Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Extracellular matrix wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Cell culture wikipedia , lookup
Cellular differentiation wikipedia , lookup
Tissue engineering wikipedia , lookup
Signal transduction wikipedia , lookup
Cell encapsulation wikipedia , lookup
Endomembrane system wikipedia , lookup
Plant Cell Physiol. 41(9): 993–1001 (2000) JSPP © 2000 Characterization of Organelles in the Vacuolar-Sorting Pathway by Visualization with GFP in Tobacco BY-2 Cells Naoto Mitsuhashi 1, 2, 3, Tomoo Shimada 3, Shoji Mano 1, Mikio Nishimura 1, 2 and Ikuko Hara-Nishimura 3, 4 1 Department of Cell Biology, National Institute for Basic Biology, Okazaki, 444-8585 Japan Department of Molecular Biomechanics, School of Life Science, The Graduate University for Advanced Studies, Okazaki, 444-8585 Japan 3 Department of Botany, Graduate School of Science, Kyoto University, Kyoto, 606-8502 Japan 2 ; reported; pumpkin PV72 (Shimada et al. 1997), pea BP-80 (Paris et al. 1997) and Arabidopsis AtELP (Ahmed et al. 2000). The receptors are a type I integral membrane protein with epidermal growth factor (EGF)-like motifs in the lumenal domain. The lumenal domains of PV72 (our unpublished data) and BP-80 (Paris et al. 1997) are involved in ligand binding, while the cytosolic tail of BP-80 is reported to be involved in efficient recycling of the receptor from prevacuolar compartments to the Golgi complex (Jiang and Rogers 1998). However, the mechanism responsible for recycling mediated by the cytosolic tail has not been characterized. On the other hand, vacuolar-targeting signals on the polypeptide sequences of soluble vacuolar proteins have been well characterized. The signals are separated into three classes; N-terminal propeptides (NTPPs), internal peptides and C-terminal propeptides (CTPPs). An NPIR sequence conserved in the NTPPs of barley aleurain (Holwerda et al. 1992) and sweet potato sporamin (Matsuoka and Nakamura 1992) has been shown to function as a vacuolar-targeting signal and to bind to the receptors (Cao et al. 2000, Shimada et al. 1997). In contrast to the NTPPs, the CTPPs of barley lectin (Bednarek and Raikhel 1991) and tobacco chitinase (Neuhaus et al. 1991) have no significant conserved sequence between them. PV72 has been shown to bind to the C-terminal peptide of 2S albumin, a major storage protein of pumpkin (Shimada et al. 1997). This raises the question of whether the peptide functions as a vacuolar-targeting signal of 2S albumin to protein storage vacuoles. Recently, green fluorescent protein (GFP) is being used in an increasing number of cell biology studies. GFP makes it possible for organelles in living cells to be visualized in real time. Thus, GFP should be a useful tool to investigate the retention or sorting signals of proteins delivered through the secretory pathway and the pathway to the vacuoles in plant cells. In plants, the modified GFPs have been reported to be localized in non-acidic vacuoles (Sansebastiano et al. 1998) as well as in ER (Berger et al. 1995, Saito et al. 1999) and Golgi complex (Nebenführ et al. 1999, Sansebastiano et al. 1998). GFP fluorescence has not been observed in the acidic and lytic vacuoles in plants. This raises the second question of whether GFP is de- We have shown the localization and mobilization of modified green fluorescent proteins (GFPs) with various signals in different compartments in a vacuolar-sorting system of tobacco BY-2 cells. In contrast to the efficient secretion of GFP from the transformed cells expressing SP-GFP composed of a signal peptide and GFP, accumulation of GFP in the vacuoles was observed in the cells expressing SP-GFP fused with the C-terminal peptide of pumpkin 2S albumin. This indicated that this peptide is sufficient for vacuolar targeting. Interestingly, the fluorescence in the vacuoles disappeared sharply at 7 d after inoculation of the cells, but it appeared again after re-inoculation into a new culture medium. When SP-GFP was fused with the region, termed PV72C, including a transmembrane domain and a cytosolic tail of a vacuolar-sorting receptor PV72, GFPPV72C was detected in the Golgi-complex-like