Download 1 a dictyostelium mutant with reduced lysozyme levels compensates

JBC Papers in Press. Published on January 7, 2005 as Manuscript M411445200
A DICTYOSTELIUM MUTANT WITH REDUCED LYSOZYME LEVELS
COMPENSATES BY INCREASED PHAGOCYTIC ACTIVITY*
Iris Müller#, Ninon Šubert~, Heike Otto#, Rosa Herbst§, Harald Rühling#, Markus Maniak# @,
and Matthias Leippe&
#
From the Department of Cell Biology, Kassel University, Heinrich-Plett-Str. 40, 34132 Kassel,
Germany, ~Bernhard Nocht Institute for Tropical Medicine, Bernhard-Nocht-Str. 74, 20359
Hamburg, Germany, §Department of Special Zoology, Ruhr University of Bochum,
Universitätsstr. 150, 44780 Bochum, Germany, and &Zoological Institute of the University of
Kiel, Olshausenstr. 40, 24098 Kiel, Germany
Running title: Compensation of lysozyme deficiency
Address correspondence to: Markus Maniak, Abt. Zellbiologie, Universität Kassel, Heinrich-Plett-Str.
40, 34132 Kassel, Germany, Tel.: +49(0)561-804-4798 Fax.: +49(0)561-804-4592 E-Mail:
[email protected]
Lysozymes are bacteria-degrading
enzymes and play a major role in the
immune defense of animals. In free-living
protozoa, lysozyme-like proteins are
involved in the digestion of phagocytosed
bacteria. Here, we purified a protein with
lysozyme activity from Dictyostelium
amoebae, which constitutes the founding
member a novel class of lysozymes. By
tagging the protein with GFP1 or the myc
epitope, a new type of lysozyme containing
vesicle was identified that was devoid of
other known lysosomal enzymes. The most
highly expressed isoform, encoded by the
alyA gene, was knocked out by homologous
recombination. The mutant cells had greatly
reduced enzymatic activity and grew
inefficiently when bacteria were the sole
food source. Over time, the mutant gained
the ability to internalize bacteria more
efficiently, so that the defect in digestion was
compensated by increased uptake of food
particles.
The lysosome is the most potent degradative
organelle within the eukaryotic cell. It contains
hydrolytic enzymes that fulfill essential
functions. In humans, many mutations
affecting its constituents lead to the diseased
state, often with dramatic consequences.
Mutations of this sort fall into two classes. The
first class affects proteins involved in
trafficking to and from the lysosome, and/or
regulating its integrity by modulating fusion
and fission events. Among these proteins are
Rabs, proteins belonging to a family that act as
molecular timers (1) controlling virtually every
trafficking step in the cell (2) and the LYST
proteins, which when mutated cause enlarged
lysosomes manifested as Chediak-Higashi
Syndrome (3). The second class of mutations
affects lysosomal enzymes with metabolic
roles. These enzymes degrade macromolecules
that the cell wants to dispose of, producing
small metabolites that are useful building
blocks or provide energy if completely
degraded in the cytosol and mitochondria.
Tragically, many of the lysosomal enzymes are
exoenzymes, i.e. they digest macromolecules
from their ends. If one of these enzymes is
lacking, degradation proceeds up to the residue
that cannot be removed and, as a consequence,
all steps that ensue will be blocked. This leads
to the accumulation of partially degraded
intermediates
within
the
lysosomes
culminating either in the formation of toxic
compounds or blowing up the volume of the
lysosome until it sterically interferes with vital
cellular activities. Depending on the cell type
that is most seriously harmed, be it neurons,
muscle or leukocytes, patients will suffer from
mental retardation, cardiac failure or
immunodeficiency (4,5).
In contrast, free-living amoebae are
unlikely to develop lysosomal storage diseases
because their endocytic pathway differs from
that of mammalian cells. In mammalian cells,
the lysosome is a dead-end of vesicular
trafficking. In most cell types, it accumulates
non-degradable material and retains it for the
lifetime of the cell and organism. In amoebae,
endocytosed cargo transits through the cell.
1
Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.
Any material that cannot be degraded because
specific enzymes are lacking is released from
the cell by exocytosis after an hour. Despite
these
differences,
amoebae
such
as
Dictyostelium can serve as bona fide model
systems to study lysosomal function in vivo.
Interference with Rabs (6,7) and LYST
proteins (8,9) produces phenotypes in
Dictyostelium that are comparable to those
observed in mammalian cells, indicating that
many lysosomal constituents are functionally
conserved in evolution. On the other hand, a
deficiency of cathepsin D leads to profound
defects in mice (10) and sheep (11) but is
tolerated well in Dictyostelium (12).
More recently mice have been
generated that specifically lack the M isoform
of lysozyme, which constitutes the most
prominent bacteriolytic activity in the airways
(13). Although homozygous mutants increase
the level of expression of the lysozyme P
isoform to compensate for their deficiency,
they remain much more sensitive to infections
of the lung (14). Lysozymes are not only found
in animals but are also present in numerous
phylogenetically diverse organisms such as
plants, fungi, bacteria, and bacteriophages
(15). Several different classes of theses
enzymes have been described revealing that
structurally diverse proteins fulfill the function
of degrading the peptidoglycan of bacteria by
splitting
a
1,4-linkage
between
Nacetylmuramic acid and N-acetylglucosamine
(16). Despite the fact that Dictyostelium has
been regarded as a good model for elucidating
molecular
mechanisms
underlying
phagocytosis of cells from higher organisms,
e.g. mammalian defensive cells, nothing is
known about the molecular armament that it
uses to efficiently eliminate the enormous
number of bacteria phagocytosed for nutrition.
We have isolated a protein with lysozyme
activity from Dictyostelium amoebae. The
protein is the first antimicrobial polypeptide
characterized in this protozoan organism at the
molecular level and it appears to be a member
of a previously unrecognized lysozyme family.
The enzyme is stored in a unique organelle and
disruption of its gene had a dramatic effect on
the phenotype.
