Download Development of an internally controlled real-time PCR

ORIGINAL ARTICLE
10.1111/j.1469-0691.2006.01417.x
Development of an internally controlled real-time PCR assay for detection
of Chlamydophila psittaci in the LightCycler 2.0 system
E. R. Heddema1, M. G. H. M. Beld2, B. de Wever1, A. A. J. Langerak1, Y. Pannekoek1 and B. Duim1
1
Department of Medical Microbiology and 2Department of Clinical Virology, Academic Medical
Centre, University of Amsterdam, Amsterdam, The Netherlands
ABSTRACT
A real-time PCR assay with a DNA purification and inhibition control (internal control; IC) was
developed to detect Chlamydophila psittaci DNA in human clinical samples. Novel C. psittaci-specific
primers targeting the ompA gene were developed. The IC DNA contained the same primer-binding sites
and had the same length and nucleotide content as the C. psittaci DNA amplicon, but had a shuffled
probe-binding region. The lower limit of detection was 80 target copies ⁄ PCR, corresponding to
6250 copies ⁄ mL in a clinical sample. Specificity was tested using reference strains of 30 bacterial species.
No amplification was observed from any of these samples. Respiratory samples from eight patients were
positive with this PCR. Six of these patients were confirmed as positive for C. psittaci with serological
testing. Two patients had increasing antibody titres, but did not fulfil criteria proposed previously for
serologically proven Chlamydia spp. infection. The real-time PCR described in this paper is a sensitive,
specific and rapid method to detect C. psittaci DNA in human clinical respiratory samples.
Keywords
Chlamydophila psittaci, diagnosis, inhibition control, PCR, psittacosis, respiratory samples
Original Submission: 19 May 2005;
Revised Submission: 9 September 2005;
Accepted: 5 November 2005
Clin Microbiol Infect 2006; 12: 571–575
INTRODUCTION
Chlamydophila psittaci (formerly Chlamydia psittaci)
is an obligate intracellular microorganism that
causes psittacosis in humans. Psittacosis is characterised by fever, chills, headache, dyspnoea and
cough [1]. The chest X-ray often shows an infiltrate.
The disease is acquired through contact with
infected birds, bird droppings or feather dust [2].
In 2003, 15 and 27 cases were reported in the USA
and The Netherlands, respectively [3,4]. The diagnosis of C. psittaci infection can be made by culture,
serology or DNA detection. Culture is time-consuming and requires extensive safety precautions.
Laboratory-associated infections are well-known
[5], and C. psittaci should therefore be handled
under Biosafety Level 3 conditions [6]. The reference standard for diagnosing psittacosis is the
measurement of a four-fold increase in serum
antibodies using microimmunofluorescence [2],
although this test does not appear to be as
species-specific as claimed by the manufacturer
[2,7]. Furthermore, the test is difficult to interpret
and needs convalescent sera. Most often, serological testing provides only a retrospective diagnosis.
A diagnostic PCR has the potential to overcome
the above problems and, in addition, can help
clinicians to target antibiotic treatment and to
expedite outbreak management. Although PCR
assays that detect C. psittaci have been described
previously, they have lacked an internal control
(IC) to monitor DNA purification and possible
inhibition of the amplification reaction, and were
not developed for a real-time PCR format [8–10].
The need for a real-time assay to detect C. psittaci
in humans has been emphasised previously [11].
Therefore, the present study aimed to develop a
real-time PCR assay with an IC to detect C. psittaci
in clinical samples.
MATERIALS AND METHODS
Corresponding author and reprint requests: E. R. Heddema,
Academic Medical Centre, Department of Medical Microbiology, Room L1-245, PO Box 22660, 1100 DD Amsterdam, The
Netherlands
E-mail: [email protected]
Respiratory specimens
Eight respiratory specimens (four sputum, one bronchoalveolar lavage (BAL) fluid, three throat swabs) from eight individuals were investigated. The BAL fluid from one of these eight
2006 Copyright by the European Society of Clinical Microbiology and Infectious Diseases
572 Clinical Microbiology and Infection, Volume 12 Number 6, June 2006
patients had already been shown to be positive for C. psittaci
DNA in a PCR assay conducted elsewhere [11]. Ten respiratory specimens (six throat washes and four sputum specimens)
from ten patients with respiratory infections caused by other
(non-chlamydial) bacteria or viruses were also tested: respiratory syncytial virus (n = 2); parainfluenza virus (n = 3);
enterovirus (n = 1); Staphylococcus aureus (n = 1); Enterobacter
cloacae (n = 1); and Haemophilus influenzae (n = 2). These pathogens were detected by standard culture procedures or direct
immunofluorescence. As pigeons represent one of the main
reservoirs of C. psittaci, a pigeon breeder provided nine nose
swabs obtained from nine pigeons with nasal discharge that
was possibly caused by C. psittaci infection.