small particles. Prolonged culture showed that GFP-PV72C that reached the prevacuolar compartments was cleaved off the PV72C region to produce GFP, that arrived at the vacuoles to be diffused. These findings suggested that the vacuolarsorting receptor might be recycled between the Golgi complex and prevacuolar compartments. Key words: BY-2 cells — Endoplasmic reticulum — GFP — Golgi complex — Vacuolar-sorting receptor — Vacuole. Abbreviations: BCECF, 2,7-bis-(2-carboxyethyl)-5,(6)-carboxyfluorescein; CTPPs, C-terminal propeptides; DEX, dexamethasone; EGF, an epidermal growth factor; ER, endoplasmic reticulum; EST, expressed sequence tag; GFP, green fluorescent protein; NTPPs, N-terminal propeptides; PV72, a vacuolar-sorting receptor of pumpkin; TIP, tonoplast intrinsic protein. Introduction Protein trafficking toward vacuoles is composed of highly complex processes in higher plant cells (Neuhaus and Rogers 1998, Okita and Rogers 1996, Robinson and Bäumer 1998, Rogers 1998). Three vacuolar-sorting receptors have been 4 Corresponding author: E-mail, [email protected]; Fax, +81-75-753-4141. 993 994 GFP in endomembrane systems graded and/or protonated not to generate fluorescence under the acidic condition in the vacuole. If not, GFP could be used to investigate the vacuolar-targeting machinery. In contrast to the well-characterized soluble proteins, vacuolar sorting of integral membrane proteins is less understood. The transport pathway for vacuolar membrane proteins has not been studied with GFP in living cells. Tonoplast intrinsic proteins (TIPs) are typical integral membrane proteins. It has been shown that -TIP is specific to protein-storage vacuoles and TIP is to vegetative vacuoles. Both types of vacuoles are found in the same cells of barley roots (Jauh et al. 1999, Okita and Rogers 1996, Paris et al. 1996) and of maturing pea cotyledons (Robinson et al. 1995). In these cells, each TIP synthesized on the ER is sorted and delivered to the respective vacuoles. The third question is whether different targeting signals for both TIPs are involved in their sorting. To answer these questions, we have visualized the compartments in the transport pathway to the vacuoles in plants by using GFP tagged with various signals to be localized in different organelles. We also investigated the developmental changes in the fluorescent image during the culture of the cells and in various culture conditions. Materials and Methods Plant materials Suspension-cultured cells of tobacco BY-2 (Nicotiana tabacum L. cv. Bright Yellow 2) were kindly provided by Dr. K. Nakamura of Nagoya University. The cells were subcultured in Murashige-Skoog medium once a week at 26.5C in the dark with an orbital shaker (BioShaker BR-3000LF, Taitec, Koshigaya, Japan). The BY-2 cells were transformed with each of the following GFP-chimeric genes. Plasmid construction sGFP-TYG was kindly provided by Dr. Y. Niwa of University of Shizuoka (Chiu et al. 1996). pSGFP-BE, that had both HindIII and BamHI sites in the 5 flanking region, an NcoI site on the starting codon, and both BglII and EcoRI sites on the stop codon of sGFP-TYG, was generated from sGFP-TYG by Mano et al. (1999). Based on pSGFP-BE, a chimeric gene encoding each of six modified GFPs as shown in Figure 1 was constructed. For the chimeric gene encoding SP-GFP, two annealing complementary oligonucleotides, 5-AGCTTGGATCCATGGCCAGACTCACAAGCATCATTGCCCTCTTCGCAGTGGCTCTGCTGGTTGCAG ATGCGTACGCCTACCGCAC-3 as a sense strand and 5-CATGGTGCGGTAGGCGTACGCATCTGCAACCAGCAGAGCCACTGCGAAG AGGGCAATGATGCTTGTGAGTCTGGCCATGGATCCA-3 as an antisense strand, were synthesized and annealed to produce a doublestranded DNA with protruding ends to be ligated with the HindIII and NcoI sites. The DNA fragment was inserted into the HindIII-NcoI site of pSGFP-BE to produce pSP-GFP. The chimeric gene encodes a fusion protein composed of the 22-amino-acid signal peptide followed by a tripeptide YRT sequence of pumpkin prepro2S albumin and GFP. For the chimeric gene encoding SP-GFP-HDEL, two annealing complementary oligonucleotides, 5-GATCTCGGGGGGGGGCACCACCACCACCACCACGATGAGCTTTGAG-3 as a sense strand and 5-AATTCTCAAAGCTCATCGTGBGTGGTGGTGGTGGTGCCCCCCCCCGA-3 