EXPERIMETAL PROCEDURES
Purification of lysozyme – The AX2
Strain of D. discoideum was cultured at 22°C
axenically (17). Amoebae in late-logarithmic
phase were harvested, sedimented at 320 x g at
4°C for 5 min and washed two times in
Sörensen´s
17
mM
sodium/potassium
phosphate, pH 6.0. Freshly harvested and
washed amoebae (2,5 x 109 cells) were lysed
by three cycles of freezing and thawing in 5
volumes of 10 mM sodium acetate, pH 4.5
supplemented with complete proteinase
inhibitor cocktail (Roche, Mannheim). The
lysate was centrifuged at 150,000 x g at 4°C
for 1 h. Subsequent purification steps were
carried out at 10°C, and samples were kept on
ice. The 150,000 x g supernatant was applied
to a chromatography column (Econo column
2.5 x 20 cm, BIO-RAD) manually filled with a
BIO-GEL matrix (BIO-GEL A-0.5m; BIORAD). The column was equilibrated with 10
mM sodium acetate, pH 4.5. Adsorbed protein
was eluted by washing the column with the
same buffer (350 ml) and with 100 mM
sodium acetate, pH 4.5 (200 ml). Finally, the
column was washed with 500 mM sodium
acetate, pH 4.5 (200 ml). Fractions with
lysozyme activity were pooled and loaded on a
Resource S cation-exchange column (1 ml;
Amersham Biosciences) equilibrated with 10
mM sodium acetate, pH 4.5. Adsorbed protein
was eluted by first washing the column with
the same buffer (5 ml), then by use of a
gradient from 0 to 300 mM NaCl (25 ml) and
finally by a wash with 1 M NaCl. Each fraction
was tested for lysozyme activity.
Protein
analysis
Protein
concentration was determined using the
microbicinchoninic acid reagent assay (Pierce)
and hen egg lysozyme as standard (18).
Tricine-SDS PAGE was performed according
to Schägger and von Jagow (19). For Nterminal sequencing, proteins were reduced
with dithiothreitol and alkylated with
iodoacetamide, subjected to Tricine SDSPAGE and subsequent semidry electroblotting
using a poly (vinylidene difluoride) membrane
(Problott; Applied Biosystems), and were
analyzed using a gas-phase protein sequencer
(model 437 A; Applied Biosystems). For the
2
detection of glycosylation, proteins were
analyzed after blotting onto nitrocellulose
membrane using a glycan detection assay
according to the manufacturer’s instructions
(Roche, Mannheim). For mass spectrometric
analysis, samples were dialyzed against 5%
acetic acid and mixed with the same volume of
saturated trans-sinapinic acid in acetonitril /
0.1 % TFA as UV-absorbing matrix. About 10
ul of the samples were spotted on a stainless
steel probe tip and dried at room temperature.
Measurements were performed using a Bruker
Relex MALDI-TOF. Ions were formed by
laser desorption at 337 nm using an N2 laser.
Spectra were recorded with an acceleration
voltage of 35 kV in the linear mode. The mass
spectrometer was calibrated with bovine serum
albumin and carbonic anhydrase from bovine
erythrocytes (both from Sigma Chemical Co.)
as external standards.
Enzyme assays - Lysozyme activity
was measured as described previously (20). In
all assays hen egg lysozyme (Sigma) served
as a control. To monitor lysozyme activity
during purification, column fractions were
analyzed using the lysoplate technique (21).
For quantitative measurements of lysozyme
activity, cell wall degradation of lyophilized
Micrococcus luteus (Sigma) was determined
turbidimetrically essentially according to
Shugar (22). Degradation of cell walls of
Staphylococcus aureus (Sigma) was tested in
the same assay. To determine the effect of pH
and ionic strength on lysozyme activity the
turbimetric assay was adjusted according to
Dobson et al. (23). Various buffers were
prepared as specified by Miller and Golder
(24). They covered a pH range from 3.5 to
7.5, their ionic strength varying between
0.005 and 0.2. The occurrence of reducing Nacetyl amino sugars was tested as described
by Reissig et al. (25). Chitinolytic activity was
assayed using chitinglycol (Sigma) as a
substrate (26). Activity against viable bacteria
was determined in a microdilution
susceptibility assay as published previously
(27).
Gene disruption - The sequence
encoding AlyA was amplified from AX2
genomic DNA using primers bearing an EcoRI
recognition sequence in front of the start codon
(5‘CCGGAATTCAAAATGAGAATTGCTTTCT
TTTTACTTGTTTTAGCCG-3’) and a BglII
site following the last codon specifying an
amino
acid
(5‘GGAAGATCTTTCGAGATCAAAACCATT
ACAGGTCTTTTCAGC-3’), cleaved with the
corresponding enzymes and ligated into the
same sites of pIC19H. After deleting a SalI site
in the polylinker of this plasmid, which is also
recognized by HincII, the lysozyme sequence
was cut at its remaining HincII site and a
blunted
cassette
conferring
blasticidin
resistance isolated via BamHI and HindIII
digestion from plasmid pUCBsrDelBam (28)
was inserted. The resulting vector was cleaved
with SmaI and NruI situated in the polylinker
region to release the plasmid backbone
required for replication and selection in
Escherichia coli. The remaining linear 2.5 kb
fragment containing 560 bp of lysozyme
homologous sequences upstream and 550 bp
downstream of the resistance cassette was
transfected into Dictyostelium AX2 cells by
electroporation, and the resulting clones were
isolated by limited dilution into multiwell
plates. To identify clones that carry a disrupted
lysozyme gene we performed PCR on
preparations of genomic DNA (29) using
primers
(5’GTGGTGCTCTCTATTTCACAGC-3’ and 5’CTTGTTCAACCCACATGGCTGG-3’) that
flank 85 bp of coding sequence containing two
introns of different lengths which allow to
distinguish between the genes encoding
lysozyme isoforms.
Expression of lysozyme and tagged
variants - To rescue possible defects in a
lysozyme mutant, EcoRI and HindIII enzymes
were used to cut out lysozyme from pIC19H
and the gene was inserted into the expression
vector pDEX-RH (30) cut with the same
restriction enzymes. To allow for detection of
the transgene, a myc-epitope sequence cloned
in pIC20R (31) was cut out using SmaI and
AccI enzymes, blunted by filling in the twobase overhang, and ligated into the HincII site
within the lysozyme sequence of the pDEXRH expression construct. To monitor the
distribution of lysozyme a GFP fusion was
constructed. The lysozyme coding sequence
3
from the ATG up to the cleavage site of the
prodomain was amplified by PCR using a
cDNA library in phage lambda (courtesy of
Peter Devreotes, Baltimore) as a template. The
product was digested at the EcoRI and BglII
cleavage sites that flanked the PCR primers 5’CCGGAATTCAAAATGAGAATTGCTTTCT
TTTTACTTGTTTTAGCCG-3’
and
5’GGAAGATCTTGTAACAGTTGCTGTGAT
AAGGAAATGATCAC-3’ and inserted into
pDd-A15-gfp (32) as modified by (33), so that
GFP replaces the C-terminal prodomain of
lysozyme.