bacterial lysis buffer (10 mM Tris-HCl, pH 8.3, 1 mM EDTA
(TE buffer) containing SDS 1% w ⁄ v, Tween-20 5% v ⁄ v,
sarkosyl 5% w ⁄ v). Thorough mixing and liquefaction was
performed in 50-mL sterile tubes containing c. 20 washed
and autoclaved glass beads (Emergo, Landsmeer, The
Netherlands). After mixing, the tubes were incubated at room
temperature for ‡ 30 min. Once liquefied, 190 lL of sputum
and 10 lL (c. 80 copies ⁄ PCR) of IC solution (see below) was
subjected to Boom extraction [14]. The pigeon and human
throat swabs, 200 lL of the human throat washes or BAL fluid,
or 100 lL of the bacterial suspensions, were suspended
directly in 900 lL of L6 lysis buffer [14] without pre-treatment.
DNA was eluted in 100 lL of TE.
Bacterial strains
Primers and probes
Thirty ATCC or quality control assessment strains, including
related members of the Chlamydiaceae, were used for specificity
experiments (Table 1). Escherichia coli (E. coli One shot; Invitrogen, Breda, The Netherlands) cells were used for propagation of
cloned plasmid constructs. Genomic C. psittaci DNA was
purified from the C. psittaci Orni strain, isolated from a human
case of psittacosis [12,13], and was used for construction of a
C. psittaci DNA control. C. psittaci 6BC (ATCC VR-125),
Chlamydophila abortus (C18 ⁄ 98), Chlamydophila felis (02DC0026)
and Chlamydophila caviae (GPIC strain) (kindly provided by
D. Vanrompay, Ghent University, Belgium) were also tested.
Primers were designed to amplify a conserved region of the
C. psittaci ompA gene. All known C. psittaci ompA gene
sequences present in the GenBank database were included in
this design. The primers used for amplification were CPsittF
(5¢-CGCTCTCTCCTTACAAGCC; nucleotide (nt) 411–429) and
CPsittR (5¢-AGCACCTTCCCACATAGTG; nt 474–492). Nucleotide numbering was derived from the C. psittaci 6BC ompA
gene (GeneBank accession number X56980). The TaqMan probes
used for detection of the C. psittaci and IC amplicons were,
respectively, CPsitt Probe (5¢-FAM-AGGGAACCCAGCTGAACCAAGTTT-TAMRA) (Isogen Bioscience, Maarsen,
The Netherlands) and CPsitt IC Probe (5¢-VIC-TCGAGACAGTGCAACGTAAGCCTA-TAMRA) (PE Applied Biosystems, Warrington, UK). This primer pair amplifies an 82-bp
DNA fragment of the C. psittaci ompA gene, as well as the IC,
which has the same length and nucleotide content as the
C. psittaci DNA amplicon, but a shuffled probe-binding region.
DNA extraction
Sputum samples (eight volumes) were first diluted with 0.1
volume acetylcysteine solution (50 mg ⁄ mL) and 0.1 volume
Table 1. Bacterial species used for specificity testing in the
Chlamydophila psittaci PCR
Species
Source
Haemophilus influenzae
Pseudomonas aeruginosa
Staphylococcus aureus
Streptococcus agalactiae
Neisseria meningitidis
Streptococcus pneumoniae
Burkholderia cepacia
Chlamydia trachomatis L2
Chlamydophila pneumoniae AR39
C. pneumoniae CWL 029
C. pneumoniae TW-183
Mycoplasma pneumoniae
Enterobacter cloacae
Proteus vulgaris
Escherichia coli
Streptocococcus pyogenes
Fusobacterium varium
Corynebacterium ulcerans
Neisseria gonorrhoea
Stomatococcus mucilaginosus
Arcanobacterium haemolyticum
Rhodococcus equi
Bordetella pertussis
Klebsiella pneumoniae
Legionella pneumophila
Moraxella catarrhalis
Chlamydophila pecorum
C. trachomatis serovar D
C. trachomatis serovar E
C. trachomatis serovar F
ATCC 49247
ATCC 27853
ATCC 29213
ATCC 624
ATCC 13090
ATCC 49619
ATCC 25416
ATCC VR 902b
ATCC 53592
ATCC VR-1310
ATCC VR-2282
ATCC 15492
ATCC 700323
ATCC 6380
ATCC 35218
QC
QC
QC
QC
QC
QC
QC
QC
QC
QC
QC
E58a
IC-CAL-8a
DK-20a
MRC-301a
Construction of the C. psittaci DNA control
C. psittaci DNA was purified from the C. psittaci Orni strain
and an amplicon was generated using the CPsitt primer pair.