as an antisense strand, were synthesized and annealed to produce a double-stranded DNA with protruding ends to be Fig. 1 Constructs of modified GFPs that were expressed in tobacco BY-2 cells. Six modified GFPs are schematically represented. SP-GFP is composed of the signal peptide (SP) of pumpkin 2S albumin followed by GFP. SP-GFP-HDEL is composed of SP-GFP followed by a 12-amino-acid sequence including an ER-retention signal, HDEL. SPGFP-2SC is composed of SP-GFP followed by a linker of GGG and the C-terminal 18-amino-acid sequence of pumpkin 2S albumin including a putative vacuolar-targeting signal, NLPS. SP-GFP-PV72C is composed of SP-GFP followed by the C-terminal 68-amino-acid sequence of pumpkin PV72, a vacuolar-sorting receptor. The C-terminal sequence includes a transmembrane domain (TMD) and a cytosolic tail with a tyrosine-based signal, YMPL. TIP-GFP is composed of pumpkin -TIP, MP28, followed by GFP. TIP-GFP is composed of Arabidopsis -TIP that is encoded by an EST clone (Genbank accession number x72581) followed by GFP. ligated with the BglII and EcoRI sites. The DNA fragment was inserted into the BglII-EcoRI site of pSP-GFP. The chimeric gene encodes a fusion protein composed of SP-GFP followed by a 12-amino-acid sequence including an ER-retention signal, HDEL. For the chimeric gene encoding SP-GFP-2SC, two annealing complementary oligonucleotides, 5-GATCTCGGGGGGGGGAAGGCTAGGAACTTGCCTTCCATGTGCGGAATCCGCCCACAGCGAT GCGACTTCTGAG-3 as a sense strand and 5-AATTCTCAGAAGTCGCATCGCTGTGGGCGGATTCCGCACATGGAAGGCAAGTTCC TAGCCTTCCCCCCCCCGA-3 as an antisense strand, were synthesized and annealed to produce a double-stranded DNA with protruding ends to be ligated with the BglII and EcoRI sites. The DNA fragment was inserted into the BglII-EcoRI site of pSP-GFP. The chimeric gene encodes a fusion protein composed of SP-GFP followed by a tripeptide, GGG, and the C-terminal 18-amino-acid sequence of pumpkin prepro2S albumin including a putative vacuolar-targeting signal, NLPS. For the chimeric gene encoding SP-GFP-PV72C, the DNA fragment, that was produced by PCR-amplification using PV72 cDNA as a template and a set of the oligonucleotide primers, 5-AGTAGATCTCGGTAACATTGGGAGCACT-3 and 5-TATGAATTCTCATACGCCCCCACGGGC-3, was inserted into the BglII-EcoRI site of pSP-GFP. The chimeric gene encodes a fusion protein composed of SP-GFP followed by the C-terminal 68-amino-acid sequence of pumpkin PV72, a vacuolar-sorting receptor. The C-terminal sequence includes a transmembrane domain and a cytosolic tail with a tyrosinebased signal, YMPL. For the chimeric gene encoding TIP-GFP, the DNA fragment, that was produced by PCR-amplification using a cDNA for pumpkin GFP in endomembrane systems MP28 (-TIP) as a template and a set of the oligonucleotide primers, 5-AAGCTTATGCCGCCGAGACGATATGCC-3 and 5-CCATGGAGCCGCCGCCGTAATCTTCCGGAGCTAAAGG-3, was inserted into the HindIII-NcoI site of pSGFP-BE. The chimeric gene encodes a fusion protein composed of -TIP and GFP. For the chimeric gene encoding TIP-GFP, the DNA fragment, that was produced by PCR-amplification using an expressed sequence tag (EST) clone for Arabidopsis -TIP (Genbank accession number x72581) as a template and a set of the oligonucleotide primers, 5AAGCTTATGCCGATCAGAAACATCGCC-3 and 5-CCATGGAGCCGCCGCCGTAGTCGGTGGTTGGGAGCTG-3, was inserted into the HindIII-NcoI site of pSGFP-BE. The chimeric gene encodes a fusion protein composed of -TIP and GFP. The chimeric genes encoding SP-GFP, SP-GFP-HDEL, SP-GFP2SC and SP-GFP-PV72C were inserted into pBI121. Both chimeric genes encoding TIP-GFP and TIP-GFP were inserted into pMAT037. The gene encoding TIP-GFP was also inserted into pTA7002 to use a glucocorticoid dexamethasone (DEX)-inducible system (Aoyama et al. 1995). These plasmids were then introduced into Agrobacterium tumefaciens (strain EHA101; Hood et al. 1986) by electroporation. BY-2 cells were transformed with each of the chimeric genes via A. tumefaciens according to the method of Matsuoka and Nakamura (1991). Extraction from the transformant cells and immunoblot analysis The transformed BY-2 cells were gently filtered to be packed. Each 1 g of the packed cells was homogenized in 2 ml of the following