Endocytosis and cell growth - The
uptake of particles and fluid phase was
measured as described previously (34,35). To
determine the capacity of cells to degrade
bacteria in vivo, we used the assay established
by Masselli et al. (36), except that we used E.
coli expressing the green fluorescent protein
(37) to measure the decrease in intracellular
fluorescence after phagocytosis. To assay the
growth properties of cells on bacterial lawns,
we used Micrococcus luteus, Klebsiella
aerogenes and E. coli as substrates. These
bacterial species were pre-grown on SM plates,
harvested in Sörensen’s phosphate buffer (as
above), mixed with about 80 cells of the
appropriate Dictyostelium strain and plaque
diameter was measured after 5 days of growth
on SM agar plates. In this assay no dramatic
growth differences were observed between
Gram-negative and Gram-positive bacteria.
Immunofluorescence and antibodies MAB 221-342-5 recognizes a sulphated
mannose determinant residing on many
lysosomal enzymes (38). MAB AD 7.5 binds
to a N-Acetyl-Glucosamine-1-P-modification
of another class of lysosomal enzymes (39).
The antigen corresponding to MAB 130-80-2,
an esterase gp70, accumulated in crystal bodies
(40). MAB 9E10 recognizes the myc epitope
(41). The anti-GFP antibody (264-449-2) is
available from Chemicon (Temecula, CA,
USA). Immunofluorescence experiments were
performed as described before (34).
Monoclonal Antibodies were detected using
TRITC-coupled
polyclonal
secondary
antibodies purchased from Dianova (Hamburg,
Germany). Images were taken from single
confocal planes using a Leica TCS-SP laser
scanning microscope.
Database searches and accession
numbers - A computer-assisted homology
search was performed using the Internet
BLAST and FASTA searches in the nucleic
acid database of the National Center for
Biotechnology Information (NCBI) and the
Dictyostelium
Protein
database
(http://dictybase.org/db/cgi-bin/blast.pl)
resulting in sequence information for DdLys1
(AAM08434), Ddlys2 (AAM08432), DdLys3
(AAO051440) Ddlys4 (DDB0217279 and
DDB016810),
DdLysC1,DdLysC2
and
DdLysC3 (lysozymes of D. discoideum similar
to c-type lysozymes; U66523, DDB0189256,
DDB0205537, respectively). Dictyostelium
genes coding for DdLys T41 and DdLysT42
(lysozymes of D. discoideum similar to T4
phage-type lysozymes; DDB0217501 and
DDB0167824, respectively), DdLysEh1 and
DdLysEh2 (lysozymes of D. discoideum
similar
to
Entamoeba
histolytica;
DDB0167552 and DDB0219864, respectively)
were found in the UCSD list of identified
cDNA
clones
(http://www.biology.ucsd.edu/others/dsmith/id
entifieds.html). The amino acid sequences of
lysozymes of diverse organisms used in the
phylogenetic analysis were retrieved from the
Protein Entrez database of NCBI and listed
below with their respective abbreviation in Fig.
7 (source organism; Accession numbers):
LysC (Gallus gallus c-type lysozyme;
2CDS_A), LysT4 (Enterobacteria phage T4type lysozyme; 1LYD), LysG (Goose-type
lysozyme; LZGSG). Following lysozymes
represent i-type lysozymes of invertebrates:
Bathymodiolus
azoricus
(AAN16208),
Bathymodiolus thermophilus (AAN16209).
(Caenorhabditis elegans 1-3 (AAC10179,
AAC19181, AAA83197), Calytogena sp. 1
and 2 (AAN16211, AAN16212), Chlamys
islandica
(CAB63451),
Drosophila
melanogaster
1-3
(CAA21317,
AAF57939,AAF57940), Hirudo medicinalis
(AAA96144),
Mytilus
galloprovincialis
(AAN16210), Mytilus edulis (AAN16207),
Tapes japonica (BAB3389), Asterias rubens
4
(AAR29291), Entamoeba histolytica EhLys 1
and 2 (Q27650, AAC67235).
Protein alignments were performed using the
software ClustalX (42) and phylogenetic
relationships were analyzed using PAUP 4.0
(43). Bootstrap analysis (1000 replicates) was
added to test tree robustness.
RESULTS
Purification of a novel lysozyme and
identification of the alyA gene – We purified a
protein with lysozyme activity from axenically
cultured Dictyostelium amoebae, exploiting its
adsorption to a BIO-GEL matrix. The main
part of active material found in acid extracts of
amoebae was only weakly retained by the
column. It was eluted as a single protein peak
with the starting buffer. Final purification was
achieved by cation exchange chromatography
and yielded homogeneous material with a
molecular mass of approximately 12 kDa as
judged by SDS-PAGE (Fig. 1A). The purified
protein degraded M. luteus cell walls optimally
at low ionic strength between pH values
ranging from 4.5 to 6 (Fig. 1B). A colorimetric
test for detecting reducing ends of N-acetyl
amino sugars within a preparation of degraded
cell walls was positive and comparable to hen
egg lysozyme. As the protein did not exert
chitinase activity in the detection system used
(data not shown), these results together support
a true N-acetylmuraminidase (lysozyme)
activity of the protein. Purified lysozyme was
relatively stable: at pH 5.5, 10 min incubations
at 50°C did not reduce the activity, but, in
contrast to hen egg white lysozyme, its activity
decreased to one half when the enzyme was
incubated at 60°C for 10 min. The enzyme
displayed antibacterial activity against viable
bacteria; the protein inhibited the growth of the
Gram-positives Bacillus subtilis and B.
megaterium at 2.5 ug/ml. The growth of
Escherichia coli, representing Gram-negatives,
was not inhibited at 10 ug/ml. Neither viable S.
aureus nor cell walls of this bacterium were
affected by the enzyme at this concentration
(data not shown).
The purified lysozyme was subjected
to N-terminal sequencing, yielding a single
amino acid sequence up to residue 25
(YSCPKPCYGNMCCSTSPNNQYYLTD).
This sequence was back-translated into nucleic
acid sequence and used to search a cDNA
database (44). A cDNA clone, SSF469, was
retrieved, the deduced amino acid sequence of
which perfectly matched the experimentally
determined amino acid sequence of lysozyme.
Using this clone, we could identify the
corresponding gene on chromosome 2 in the
database from the Dictyostelium genome
project (45) and named it alyA (for amoeba
lysozyme A). The information on genomic
structure and amino acid sequence is
summarized in Fig. 2.
The N-terminal tyrosine residue of the
mature enzyme is preceded by a stretch of 19
mostly hydrophobic amino acid residues which
may serve as a signal peptide necessary for the
transport of the protein into the ER membrane.
MALDI-TOF analysis of the purified AlyA
protein yielded a molecular mass of 12.652 kDa.