The amplicon was cloned into PCR 2.1 plasmid DNA (Invitrogen) to create pPsittWT, which was then propagated in
E. coli and purified using the Wizard Plus Miniprep isolation
kit (Promega, Leiden, The Netherlands). The sequence of the
DNA insert in pPsittWT was checked by dideoxynucleotide
sequencing (BigDye Terminator v.1.1; PE Applied Biosystems).
The concentration and purity of the isolated plasmid construct
were measured with a spectrophotometer at 260 and 280 nm,
respectively, and the construct was then stored in TE at 20C.
Construction of the internal control
The IC was constructed using two oligonucleotides: IC-CPsitt1 (5¢-CGCTCTCTCCTTACAAGCCTTGCCTGTTCGAGACAGTGCAACGTAAGCCTA) and IC-CPsitt-2 (5¢-AGCACCTTCCCACATAGTGCCATCGATTAATTAGGCTTACGTTGCACTGTCTCGA) as described previously [15]. This amplicon was
cloned into PCR 2.1 plasmid DNA, which was then propagated in E. coli. DNA sequence analysis, purification, quantification and storage of the IC plasmids were performed as
described above.
Dilution series of pPsittWT and IC
a
Previously studied and characterised by Meijer et al. [12].
ATCC, American Type Culture Collection; QC, Dutch or UK quality control
assessment strains.
Serial dilutions of pPsittWT and IC were prepared in a
stabilising lysis buffer (5.25 M GuSCN, 50 mM Tris-HCl,
2006 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 12, 571–575
Heddema et al. Real-time PCR for Chlamydophila psittaci 573
pH 6.4, 20 mM EDTA) supplemented with calf thymus DNA
20 ng ⁄ lL, and were then stored at ) 20C. Extraction of the
dilution series, corresponding to 80, 40, 20 and 10 copies ⁄ PCR,
was performed six times, in a background of 190 lL of
C. psittaci DNA-negative pooled and liquefied sputum by the
Boom procedure [14].
Real-time PCR assay
Reactions were performed in the LightCycler 2.0 system (Roche
Diagnostics, Penzberg, Germany) using two TaqMan probes.
The final reaction volume (20 lL) contained 8 lL of eluate, 2 lL
of 10· LightCycler Faststart DNA Master Hybridisation Probes
Mix (Roche Diagnostics), 0.2 U of uracil-N-glycosylase (PE
Applied Biosystems) and final concentrations of 0.3 lM each
probe, 0.7 lM each primer and 4.5 mM MgCl2. The real-time
PCR steps comprised 50C for 10 min, 95C for 10 min, 49 cycles
of 95C for 10 s, 62C for 5 s and 72C for 10 s, and finally, 30C
for 30 s. Fluorescence values for the FAM and VIC probe signal,
used for detection of C. psittaci DNA or IC, were detected in
channel 530 and 560, respectively. A colour compensation file
was used, according to the manufacturer’s instructions, to
prevent crosstalk of the two fluorescent probe signals.
Serological diagnosis
An ELISA (Chlamydia IgG ⁄ A ⁄ M rELISA; Medac Diagnostika,
Hamburg, Germany) was used for the serological diagnosis of
C. psittaci infections. Serological diagnosis in acute-phase and
convalescent sera is usually based on a three-fold rise in the
Chlamydia IgG titre, a two-fold or greater change in the IgM
titre, or a two-fold increase in the IgG titre in combination with
a two-fold increase in the IgA titre [10,17].
