoSp shows that the best alignment was found in .the four C-terminal glycosylation sites. This observation supports the conclusion of Riederer & Hinnen (1991) that the oligosaccharides found at the C-terminus have the most prominent influence on protein folding. KlPhoSp shows strong similarity with ScPho5p and ScPho3p and, to a lesser extent, with SpPholp and PpPhol. Our results are in agreement with the evolutionary relationship described for Sacch. cerevisiae and K . lactis (Barns et al., 1991). In KlPhoSp, the consensus signature RHGXRXP, described by Piddington et al. (1993) for all - E. coli, yeast, fungal, rat and human - acid phospatases, is found between amino acids 76 and 82. Currently, sitespecific mutagenesis is being carried out to confirm this aspect. The signals for translation, transcription, termination and polyadenylation agree with the consensus for yeast motifs in general (Cigan & Donahue, 1987; Kozak, 1987; Zaret & Sherman, 1982). Transcription of KlPHO5 is strongly regulated in response to the level of inorganic phosphate. By primer extension in the promoter we identified five specific initiation sites. All of them bear the consensus motif RRYRR (R = purine; Y = pyrimidine) or TC(G/A)A described by Hahn et al. (1985). Furthermore, two of them are major transcription initiation sites and lie between 55 and 110 bp downstream of the functional TATA element, as has been described by Rudolph & Hinnen (1987) for Sacch. cerevisiae. Rudolph & Hinnen (1987) have described regulatory regions in the Sacch. cerevisiae PHO5 promoter that act as phosphate-controlled upstream activation sites (UASps). Two of them [CACGT(G/T)] are also found in the 5’ flanking region of the K l P H 0 5 promoter. Our previous results (unpublished) support the idea that those regions are in fact the binding site for the regulatory protein Pho4, in agreement with the results described for Sacch. cerevisiae by Rudolph & Hinnen (1987) but in contrast with those reported for the same yeast by Bergman et al. (1986) or for the Penicillium chrysogenum phoA gene by Haas et al. (1992). In Sacch. cerevisiae it has been described that Pho2 binds to a region located between the two UASs. We located a region in the KlPH05 promoter with a symmetrical axis (see Results) and are now carrying out experiments to explore the possible role of this region. We cloned a 2.5 kb fragment of K . lactis DNA containing the whole K l P H 0 5 gene and the promoter region (-771 bp upstream of the ATG) in an autonomous plasmid, pSK1, able to function as a shuttle vector between K . lactis and Sacch. cerevisiae. After transforming a strain of Sacch. cerevisiae lacking repressible acid phosphatase activity we observed the recovery of this activity. Also, the acid phosphatase activity is regulated by the amount of Pi in the culture medium (repressed in normal MM and derepressed in low-Pi medium). Our results indicate that the PHO5 gene from K . lactis is functionally expressed in Sacch. cerevisiae and that in the K l P H 0 5 promoter there are regulatory elements that respond to the regulatory proteins Pho4 and Pho2. Identification of the physical location of the K l P H 0 5 gene has allowed us to examine the organization of the acid phosphatase gene family in K . lactis. Using chromosomal hybridization we mapped the KlPHO5 gene on chromosome I1 of strain CBS2359. In contrast with the results described for Sacch. cerevisiae (Steensma et al., 1989), we were unable to find any other signal. A similar result was obtained with strain CBS2360 (not shown). However, after Southern blot experiments we found differences between the two strains. With ClaI and BamHI the same bands appeared, whilst with EcoRI a different pattern emerged. In view of our results - derepression conditions, gene sequencing, chromosome mapping and Southern blotting - we believe that strain 2360/7 has only one acid phosphatase, located on chromosome 11. Strain 2359/ 152 has a constitutive and a repressible acid phosphatase, both also located on chromosome 11. We know that the constitutive acid