This value confirms the molecular mass
estimated from SDS-PAGE and is in good
agreement with a mature peptide of 119 residues
which would have a calculated molecular mass
of 12.633 kDa provided that the 12 cysteine
residues participate in disulfide bonding. No
glycosylation of the purified protein was
experimentally evident as judged by a glycan
detection assay. The only putative Nglycosylation site in the primary translation
product is at Asn149, beyond the C-terminus of
the mature protein. Neither the mature protein,
nor its precursor molecule reveal significant
similarity to any protein of other organisms
reported so far, in particular not to other
bacteriolytic enzymes.
Phenotypic instability of aly knockouts
– To analyze the in vivo function of this novel
protein, we disrupted the alyA gene. Therefore,
we electroporated Dictyostelium cells in the
presence of a linear DNA fragment in which
genomic regions of alyA flanked a cassette
conferring blasticidin resistance to transformed
cells. As soon as clones appeared on the
primary Petri dish, we re-cloned them by
limited dilution in liquid growth medium. In
the first attempt to isolate a mutant lacking
alyA, we screened about 100 clones by PCR
analysis of genomic DNA and obtained a
single mutant cell line. Cell homogenates from
5
this clone #74 had a lysozyme activity that was
reduced to about 50% of wild-type levels.
When plated on a bacterial lawn the mutant
initially formed plaques, where the food
bacteria were consumed, that grew only to half
the size measured for the wild-type strain. This
phenotype, however, was not stable. Plating
experiments repeated over the course of two
weeks revealed that the diameter of plaques
increased in the alyA mutant until no
difference was seen to wild-type cells. In
contrast, the enzyme activity remained low.
Because of this phenotypic instability,
we repeated the transformation to obtain
another mutant. In the second attempt, one
mutant was found among about 150 clones
analysed. The following analysis focuses on
this clone, #138. PCR analysis using a primer
pair that binds to both alyA and alyB genes
(see below) revealed both genes in genomic
DNA from wild-type cells whereas only a
product corresponding to alyB, was detected in
the mutant (Fig. 3A). The mutant carried the
blasticidine resistance cassette precisely within
the alyA locus (Fig. 3B). As seen previously in
strain #74 the knockout mutant alyA138 had a
total lysozyme activity corresponding to about
40% of wild-type cells and maintained this
level over more than two months (Fig. 3C).
When the plaque diameters of the alyA138
strain were measured and compared to wildtype values, they were found to increase from
60% to 90% within about ten days, steadily
rising to 150% after 40 days, and finally
stabilizing at a constant value corresponding to
180% of wild-type cells (Fig. 3D). Despite
these changes, repeated PCR analyses did not
reveal any alteration at the alyA locus (data not
shown). All of the subsequent experiments
were performed using cells from this stage.
In order to test whether the increased
plaque size was due to an AlyA-independent
increase in the capacity to degrade bacteria, we
fed the cells with GFP-expressing bacteria and
measured the disappearance of their
fluorescence signal. Unexpectedly, the
alyA138 mutant performed as efficiently as
wild-type cells (Fig. 4A), although it was still
reduced in lysozyme activity. To find out
whether the increased plaque size was caused
by an increased efficiency of phagocytosis, we
measured the internalization of an indigestible
particle, fluorescently labeled yeast. Indeed,
the rate of particle uptake by alyA138 mutant
cells was almost two-fold higher than the rate
of wild-type phagocytosis (Fig. 4B), providing
a reasonable explanation for the increased
plaque diameter. Because the rate of fluidphase uptake was unaltered (Fig. 4C), the
phenotype observed in the alyA138 mutant is
not caused by a general change in the
endocytic properties of these cells.
Rescue of phenotypic defects - In the
case of unstable phenotypes, it is particularly
important to check whether the re-expression
of the product corresponding to the disrupted
gene reverts the phenotype to wild-type-like
character. To this end, we inserted the entire
coding region of alyA including the introns
into an expression vector and produced stably
transformed cell lines in the alyA138 mutant
background. RT-PCR analysis of various
clones generally revealed a more intense band
corresponding to the alyA gene (data not
shown), which reflects the high copy number
integration of the plasmid into the genome. In
clone #2.4, phagocytosis was reduced to
approximately wild-type levels (Fig. 4B),
plaque size returned to normal (Fig. 4D) and
the lysozyme activity in homogenates was also
partially rescued (Fig. 4E).
Because we failed to produce a
polyclonal antibody in chicken, which was
suitable for the localization of the enzyme in
cells, we resorted to analyzing the distribution
of genetically tagged AlyA proteins bearing a
myc epitope in the middle of the mature
enzyme or a GFP extension at its C-terminus
(Fig. 5A). In the former construct the enzyme’s
prodomain is maintained, whereas the GFP-tag
elimininated the cleavage signal, replacing the
C-terminal prodomain. These constructs were
individually transformed into the alyA mutant
background. The presence of the transgene was
verified by PCR (Fig. 5B) and the protein was
detected in Western blots (Fig. 5C). For all
rescued clones we established that the
endogenous copy of alyA was still disrupted
(data not shown). Although expression of each
of the tagged lysozymes increased the
enzymatic activity of cell extracts only mildly
(Fig. 5D), the efficiency of phagocytosis
6
approached wild-type levels (Fig. 5E),
indicating that the hybrid molecules were
sorted to proper destination in the cells.
Localization of the alyA product - Both
tagged proteins localized to numerous small
vesicles distributed throughout the cytoplasm.
Because the GFP moiety replaced the
prodomain in the hybrid construct, we
compared the subcellular distributions of
AlyA-GFP and myc-tagged AlyA directly in
cells transformed with a mixture of both
plasmids. Fig. 6A documents that the majority
of GFP-containing vesicles are also loaded
with the myc-tagged enzyme. The perinuclear
ring and the peripheral structures labeled with
theanti myc-antibody alone represent the
endoplasmic reticulum (data not shown),
suggesting that the myc epitope in the middle
of the AlyA protein reduces the efficiency of
protein folding. To investigate the identity of
the labeled vesicles, we checked the AlyAGFP expressing strain for the distribution of
three classes of lysosomal enzymes, known to
reside in different types of lysosomes.
Surprisingly, neither enzymes bearing the
common-antigen 1, a mannose-6-SO4containing oligosaccharide (Fig. 6B), nor
enzymes characterized by the N-acetylglucosamine-1-P-modification
co-distribute
with AlyA (Fig. 6C). Vesicles containing
crystal-forming esterases are also devoid of
AlyA-GFP (Fig. 6D). We therefore conclude
that the enzyme resides in a novel type of
vesicle in Dictyostelium. To test whether these
vesicles
deliver
their
contents
into
phagosomes, AlyA-GFP expressing cells were
fed with synthetic particles. One of the rare
events, where ite internalized beads are
surrounded by a rim of fluorescence is shown
in Fig. 6E. More frequently we saw fluorescent
granules accumulating in the vicinity of a bead
as if docked to the phagosome membrane (also
visible in Fig. 6E). We assume that the protein
is rapidly degraded when it encounters the
degradative enzymes of phagosome but is
rather stable in the storage vesicles.