RESULTS
Optimisation of the real-time PCR for use with
the TaqMan probes
During the LightCycler assay, an accumulation of
amplicon is indicated by an increase in fluorescence emitted by the FAM-reporter dye after
hydrolysis of the TaqMan probe. Initially, electrophoresis analysis of the amplicons indicated quantities that were disproportionately greater than the
fluorescence signal detected (data not shown).
However, changing the temperature transition rate
from 20C ⁄ s to 1C ⁄ s during the annealing step
allowed optimal binding of the TaqMan probes and
adequate fluorescence signals, as shown by the
lower limit of detection (see below).
Determination of the lower limit of detection
of the C. psittaci real-time PCR
In a background of C. psittaci-negative pooled
sputum, it was possible to detect 80 copies ⁄ PCR
of pPsittWT or IC (Table 2). The lowest detection
limit for pPsittWT and IC was ten copies ⁄ PCR
(1 ⁄ 6 and 3 ⁄ 6 experiments positive, respectively).
In the presence of 80 copies of IC, 80 copies of
pPsittWT were always detected. This suggests
that there is no significant competition between
pPsittWT and IC when ‡ 80 copies of pPsittWT
are present in a clinical sample (data not shown).
Detection of 80 copies ⁄ PCR corresponds to a
minimum sensitivity of 6250 copies ⁄ mL in a
sputum sample.
Specificity of the real-time PCR assay
No amplification was observed when DNA of 30
bacterial species, including related members of
the Chlamydiaceae (Table 1), was tested in the
PCR. All IC signals were positive. Although this
PCR was not developed as a quantitative test, the
mean Ct (crossing point) value for the IC signal
with these samples was 34.1 (SD 1.3) cycles. DNA
from the avian type strain C. psittaci 6BC (ATCC
VR-125), C. abortus (C18 ⁄ 98), C. felis (02DC0026)
and C. caviae (GPIC strain) was amplified, as
expected based on sequence homology [16].
Respiratory specimens
Four sputa, one BAL fluid and three throat swabs,
tested in six separate runs, were positive by realtime PCR (mean Ct values of 27.2–35.9 cycles,
SD 0.3–1.5). There was no clear association between the Ct values obtained and the different
respiratory samples. Six of the eight cases were
confirmed serologically by ELISA; of the two
remaining cases, one had positive IgA and IgM
titres that did not change, and a two-fold rise in
IgG serum antibodies, while the other had a twofold rise in IgA, together with increasing, but not
doubled, serum IgG. Three of the nine pigeon
Table 2. Lower limit of detection of the PCR assay for
pPsittWT, internal control (IC) and pPsittWT plus IC
Copies ⁄ PCR
pPsittWTa
ICa
pPsittWT with
80 copies of ICa
80b
40
20
10
0
6⁄6
4⁄6
2⁄6
1⁄6
0⁄2
6⁄6
3⁄6
2⁄6
3⁄6
0⁄2
6⁄6
2⁄6
1⁄6
0⁄6
0⁄2
a
Data shown indicate the number of positive samples vs. the number of samples
tested.
b
For all the copy numbers presented, 100% extraction and PCR efficiency was
assumed.
2006 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 12, 571–575
574 Clinical Microbiology and Infection, Volume 12 Number 6, June 2006
nasal swabs were positive for C. psittaci. The ten
respiratory samples from patients with other
respiratory infections were negative. All PCRnegative samples were IC-positive.
DISCUSSION
The real-time PCR described in the present study
appears to be a sensitive and specific format for
diagnosing psittacosis. This is the first report of an
internally controlled real-time PCR assay to detect
C. psittaci DNA in the LightCycler 2.0 system
using two TaqMan probes. The IC monitored the
process of nucleic acid purification and amplification for each individual sample. After liquefaction of sputum samples and subsequent Boom
extraction, it was possible to reliably detect
80 copies ⁄ PCR of pPsittWT or IC. The specificity
of the real-time PCR assay was confirmed with a
set of bacterial species, including related members
of the Chlamydiaceae, and with respiratory samples from patients with evidence of other respiratory infections.