phosphatase is either located distant from the K l P H 0 5 gene, towards the 3’ region (we have sequenced a further 6 kb) or upstream of the promoter. This is therefore opposite to the results described for Sacch. cerevisiae (Bajwa et al., 1987). Experiments to isolate the constitutive KlPHO gene are currently under way in our laboratory. ACKNOWLEDGEMENTS We wish t o thank H. Fukhuara and M. Wesolowski-Louvel for providing K . lactis strains and plasmids This work was partially supported by grants from the CICYT (BIO 92-0304 and BIO 95-0518) and EU (BI04-CT96-0003). REFERENCES Arima, K., Oshima, T., Kubota, I., Nakamura, N., Mizunaga, T. & Toh-e, A. (1983). The nucleotide sequence of the yeast PHO5 gene : a putative precursor of repressible acid phosphatase contains a signal peptide. Nucleic Acids Res 11, 1657-1673. Babczinski, R. (1980). Partial purification, characterization and localization of the membrane associated invertase of yeast. Biochim Biophys Acta 614, 121-127. Bajwa, W., Meyhack, B., Rudolph, H., Schweingruber, A. M. & Hinnen, A. (1984). Structural analysis of the two tandemly repeated acid phosphatase genes in yeast. Nucleic Acids Res 12, 7722-7738. Barns, 5. M., Lane, D. J., Sogin, M. L., Bibeau, C. & Weisburg, W. G. (1991). Evolutionary relationships among pathogenic Candida species and relatives. J Bacteriol 173, 2250-2255. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2623 E. F E R M I N A N a n d A. D O M I N G U E Z Becker, D. M. & Guarente, L. (1991). High efficiency transform- Mayaux, 1. F. (1991). Stable multicopy vectors for high-level ation of yeast by electroporation. In Methods Enzymol 194, 182-187. secretion of recombinant human serum albumin by Kluyveromyces yeasts. Biotechnology 9, 968-975. Bennetzen, J. L. & Hall, B. D. (1982). Codon selection in yeast. J Goffrini, P., Algeri, A. A., Donnini, C., Wesolowski-Louvel, M. & Ferrero, 1. (1989). RAG1 and RAG2 : nuclear genes involved in the Biol Chem 257, 3026-3031. Bergman, L. W., McClinton, D. C., Madden, 5. L. & Preiss, L. H. (1986). Molecular analysis of the DNA sequences involved in the transcriptional regulation of the phosphate-repressible acid phos- phatase gene ( P H O 5 ) of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 83, 607045074. Bianchi, M. M., Falcone, C., Chen, X. J., Wesolowski-Louvel, M., Frontali, L. & Fukuhara, H. (1987). Transformation of the yeast Kluyveromyces lactis by new vectors derived from the 1.6 pm circular plasmid pkD1. Curr Genet 12, 185-192. Biggin, M. D., Gibson, T. 1. & Hong, G. F. (1983). Buffer gradient gels and ‘3*5S label as an aid to rapid DNA sequence termination. Proc Natl Acad Sci USA 80,3963-3965. Bostian, K. A., Lemire, 1. A., Cannon, L. E. & Halvorson, H. 0. (1980). In vitro synthesis of repressible acid phosphatase: identification of multiple mRNAs and products. Proc Natl Acad Sci USA 77,4504-4508. Boyer, H. & Roulland-Dussoix, D. (1969). A complementary analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol41,459-472. Breathnach, R. & Chambon, P. (1981). Organization and expression of eukaryotic split genes coding for proteins. Annu Rev Biochem 50, 349-383. Buckholz, R. G. & Gleeson, A. G. M. (1991). Yeast systems for the commercial production of heterologous proteins. Biotechnology 9, 1067-1072. Chen, X. J., Wesolowski-Louvel, M., Tanguy-Rougeau, C., Fukuhara, H., Bianchi, M. M., Fabiani, L., Saliola, M., Falcone, C. & Frontali, L. (1988). A gene cloning system for Kluyveromyces lactis and isolation of a chromosomal gene required for killer production. J Basic Microbiol28, 211-220. Cigan, A. M. & Donahue, P. (1987). Sequence and structural features associated with translational initiator regions in yeast - a review. Gene 59, 1-18. Dimond, R. L., Knecht, D. A., Jordan, K. B., Burns, R. A. & Livi, G. P. (1983). Secretory mutants in the cellular slime mold Dictyo- stelium discoideum. Methods Enzymol96, 815-826. Domlnguez, A., Lbpez, M. C., Santos, B. & Rodriguez, C. (1991). Purification, glycosylation and secretion of a repressible acid dependence/independence on