DISCUSSION
The only lysozymes of protozoan
origin characterized at the molecular level to
date are from Entamoeba histolytica (20,46), a
parasitic amoeba colonizing the human small
intestine. Entamoeba is thought to have
diverged from the evolutionary path to higher
organism virtually at the same time as
Dictyostelium (47) and it was tempting to think
that Dictyostelium lysozymes are more closely
related to the Entamoeba lysozymes than to
enzymes from other organisms. We purified
the major protein with lysozyme activity from
extracts of Dictyostelium amoebae. The protein
was characterized and N-terminally sequenced
and a subsequent database search identified a
gene product with unknown function and
allowed to elucidate the entire primary
structure of the protein. The enzyme described
here is not related to any known lysozyme, and
we suggest viewing it as the founding member
of a new lysozyme class.
Several other sequences for putative
gene products that may have lysozyme-like
properties can be extracted from the
Dictyostelium database (Fig. 7A). A recent
survey of the genome reveals the existence of
eleven lysozyme genes that potentially code for
lysozymes belonging to four classes: two are of
the bacteriophage T4 type, three are
homologous to the C-type lysozymes.
Dictyostelium also has two genes that may code
for
proteins
closely
related
to
the
unconventional lysozymes first described from
E. histolytica (20,46). Searching with the
sequence of the AlyA protein turns up three
additional members of this so far unique
lysozyme gene family. The predicted protein
sequences of ALY B and ALY C, are
characterized by 12 and 22 exchanged residues,
respectively. The fourth and most divergent
member of the proteins encoded by the alyfamily, ALY D, carries a 77 residue insertion in
the middle of the molecule, which consists
almost exclusively of serines and glycines. The
remaining sequence is only about 40% identical
to AlyA. In summary, no other organism is as
well equipped with lysozyme genes as
Dictyostelium.
Many of the animals investigated so far
appear to possess a single type of lysozyme
only; multiple isoforms of a single lysozyme
type can be found when the protein has also
been recruited as a digestive enzyme (23). The
7
only other organisms known to date bearing
genes potentially coding for more than one type
of lysozyme are Drosophila melanogaster and
C. elegans. They possess c-type and i-type
lysozymes or E. histolytica-type and i-type
lysozymes, respectively (16,46). Phylogenetic
analysis revealed that the newly recognized
AlyA-D described here represent a novel type of
lysozymes (Fig. 7B). It is reasonable to assume
that the amoebic lysozymes, like in other
phagocytic cells, are constituents of an
intracellular armament that fulfill a digestive
function to exploit bacteria for nutrition. In
addition these enzymes may prevent
uncontrolled microbial growth within the
digestive vacuoles.
Irrespective of whether AlyA is tagged
with a myc epitope in the middle of the
molecule, or with a GFP moiety replacing the
C-terminal
prodomain,
the
enzyme
accumulates in the same type of small vesicle
(Fig. 6A). This observation indicates that the
prodomain is not required for proper sorting of
AlyA, an observation that has been made with
other lysosomal enzymes as well (48,49).
Because the N-terminal signal peptide is likely
to be cleaved immediately after entry into the
endoplasmic reticulum, the mature enzyme
must encompass all the signals required for
correct subcellular targeting.
Interestingly, AlyA is concentrated in a
specific sort of vesicle, devoid of other
lysosomal enzymes (Fig. 6). This finding
increases the number of primary lysosomes to
four, because it has been convincingly shown
that mannose-6-SO4 modified enzymes, and Nacetyl-glucosamine-1-P modified proteins do
not coexist in the same vesicle (39), and the
number and morphology of esterosomes (40,50)
identifies the AlyA containing organelles as a
novel class of lysosomes. A possible reason for
sorting AlyA away from the majority of
proteases lies in the sensitivity of the molecule:
It is very short-lived in total cell extracts at
acidic conditions and becomes increasingly
stable
during
purification.
Indeed,
immunofluorescence experiments reveal that
bead-bearing phagosomes only rarely contain
detectable steady state levels of the enzyme
(Fig. 6), but its acidic pH optimum is in good
agreement with the pH values found within
Dictyostelium endosomes.
When alyA, the gene encoding the
major lysozyme isoform, is disrupted, the total
lysozyme activity of cells extracts is reduced to
40% of wild-type cells as measured by the
degradation of bacterial cell walls in vitro (Fig.
3C). In support of these findings, the initial
ability of cells to form plaques on a lawn of
bacteria is reduced to a similar degree (Fig.
3D). Taken together these two observations
clearly support a role for AlyA in efficient
degradation of phagocytosed bacteria, which is
perfectly consistent with its well known
activity to cleave the bacterial peptidoglycan,
the major constituent of the cell wall of Grampositives. As peptidoglycan is also a
constituent of the cell wall of Gram-negative
bacteria, it is not surprising to find the same
initial results when alyA mutant cells grow on
lawns of E. coli and K. aerogenes.
However, when the alyA deficient cells
are cultivated for prolonged times, a surprising
observation can be made. The efficiency of
plaque formation increases gradually, until it
reaches wild-type levels, finally exceeding
these values by almost two fold (Fig. 3D). The
reasons for these phenotypic changes are not
trivial, because the enzymatic activity of
lysozyme in both strains remains constantly at
40% of wild-type level in vitro (Fig. 3C). Most
importantly, alyA mutant cells attain wild-type
properties after re-expression of wild-type and
hybrid AlyA transgenes (Fig. 4, 5), indicating
that the changes observed in the mutant over
time are not the consequence of an
accumulation of a number of second site
mutations. Instead, the compensatory events
leading to increased phagocytosis in the mutant
are more likely to involve metabolic changes,
regulation within networks of gene expression,
or epigenetic phenomena.
In principle, compensation that leads to
the increased plaque size in the Dictyostelium
alyA mutants can be of two kinds. Either the
ability to degrade bacteria is enhanced, or the
rate of phagocytosis is augmented. The first
possibility can be ruled out, because when the
mutants were measured for their ability to
attack GFP-expressing bacteria, they perform
similar to wild-type cells (Fig. 4A). On the
8
contrary, when the uptake of non-degradable
yeast particles is measured, the rate of
phagocytosis for all strains corresponds to the
behavior observed in the plaque-forming assay
(Fig. 4, 5).