In the recently revised taxonomic classification,
C. psittaci has been subdivided into four
Chlamydophila spp., namely C. abortus, C. psittaci,
C. felis and C. caviae [16,19]. This classification
included newly available sequence data and
showed the relatedness of Chlamydophila spp.
from typical hosts (e.g., cats, birds and guineapigs). The new classification is based mainly on
minor sequence differences in the 16S rRNA gene,
23S rRNA gene and internal ribosomal spacer
region [16]. The C. psittaci primers and probes
designed during the present study also amplified
and detected these other three species, but
because of sequence homology in the ompA gene,
it was not possible to design primers that could
distinguish these four species in a LightCycler
assay. However, for clinical purposes, this is not
important, since all four are considered to be
potentially infectious for humans [20,21]. If
required, sequence analysis of the ompA gene
can be performed for strain or serovar speciation
[22].
The incidence of confirmed cases of psittacosis
is low [3,4], but may be underestimated, as
accurate methods for the diagnosis of psittacosis
are not always available. In addition, many
patients with this disease are unable to produce
sputum and receive broad-spectrum antibiotic
treatment without invasive sampling. Therefore,
the number of samples available for clinical
evaluation of the PCR was limited. In the present
study, C. psittaci DNA was detected in eight
respiratory samples obtained from eight patients
(c. 30% (8 ⁄ 27) of the annual reported cases in The
Netherlands) [3]. One of these samples had been
shown previously to be PCR-positive with a
different primer set [8,11], and six cases were
confirmed serologically (the two remaining cases
showed increasing titres only of specific IgG).
In general, serological tests for the diagnosis of
C. psittaci infection are hampered by lack of
sensitivity and specificity (genus and ⁄ or species)
and poor reproducibility [7,23–25]. The two PCRpositive, but serologically negative, cases in the
present study highlight this problem. A PCR
false-positive result is unlikely, as the specificity
of the assay was confirmed, but it is always
difficult to validate a newly developed PCR
against a poor reference standard. Although the
positive pigeon samples were not tested against a
recognised standard method, these samples were
tested as highly suspected animal reservoirs. The
detection of C. psittaci DNA in three of nine
pigeons with a possible clinical picture of C. psittaci infection is highly suggestive of true disease.
In conclusion, this sensitive and specific realtime PCR assay can generate results in a few
hours, thereby avoiding the wait for serological
confirmation and by-passing the need for culture,
which is particularly important for the rapid
detection and management of psittacosis outbreaks [5,26]. The assay detects C. psittaci DNA in
human respiratory specimens, and is a valuable
addition to the diagnostic tools available for
patients suspected of having psittacosis. The test
will also help clinicians to target antibiotic treatment and can expedite outbreak management.
The inclusion of an IC prevents the occurrence of
false-negative PCR results.
ACKNOWLEDGEMENTS
We thank H. C. J. G. Peters, pigeon breeder, for collecting the
nine pigeon nasal swabs, N. E. Vrede for the construction of
the internal control, and D. Vanrompay (Ghent University,
Belgium) for providing the C. abortus, C. caviae and C. felis
strains.
REFERENCES
1. Yung AP, Grayson ML. Psittacosis—a review of 135 cases.
Med J Aust 1988; 148: 228–233.
2006 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 12, 571–575
Heddema et al. Real-time PCR for Chlamydophila psittaci 575
2. Smith KA, Bradley KK, Stobierski MG, Tengelsen LA.
Compendium of measures to control Chlamydophila psittaci
(formerly Chlamydia psittaci) infection among humans
(psittacosis) and pet birds, 2005. J Am Vet Med Assoc 2005;
226: 532–539.
3. Anonymous. Notified cases of infectious diseases in the
Netherlands. Dutch Infect Dis Bull 2004; 15: 30.
4. Centers for Disease Control. Notifiable diseases ⁄ deaths in
selected cities weekly information. MMWR 2004; 52: 1291–
1299.
5. Sewell DL. Laboratory-associated infections and biosafety.
Clin Microbiol Rev 1995; 8: 389–405.
6. Mahony JB, Coombes BK, Chernesky MA. Chlamydia and
Chlamydophila. In: Murray PR, Baron EJ, eds. Manual of
clinical microbiology. Washington, DC: ASM Press, 2003;
991–1004.
7. Wong YK, Sueur JM, Fall CH, Orfila J, Ward ME. The
species specificity of the microimmunofluorescence antibody test and comparisons with a time resolved fluoroscopic immunoassay for measuring IgG antibodies against
Chlamydia pneumoniae. J Clin Pathol 1999; 52: 99–102.