mitochondria1 regulatory functions for the growth on sugars. Yeast 5, 99-106. Haas, J., Redl, B., Friedlin, E. & Stoffler, G. (1992). Isolation and analysis of the Penicillium chrysogenum p h o A gene encoding a secreted phosphate-repressible acid phosphatase. Gene 113, 129-133. Haguenauer-Tsapis, R. & Hinnen, A. (1984). A deletion that includes the signal peptidase cleavage site impairs processing, glycosylation, and secretion of cell surface yeast acid phosphatase. Mol Cell Biol4, 2668-2675. Hahn, S., Hoar, E. T. & Guarente, L. (1985). Each of the three TATA elements specifies a subset of the transcription initiation sites at the C Y C l promoter of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 82, 8562-8566. Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-580. von Heijne, G. (1986). A new method for predicting signal sequence cleavage sites. Nucleic Acids Res 14, 4683-4690. Henikoff; S. (1987). Unidirectional digestion with exonuclease 111 in DNA sequence analysis. Methods Enzymol 155, 156-165. Higgins, D. G. & Sharp, P. M. (1988). CLUSTAL: a package for performing multiple sequence alignments o n a microcomputer. Gene 73,237-244. Hinnen, A., Meyhack, B. & Heim, 1. (1989). Heterologous gene expression in yeast. In Yeast Genetic Engineering, pp. 193-213. Edited by P. J. Barr, A. J. Brake & P. Valenzuela. Boston: Butterworths. Johnston, M. & Carlson, M. (1992). Regulation of carbon and phosphate utilization. In T h e Molecular and Cellular Biology of the Yeast Sacchavomyces :Gene Expression, pp. 193-281. Edited by J. N. Strathern, E. W. Jones & J. R. Broach. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Kim, S., Mellor, J., Kingsman, A. 1. & Kingsman, 5. M. (1986). Multiple control element in the T R P l promoter of Saccharomyces cerevisiae. Mol Cell Biol 6, 42514258. Kozak, M. (1987). An analysis of 5’-noncoding sequences from 699 vertebrate mRNAs. Nucleic Acids Res 15, 8125-8148. phosphatase of Yarrowia lipolytica. In Protein Glycosylation : Cellular, Biotechnological and Analytical Aspects (GBS Monographs vol. 15),pp. 117-124. Edited by H. s. Conradt. Weinheim, New York & Cambridge: VCH. Kyte, 1. & Doolittle, R. F. (1982). A simple method for displaying the hydropathy of a protein. J M o l Biol 157, 105-132. Dubois, N. K., Gilles, K., Hamilton, 1. L., Rebers, P. A. & Smith, F. (1956). Colorimetric method for determination of sugars and L6pez. M. C. (1989). Purificacion y caracterizacion de una fosfatasa acida repremible de Yarrowia lipollytica. Estudio del procesamiento y aislamiento de una secuencia genica. PhD thesis, . University of Salamanca. L6pez, M. C. & Domlnguez, A. (1988). Purification and properties of a glycoprotein acid phosphatase from the yeast form of Yarrowia lipolytica. J Basic Microbiol28, 249-263. related substances. Anal Chem 28, 350-356. Elliott, S., Chang, C., Schweingruber, M. E., Schaller, J., Rickli, E. E. & Carbon, 1. (1986). Isolation and characterization of the structural gene for secreted acid phosphatase from Schizosacchavomyces pombe. J Biol Chem 261, 2936-2941. Erickson, P. F., Minier, L. N. & Lasher, R. 5. (1982). Quantitative electrophoretic transfer of polypeptides from SDS polyacrylamide gels to nitrocellulose sheets: a method for their re-use in immunoradiographic detection of antigens. J Zmmunol Methods 51, 241-249. Fleer, R., Yeh, P., Amellal, N., Maury, I., Fournier, A., Bacchetta, F., Baduel, P., lung, G., L‘Hote, H., Becquart, J., Fukuhara, H. & 2624 Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. MacRae, W. D., Buxton, F. P., Sibley, S., Garven, S., Gwynne, D. I., Davies, R. W. & Arst, H. N. (1988). A phosphate-repressible acid phosphatase gene from Aspergillus niger : its cloning, sequencing and transcriptional analysis. Gene 71, 339-348. Meissner, P. S., Sisk, W. P. & Berman, M. L. (1987). Bacteriophage cloning system for the construction of directional cDNA libraries. Proc Natl Acad Sci U S A 84,41714175. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 The acid phosphatase system of K . lactis Mizunaga, T. (1979). Some properties of phosphatase-repressible and constitutive acid phosphatases of baker’s yeast. Agric Biol Chem 43, 1211-1218. Moreno, S., Sanchez, Y. & Rodrlguez, L. (1990). Purification and characterization of the invertase from Schizosaccharomyces pombe. Biochem J 267, 697-702. Morrissey, J. M. (1981). Silver stain for proteins in polyacrylamide gels : a modified procedure with enhanced uniform sensitivity. Anal Biochem 117, 307-310. Oshima, Y. (1982). Regulatory circuits for gene expression : the metabolism of galactose and phosphate. In The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, pp. 159-180. Edited by J. N. Strathern, E. W. Jones & J. R. Broach. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Payne, W. E., Cannon, P. M. & Kaiser, C. A. (1995). An inducible acid phosphatase from the yeast Pichia pastoris : characterization of the gene and its product. Gene 163, 19-26. Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proc Natl Acd Sci USA 85, 2444-2448. Percival-Smith,A. & Segall, J. (1984). Isolation of DNA sequences preferentially expressed during sporulation in Saccharomyces cerevisiae. Mol Cell Biol 6, 2443-2451. Piddington, C. S., Houston, C. S., Paloheimo, M., Cantrell, M., Miettinen-Oinonen, A,, Nevalainen, H. & Rambosek, J. (1993). The cloning and sequencing of the genes encoding phytase (phy) and pH 2.5-optimum acid phosphatase (aph) from Aspergillus niger var. awamori. Gene 133, 55-62. Raeder, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1, 17-20. Riederer, M. A. & Hinnen, A. (1991). Removal of N-glycosylation sites of the yeast acid phosphatase severely affects protein folding. J Bacteriol 173, 3539-3546. Rudolph, H. & Hinnen, A. (1987). The yeast PHOS promoter: phosphate-control elements and sequences mediating mRNA start site selection. Proc Natl Acad Sci USA 84, 1340-1344. Sambrook, 1. E., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sanchez, M., Iglesias, F. J., Santamarb, C. & Domlnguez, A. (1993). Transformation of Kluyveromyces lactis by electro- poration. Appl Environ Microbiol 59, 2087-2092. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467. Schurr, A. 81Yagil, E. (1971). Regulation and characterization of acid and alkaline phosphatase in yeast. J Gen Microbiol 65, 29 1-303. Schweingruber, M. E. (1987). Acid and alkaline phosphatases in yeast. Adv Protein Phosphatases 4,77-93. Sherman, F., Fink, G. R. & Lawrence, C. (1977). Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Lab- oratory. Steensma, H. Y. de, Jonge, P. de, Kaptein, A. & Kaback, D. B. (1989). Molecular cloning of chromosome I DNA from Saccharomyces cerevisiae : localization of a repeated sequence containing an acid phosphatase gene near a telomere of chromosome I and chromosome VIII. Curr Genet 16, 131-137. Swinkels, B. W., van Ooyen, A. J. J. & Bonekamp, F. J. (1993). The yeast Kluyveromyces lactis as an efficient host for heterologous gene expression. Antonie Leeuwenhoek 64, 187-201. Towbin, H., Staehelin, T. 81 Gordon, 1. (1979). Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets :procedure and some applications. Proc Natl Acad Sci USA 76,4350-4354. Vogel, K. & Hinnen, A. (1990). The yeast phosphatase system. Mol Microbiol 4, 2013-2017. Vogel, K., HWz, W. & Hinnen, A. (1989). The two positively acting regulatory proteins Pho2 and Pho4 physically interact with P H 0 5 upstream activation regions. Mol Cell Biol9, 2050-2057. Wesolowski-Louvel, M. 81 Fukuhara, H. (1995). A map of Kluyveromyces lactis genome. Yeast 11, 21 1-218. Wickerham, L. J. (1946). A critical evaluation of the nitrogen assimilation tests commonly used in the classification of yeast. ] Bacteriol 52, 293-301. Yang, 1. 8t Schweingruber, E. (1990). The structural gene coding for thiamine-repressible acid phosphatase in Schizosaccharomyces pombe. Curr Genet 18,269-272. Zaret, K. S. & Sherman, F. (1982). DNA sequence required for efficient transcription termination in yeast. Cell 28, 265-273. Received 19 February 1997; revised 17 April 1997; accepted 18 April 1997. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 23:52:14 2625