buffers. The buffer of 10 mM Tris-HCl, pH 7.5, including proteinase inhibitors (Complete Mini, Boehringer Mannheim, Tokyo, Japan) was used for SP-GFP/BY2, SP-GFP-HDEL/BY2 and SP-GFP-2SC/ BY2 that accumulated soluble GFPs. The other buffer of 10 mM TrisHCl, pH 7.5, including the proteinase inhibitors and 0.1% SDS was used for SP-GFP-PV72C/BY2, TIP-GFP/BY2, TIP-GFP/BY2 that accumulated GFPs in the cellular membranes. The homogenates were centrifuged at 15,000g and 4C for 20 min to obtain the cellular extracts as supernatant solutions. To analyze secreted proteins, the culture medium of the transformed BY-2 cells at 4 d after inoculation into a new medium was used as described by Saito et al. (1999). The medium was filtered through four layers of cheesecloth to remove the cells. The filtrate was centrifuged at 5,000g and 4C for 15 min. The supernatant was treated with 70% (w/v) ammonium sulfate for 1 h followed by centrifugation. The precipitate was suspended with 5 mM Tris-HCl, pH 7.0, and then dialyzed against 5 mM Tris-HCl for 15 h to obtain a solution containing secreted proteins. Immunoblot analysis was performed essentially as described previously (Inoue et al. 1995). The above sample solutions were subjected to SDS-PAGE and the separated proteins on gels were transferred electrophoretically to a GVHP membrane (0.22 m; Nihon Millipore, Tokyo, Japan). The membrane blot was incubated with specific antibodies against GFP (diluted 1,000-fold, Clontech, Palo Alto, CA, U.S.A.) for 1 h. Horseradish peroxidase-conjugated antibodies raised in donkey against rabbit IgG (Amersham Japan, Tokyo, Japan) were diluted 10,000-fold and used as second antibodies. Immunodetection was performed with an enhanced chemiluminescence kit (an ECL system, Amersham Japan) according to the manufacturer’s directions. Fluorescent microscopy and laser-scanning confocal microscopy The transformed BY-2 cells were inspected with a fluorescence microscope (Axiophot 2, Carl Zeiss, Jena, Germany) using a filter set (an excitation filter; BP450–490, a dichroic mirror; FT510, a barrier filter; BP515–565, Carl Zeiss), a CCD camera (CoolSNAP, RS Photometrics, Chiba, Japan), and a light source (Arc HBO 100W, Atto, To- 995 kyo, Japan). The lytic vacuoles of non-transformed BY-2 cells that were stained with 2,7-bis-(2-carboxyethyl)-5,(6)-carboxyfluorescein (BCECF) were also inspected with the fluorescent microscope. The transformed BY-2 cells were also examined with a laser-scanning confocal microscope (LSM510, Carl Zeiss) equipped with a krypton-argon laser and a filter set for GFP. Results Secretion of GFP from the SP-GFP/BY2 cells and accumulation of GFP-HDEL in the ER of the SP-GFP-HDEL/BY2 cells GFP itself is known to be localized in cytosol and/or nuclear matrix in the plant cells transformed with a GFP gene. To visualize the compartments involved in the transport of vacuolar proteins, we constructed the modified GFPs with various signals to be localized in different organelles, as shown in Figure 1. BY-2 cells were transformed with a chimeric gene encoding SP-GFP composed of the signal peptide of pumpkin 2S albumin and GFP to generate a transformant SP-GFP/BY2. Figure 2A and 2B shows that fluorescence was detected on the network and nuclear envelope of the SP-GFP/BY2 cells. An immunoblot of the extract of the cells with GFP-specific antibodies revealed that a 28-kDa protein was accumulated in the cells (Fig. 2F, lane 1). The molecular mass of 28-kDa was consistent with the calculated mass for GFP itself, 27,919 Da. An 18-kDa degradation product was detected in the culture medium as well as a slight amount of the 28-kDa GFP (Fig. 2F, lane 2). These findings indicated that the co-translational cleavage of the signal peptide of SP-GFP produces GFP that is secreted into the medium to be degraded. SP-GFP-HDEL was composed of SP-GFP followed by an ER-retention signal, HDEL. The transformant SP-GFP-HDEL/ BY2 cells show a strong and stable fluorescence on the network within the cells (Fig. 2C, D, E). The fluorescent image on the network shows the ER-network. An immunoblot of the cellular extract showed that a 30-kDa protein was accumulated in the ER (Fig. 2F, lane 3). The