8. Hewinson RG, Griffiths PC, Bevan BJ et al. Detection of
Chlamydia psittaci DNA in avian clinical samples by polymerase chain reaction. Vet Microbiol 1997; 54: 155–166.
9. Madico G, Quinn TC, Boman J, Gaydos CA. Touchdown
enzyme time release-PCR for detection and identification
of Chlamydia trachomatis, C. pneumoniae, and C. psittaci
using the 16S and 16S)23S spacer rRNA genes. J Clin
Microbiol 2000; 38: 1085–1093.
10. Messmer TO, Skelton SK, Moroney JF, Daugharty H,
Fields BS. Application of a nested, multiplex PCR to psittacosis outbreaks. J Clin Microbiol 1997; 35: 2043–2046.
11. Heddema ER, Kraan MC, Buys-Bergen HE, Smith HE,
Wertheim-Van Dillen PM. A woman with a lobar infiltrate
due to psittacosis detected by polymerase chain reaction.
Scand J Infect Dis 2003; 35: 422–424.
12. Meijer A, Kwakkel GJ, De Vries A, Schouls LM, Ossewaarde JM. Species identification of Chlamydia isolates by
analyzing restriction fragment length polymorphism of
the 16S)23S rRNA spacer region. J Clin Microbiol 1997; 35:
1179–1183.
13. Meijer A, Morre SA, van den Brule AJ, Savelkoul PH,
Ossewaarde JM. Genomic relatedness of Chlamydia isolates
determined by amplified fragment length polymorphism
analysis. J Bacteriol 1999; 181: 4469–4475.
14. Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-Van
Dillen PM, van der Noordaa NJ. Rapid and simple method
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
for purification of nucleic acids. J Clin Microbiol 1990; 28:
495–503.
Beld M, Minnaar R, Weel J et al. Highly sensitive assay for
detection of enterovirus in clinical specimens by reverse
transcription-PCR with an armored RNA internal control.
J Clin Microbiol 2004; 42: 3059–3064.
Everett KD, Bush RM, Andersen AA. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing
one monotypic genus, revised taxonomy of the family
Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. Int J
Syst Bacteriol 1999; 49: 415–440.
Verkooyen RP, Van Lent NA, Mousavi Joulandan SA et al.
Diagnosis of Chlamydia pneumoniae infection in patients with
chronic obstructive pulmonary disease by micro-immunofluorescence and ELISA. J Med Microbiol 1997; 46: 959–964.
Verkooyen RP, Willemse D, Hiep-van Casteren SC et al.
Evaluation of PCR, culture, and serology for diagnosis of
Chlamydia pneumoniae respiratory infections. J Clin Microbiol 1998; 36: 2301–2307.
Garrity GM, Bell JA, Lilburn TG. Chlamydiae. In: Garrity
GM, Brenner DJ, Krieg NR, Staley JT, eds, Bergey’s manual
of systematic bacteriology. New York: Springer-Verlag, 2003;
300–301.
Corsaro D, Venditti D, Valassina M. New parachlamydial
16S rDNA phylotypes detected in human clinical samples.
Res Microbiol 2002; 153: 563–567.
Cotton MM, Partridge MR. Infection with feline Chlamydia
psittaci. Thorax 1998; 53: 75–76.
Bush RM, Everett KD. Molecular evolution of the
Chlamydiaceae. Int J Syst Evol Microbiol 2001; 51: 203–220.
Bas S, Muzzin P, Ninet B, Bornand JE, Scieux C, Vischer
TL. Chlamydial serology: comparative diagnostic value of
immunoblotting, microimmunofluorescence test, and
immunoassays using different recombinant proteins as
antigens. J Clin Microbiol 2001; 39: 1368–1377.
Bourke SJ, Carrington D, Frew CE, Stevenson RD, Banham
SW. Serological cross-reactivity among chlamydial strains
in a family outbreak of psittacosis. J Infect 1989; 19: 41–45.
Wong KH, Skelton SK, Daugharty H. Utility of complement fixation and microimmunofluorescence assays for
detecting serologic responses in patients with clinically
diagnosed psittacosis. J Clin Microbiol 1994; 32: 2417–2421.
Williams J, Tallis G, Dalton C et al. Community outbreak
of psittacosis in a rural Australian town. Lancet 1998; 351:
1697–1699.
2006 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 12, 571–575