The rate of phagocytosis depends on
the dynamics of the actin cytoskeleton, and
many Dictyostelium mutants affected in actinbinding proteins show a reduced rate of
particle uptake (51). Interestingly, a number of
mutants exist, which are characterized by an
increased rate of phagocytosis (52-54). When
the expression levels of a variety of these
proteins were analyzed by Western blotting of
mutant cell extracts, no differences to the wildtype were detected (data not shown). On the
other hand, it may be informative to look in
more detail into signal transducing cascades. In
particular, overexpression of the small
GTPases RacC or Rap1, is known to result in
increased phagocytosis, while fluid-phase
uptake remains unaffected (55,56). While these
proteins could possibly signal to the
cytoskeleton, it remains to be investigated,
how they would perceive the level of AlyA
within the compartments of the secretory
and/or endocytic pathway.
Acknowledgements - We thank Friedrich Buck
for protein sequencing, Thomas Jacobs for
mass spectrometry, Josef Rüschoff and
Thomas Brodegger for making their DNA
sequencing facility available. Günther Gerisch,
Annette Müller-Taubenberger and Hudson
Freeze have kindly provided monoclonal
antibodies. We are grateful to all teams
involved in the Dictyostelium genome and
cDNA sequencing projects.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Rybin, V., Ullrich, O., Rubino, M., Alexandrow, K., Simon, I., Seabra, M. C., Goody, R., and
Zerial, M. (1996) Nature 383, 266-269
Novick, P., and Zerial, M. (1997) Curr. Op. Cell Biol. 9, 496-504
Barbosa, M. D. F. S., Ngyuyen, Q. A., Tchernev, V. T., Ashley, J. A., Detter, J. C., Blaydes,
S. M., Brandt, S. J., Chotai, D., Hodgman, C., Solari, R. E., Lovett, M., and Kingsmore, S. F.
(1996) Nature 382, 262-265
Winchester, B., Vellodi, A., and Young, E. (2000) Biochem Soc Trans 28, 150-154.
Walkley, S. U. (2001) Curr Opin Neurol 14, 805-810.
Buczynski, G., Bush, J., Zhang, L., Rodriguez-Paris, J., and Cardelli, J. (1997) Mol. Biol. Cell
8, 1343-1360
Bruckert, F., Laurent, O., and Satre, M. (2000) Protoplasma 210, 108-116
Harris, E., Wang, N., Wu, W., Weatherford, A., De Lozanne, A., and Cardelli, J. (2002) Mol.
Biol. Cell 13, 656-669.
Cornillon, S., Dubois, A., Bruckert, F., Lefkir, Y., Marchetti, A., Benghezal, M., De Lozanne,
A., Letourneur, F., and Cosson, P. (2002) J. Cell Sci. 115, 737-744.
Saftig, P., Hetman, M., Schmahl, W., Weber, K., Heine, L., Mossmann, H., Koster, A., Hess,
B., Evers, M., von Figura, K., and et al. (1995) Embo J 14, 3599-3608
Tyynela, J., Sohar, I., Sleat, D. E., Gin, R. M., Donnelly, R. J., Baumann, M., Haltia, M., and
Lobel, P. (2000) Embo J 19, 2786-2792
Journet, A., Chapel, A., Jehan, S., Adessi, C., Freeze, H., Klein, G., and Garin, J. (1999) J.
Cell Sci. 112, 3833-3843
Markart, P., Korfhagen, T. R., Weaver, T. E., and Akinbi, H. T. (2004) Am J Respir Crit Care
Med 169, 454-458
Markart, P., Faust, N., Graf, T., Na, C. L., Weaver, T. E., and Akinbi, H. T. (2004) Biochem J
380, 385-392
Jollès, P., and Jollès, J. (1984) Mol Cell Biochem 63, 165-189
Bachali, S., Jager, M., Hassanin, A., Schoentgen, F., Jollès, P., Fiala-Medioni, A., and
Deutsch, J. S. (2002) J Mol Evol 54, 652-664
Watts, D. J., and Ashworth, J. M. (1970) Biochem. J. 119, 171-174
9
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M.
D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Anal Biochem 150,
76-85
Schägger, H., and von Jagow, G. (1987) Anal Biochem 166, 368-379
Jacobs, T., and Leippe, M. (1995) Eur J Biochem 231, 831-838
Osserman, E. F., and Lawlor, D. P. (1966) J Exp Med 124, 921-952
Shugar, D. (1952) Biochim Biophys Acta 8, 302-309
Dobson, D. E., Prager, E. M., and Wilson, A. C. (1984) J Biol Chem 259, 11607-11616
Miller, G. L., and Golder, R. H. (1950) Arch. Biochem. Biophys. 29, 420-423
Reissig, J. L., Storminger, J. L., and Leloir, L. F. (1955) J Biol Chem 217, 959-966
Yamada, H., and Imoto, T. (1981) Carbohydr Res 92, 160-162
Andrä, J., Berninghausen, O., Wülfken, J., and Leippe, M. (1996) FEBS Lett 385, 96-100
Adachi, H., Hasebe, T., Yoshinaga, K., Ohta, T., and Sutoh, K. (1994) Bioch. Biophys. Res.
Comm. 205, 1808-1814
Nellen, W., Datta, S., Reymond, C., Sivertsen, A., Mann, S., Crowley, T., and Firtel, R. A.
(1987) Meth. Cell Biol. 18, 67-100
Faix, J., and Dittrich, W. (1996) FEBS Lett. 394, 251-257
Drengk, A., Fritsch, J., Schmauch, C., Rühling, H., and Maniak, M. (2003) Curr. Biol. 13,
1814-1819
Gerisch, G., Albrecht, R., Heizer, C., Hodgkinson, S., and Maniak, M. (1995) Curr. Biol. 5,
1280-1285
Hanakam, F., Albrecht, R., Eckerskorn, C., Matzner, M., and Gerisch, G. (1996) EMBO J. 15,
2935-2943
Maniak, M., Rauchenberger, R., Albrecht, R., Murphy, J., and Gerisch, G. (1995) Cell 83,
915-924
Hacker, U., Albrecht, R., and Maniak, M. (1997) J. Cell Sci. 110, 105-112
Maselli, A., Laevsky, G., and Knecht, D. A. (2002) Microbiology 148, 413-420.
Crameri, A., Whitehorn, E. A., Tate, E., and Stemmer, W. P. C. (1996) Nature Biotech. 14,
315-319
Neuhaus, E. M., Horstmann, H., Almers, W., Maniak, M., and Soldati, T. (1998) J. Struct.
Biol. 121, 326-342
Souza, G. M., Metha, D. P., Lammertz, M., Rodriuez-Paris, J., Wu, R., Cardelli, J. A., and
Freeze, H. H. (1997) J. Cell Sci. 110, 2239-2248
Bomblies, L., Biegelmann, E., Döring, V., Gerisch, G., Krafft-Czepa, H., Noegel, A. A.,
Schleicher, M., and Humbel, B. M. (1990) J. Cell Biol. 110, 669-678
Munro, S., and Pelham, H. R. (1987) Cell 48, 899-907
Heringa, J. (1999) Comput. Chem. 23, 341-364
Swofford, D. (1999) Sinauer, Sunderland, MA
Morio, T., Urushihara, H., Saito, T., Ugawa, Y., Mizuno, H., Yoshida, M., Yoshino, R., Mitra,
B. N., Pi, M., Sato, T., Takemoto, K., Yasukawa, H., Williams, J., Maeda, M., Takeuchi, I.,
Ochiai, H., and Tanaka, Y. (1998) DNA Res. 5, 335-340
Glöckner, G., Eichinger, L., Szafranski, K., Pachebat, J. A., Bankier, A. T., Dear, P. H.,
Lehmann, R., Baumgart, C., Parra, G., Abril, J. F., Guigo, R., Kumpf, K., Tunggal, B., Cox,
E., Quail, M. A., Platzer, M., Rosenthal, A., and Noegel, A. A. (2002) Nature 418, 79-85.
Nickel, R., Jacobs, T., and Leippe, M. (1998) FEBS Lett 437, 153-157
Bapteste, E., Brinkmann, H., Lee, J. A., Moore, D. V., Sensen, C. W., Gordon, P., Durufle, L.,
Gaasterland, T., Lopez, P., Muller, M., and Philippe, H. (2002) Proc Natl Acad Sci U S A 99,
1414-1419.
Huete-Perez, J. A., Engel, J. C., Brinen, L. S., Mottram, J. C., and McKerrow, J. H. (1999) J
Biol Chem 274, 16249-16256
10
49.
50.
51.
52.
53.
54.
55.
56.
Moin, K., Demchik, L., Mai, J., Duessing, J., Peters, C., and Sloane, B. F. (2000) Adv Exp
Med Biol 477, 391-401
Yuan, A., and Chia, C. P. (2000) Exp. Cell Res. 261, 336-347.
Maniak, M. (2002) Int. Rev. Cytol. 221, 257-287
Wienke, D. C., Knetsch, M. L. W., Neuhaus, E. M., Reedy, M. C., and Manstein, D. J. (1999)
Mol. Biol. Cell 10, 225-243
Temesvari, L., Zhang, L., Fodera, B., Janssen, K. P., Schleicher, M., and Cardelli, J. A. (2000)
Mol. Biol. Cell 11, 2019-2031
Konzok, A., Weber, I., Simmeth, E., Hacker, U., Maniak, M., and Müller-Taubenberger, A.
(1999) J. Cell Biol. 146, 453-464
Seastone, D., Lee, E., Bush, J., Knecht, D., and Cardelli, J. (1998) Mol. Biol. Cell 9, 28912904
Seastone, D., Zhang, L., Buczynski, G., Rebstein, P., Weeks, G., Spiegelman, G., and
Cardelli, J. (1999) Mol. Biol. Cell 10, 393-406
FOOTNOTES
*This work was supported by the Deutsche Forschungsgemeinschaft (DFG) by grants MA
1439/4-1 and LE 1075/2-3. R.H. is a recipient of a Lise Meitner fellowship from Nordrhein-Westfalen.
1
The abbreviations used are: Aly, amoeba lysozyme; PCR, polymerase chain reaction; MAB,
monoclonal antibody; GFP green fluorescent protein.
FIGURE LEGENDS
Fig. 1. Purification of AlyA and activity determination at various conditions. A, a protein preparation
with lysozyme activity eluted isocratically from a Bio-Gel column was subjected to Resource S cation
exchange chromatography. Bound protein was eluted with an increasing NaCl gradient (dotted line)
and active fractions were pooled as indicated by the bar. The inset shows the different steps of
purification of AlyA on a silver-stained SDS gel: Lane 1, amoebic acid extract; lane 2, Bio-Gel
fraction; lane 3, Resource S fraction. Molecular masses are indicated at the left. B, cell walls of M.
luteus were incubated with the purified protein at various pH and at ionic strength reaching from 0.005
to 0.2, and degradation as a measure of lysozyme activity was determined photometrically.
Fig. 2. Sequence features of the alyA gene. Nucleotide sequence of the cDNA clone SSF 469 and
derived amino-acid sequence. The residues identified by peptide sequencing are shown in bold face.
CS denotes the cleavage site positions between the signal peptide (residues 1-19), the mature protein
and and the prodomain (residues 139-181). Above the nucleotide sequence, H2 denotes the single
HincII site used for insertion of the resistance cassette and the myc epitope, respectively (see Figs. 3
and 5). The positions of the six introns from the genomic clone are numbered I1 to I6. The underlined
sequences indicate the position of primers used for PCR in Fig. 3.
Fig. 3. Unstable phenotype in an alyA-knockout mutant. A, PCR products from genomic DNA of wildtype cells (AX2) and alyA138 using the primers flanking introns 4 and 5 (see Fig. 2). The upper band
corresponding to the alyA gene is missing in the mutant. The remaining band was cut out and
sequenced and thus identified as a product of a second isoform, the alyB gene. The intron positions are
conserved, but their length varies. Intron 4 is 90 bp in alyA, and 81 bp in alyB. Intron 5 is 125 bp in
alyA, and 79 bp in alyB. Together, the sizes of alyA and alyB introns amount to a 55 bp difference
detected in the PCR reaction. B, PCR using a primer corresponding to a sequence coding for the Nterminus of the signal peptide and a primer that is located within the blasticidin resistance cassette
only amplifies a product from alyA138 mutant DNA. C, enzymatic activity of lysozyme was measured
11
in wild-type cells (filled symbols, set to 100%) or the alyA138 mutant (open symbols) at intervals after
transformation and the turnover rates were plotted over time (days). It did not change over the two
months period shown, and remained constant thereafter. D, plaque diameter of the alyA138 mutants
increases with time (days). Single cells were seeded together with lawns of bacteria onto agar plates
and the diameter of the zone cleared by phagocytosis was measured on day 5 after inoculation. Wildtype values were set to 100%.
Fig. 4. Endocytic performance of the alyA mutant and rescue of the phenotype. A, degradation of
bacteria by alyA138 cells (open circles) in vivo occurs with the same efficiency as in the wild-type
strain (filled circles). Cells were challenged with GFP-expressing bacteria, and the decrease of
intracellular fluorescence was measured over time .B, the rate of phagocytosis is increased in the
alyA138 mutant, and can be rescued to wild-type-like levels upon re-expression of alyA (open
squares). Cells were incubated together with fluorescent yeast particles and the intracellular
fluorescence signal (relative units) originating from phagocytosed particles was measured at 15 min
intervals. C, Fluid-phase uptake is unaltered in the alyA138 mutant. Cells were allowed to internalize
nutrient medium containing fluorescently labeled dextran and intracellular fluorescence (relative units)
was recorded over time. D, re-expression of AlyA reverts the plaque size to wild-type-like dimensions.
Conditions were as for Fig. 3D. Filled bars are from wild-type cells, open bars represent the alyA138
mutant, and hatched bars denote the rescued strain. Values (in mm) are the mean of 6-7 measurements
in at least three independent experiments (n as indicated). Error bars are S.E.M. E, re-expression of
alyA increases total enzyme activity about two-fold. Enzymatic activity in cell extracts is measured as
the decrease in absorbance of a bacterial cell wall preparation over time.
Fig. 5. Tagged AlyA proteins can complement the phenotypic alterations of the alyA138 mutant. A,
schematic drawing of the tagged constructs. Signal indicates the N-terminally cleaved signal peptide
for translocation into the ER. The active mature enzyme is followed by the C-terminally cleaved
prodomain (pro). MYC and GFP tags were inserted in the middle of the mature protein (catalytic) or
replacing pro, respectively. B, PCR of myc and GFP rescues produced in the alyA138 background. In
clones bearing the myc epitope within the coding sequence (myc) the PCR-fragment was up-shifted in
size relative to the alyA band from wild-type genomic DNA (AX2) because the construct was based on
the genomic clone. In cells expressing the GFP-hybrid protein (GFP) the PCR fragment was smaller
than the genomic alyA product, because in this case the fusion-protein was constructed using the
cDNA clone. Marker (M) sizes in kb. C, Western blot of myc-tagged and GFP-tagged proteins. Two
membranes were incubated with anti-myc and anti-GFP monoclonal antibodies, respectively, and
developed with a chromogenous substrate. Abbreviations are as above. Molecular masses of the
tagged proteins corresponded to the expected sizes of 15 kDa and 40 kDa, respectively. An asterisk
indicates a cross-reactive band. Molecular mass of marker (M) in kDa. D, rescue of enzymatic activity
by myc and GFP Total lysozyme activity in cell extracts (measured as in Fig. 4E) is increased by
expression of myc-tagged protein (open triangle) or by a GFP-hybrid (open squares). Wild-type cells
(filled circles) and the alyA138 mutant (open circles) were measured as controls. E, rescue of
phagocytosis by expression of myc- and GFP-tagged proteins. Particle uptake was measured as in Fig.
4B. Symbols are used as above.
Fig. 6. Localization of myc- and GFP-tagged AlyA. Individual channels and overlay images of single
confocal sections through AlyA-GFP expressing cells (green), stained with various antibodies in
indirect immunofluorescence (red). A, a cell expressing additionally myc-tagged AlyA as detected by
MAB 9E10. B, a cell stained for common-antigen 1 using MAB 221-342-5. C, immunofluorescence
using MAB AD7.5, directed against the N-acetyl-glucosamine-1-P-modification, or D, the crystal
protein, which is the target of MAB 130-80-2 binding. For E cells were allowed to phagocytose latex
beads as seen in the transmission image. Bar = 5 um.
12
Fig. 7. Multiple sequence alignment and phylogenetic tree of lysozymes. A, multiple sequence
alignment using ClustalX. The amino acid sequences of the ALY isoforms A-D are shown as
proenzymes. The other amino acid sequences of putative lysozymes of D. discoideum, namely c-type
(DdLysC1-3), phage-type (DdLysT41-2) and Entamoeba-type lysozymes (DdLysEh1-2) were found
in databases and are aligned with representative homologues of the respective class of lysozymes from
other organisms. B, phylogenetic tree of lysozymes from different species drawn and analyzed with
PAUP 4.0. Data on sequences are given in the experimental procedures section. An unrooted distance
tree (neighbor joining) is presented. Numbers at the nodes represent bootstrap proportions on 1000
replicates; values over 70% are depicted only. The ALY family members are marked by bold letters.
The invertebrate lysozymes are considered a monophyletic family and therefore the entire branch is
shaded.
13
Fig. 2
1
1
TCAACAATGAGAATTGCTTTCTTTTTACTTGTTTTAGCCGTTATTATCGGA
MetArgIleAlaPhePheLeuLeuValLeuAlaValIleIleGly
103
33
I1
TTTGCTTATGGTTACAGTTGTCCAAAACCATGTTATGGTAACATGTGTTGT
PheAlaTyrGlyTyrSerCysProLysProCysTyrGlyAsnMetCysCys
CS
I2
TCAACTTCACCAAATAACCAATATTATTTAACTGATTTCTGTGGAAGCACA
SerThrSerProAsnAsnGlnTyrTyrLeuThrAspPheCysGlySerThr
154
50
I3
AGTGCTTGTGGTCCAGTTCCATCATGTAGTGGTGCTCTCTATTTCACAGCT
SerAlaCysGlyProValProSerCysSerGlyAlaLeuTyrPheThrAla
205
67
I4
H2
GATAGTCAACGTTTTGGTTGTGGTAAATATTTAAATCTTTGCAGAAGTGGT
AspSerGlnArgPheGlyCysGlyLysTyrLeuAsnLeuCysArgSerGly
256
84
I5
AAATGTGTTAAAGCCCAAATTTATGATGCTGGTCCAGCCATGTGGGTTGAA
LysCysValLysAlaGlnIleTyrAspAlaGlyProAlaMetTrpValGlu
307
101
I6
CAAGATGCTGGTATGATGATTATTGATGCATCACCAACTATTTGTCACGTT
GlnAspAlaGlyMetMetIleIleAspAlaSerProThrIleCysHisVal
358
118
CTCACTGGTGGATCATCATGTGGTTGGAGTGATCATTTCCTTATCACAGCA
LeuThrGlyGlySerSerCysGlyTrpSerAspHisPheLeuIleThrAla
409
135
ACTGTTACATCTCTCACTGATTCAAGACCACTCGGTCCATTCAATGTTACT
ThrValThrSerLeuThrAspSerArgProLeuGlyProPheAsnValThr
CS
460
152
GAATCAGAAATGGCTCAACTTTTCATTGATCATGAAATTGCTATGGCTCAA
GluSerGluMetAlaGlnLeuPheIleAspHisGluIleAlaMetAlaGln
511
169
TGTGAAGCTGAAAAGACCTGTAATGGTTTTGATCTCGAATAAATTATATAC
CysGluAlaGluLysThrCysAsnGlyPheAspLeuGlu
562
TTTAATATTTAAAATAAAAAATTTATTTTCTCTTTGTCGATTAAAAAA
52
16