molecular mass of 30 kDa was consistent with 29,264 Da of the calculated mass for GFPHDEL. The 30-kDa GFP-HDEL was retained within the ER, but not secreted into the culture medium (Fig. 2F, lane 4). A C-terminal peptide of 2S albumin as a vacuolar-targeting signal To elucidate the vacuolar-targeting signal of 2S albumin, a major storage protein, we constructed SP-GFP-2SC composed of SP-GFP followed by the C-terminal 18-amino-acid peptide (2SC) of pumpkin 2S albumin (Fig. 1). The peptide could bind to PV72, a vacuolar-sorting receptor of developing pumpkin seeds (Shimada et al. 1997). The SP-GFP-2SC/BY2 callus cells were inspected with a laser-scanning confocal microscope. Figure 3A shows that fluorescence was observed in the large compartments as well as the ER-network and/or nuclear envelope. All the compart- 996 GFP in endomembrane systems Fig. 3 Sorting of GFP-2SC to vacuoles in the transformant SP-GFP2SC/BY2 cells. BY-2 cells were transformed with a p35S::sp-gfp-2sc gene to produce a transformant, SP-GFP-2SC/BY2. The callus cells were inspected with a laser-scanning confocal microscope. Comparison of the confocal image (A) with that of the stainable vacuoles with BCECF of non-transformed cells (B) shows that GFP fluorescence was observed in both the ER-networks and vacuoles of the transformant. Bars = 20 m. Fig. 2 Secretion of GFP from the transformant SP-GFP/BY2 cells, and accumulation of GFP-HDEL in the ER of the transformant SPGFP-HDEL/BY2 cells. BY-2 cells were transformed with each of a p35S::sp-gfp gene and a p35S::sp-gfp-hdel gene to produce transformants, SP-GFP/BY2 (left) and SP-GFP-HDEL/BY2 (right), respectively. (A–D) The 3-day-old transformant cells were inspected with a fluorescent (FL) or differential-interference-contrast (DIC) microscope. Fluorescent images (A, C) show the localization of the modified GFPs within the cells and DIC micrographs (B, D) show the cellular structures of the respective fields. (E) The fluorescent ER networks were observed in the SP-GFP-HDEL/BY2 cells with a higher magnification. Bars = 20 m. (F) Both the cellular extract (c) and the culture medium (m) from each transformant of SP-GFP/BY2 and SP-GFPHDEL/BY2 were subjected to SDS-PAGE and subsequent immunoblot analysis with GFP-specific antibodies. The 28-kDa GFP was synthesized on the ER of the SP-GFP/BY2 cells (lane 1) and then secreted into the culture medium to be degraded to form the 18-kDa product (lane 2). The 30-kDa GFP-HDEL was synthesized to be accumulated in the ER of the SP-GFP-HDEL/BY2 cells (lane 3) and no GFPrelated proteins were detected in the medium of the cells (lane 4). ments were stainable with BCECF (Fig. 3B), that is known to give the fluoresced vacuoles of the BY-2 cells (Matsuoka et al. 1997). This indicated that GFP-2SC was transported and accumulated in the vegetative vacuoles. The confocal image showed that the vacuoles had a complicated structure rather than a single central vacuole (discussed below). The detailed confocal image of the SP-GFP-2SC/BY2 cells showed that fluorescence was also detected in small particles with a similar size to that of Golgi complex (discussed below). Such small particles were not detected in the SP-GFP-HDEL/BY2 cells. These findings indicated that the C-terminal peptide functions as a targeting signal for vacuoles via Golgi complex. Cyclical change in the fluorescent image and the accumulation level of GFP during the growth of SP-GFP-2SC/BY2 cells Although the SP-GFP-2SC/BY2 cells exhibited fluorescent vacuoles (Fig. 3A), the fluorescent image was not stable in contrast to the stable fluorescent image throughout the growth of the SP-GFP/BY2 and SP-GFP-HDEL/BY2 cells. The fluorescent pattern of the SP-GFP-2SC/BY2 cyclically changed during the cell culture (Fig. 4A). The 9- to 10-day-old cells in a stationary phase gave faint fluorescence only around the nuclear envelope. The cells with a large central vacuole were inoculated into a new medium to be cultured for another cycle of 9 d. The 2-day-old cells were proliferated and divided into the smaller cells. The fluorescent intensity around the nuclear envelope and the ER-network increased and reached the maximum in the 3-day-old cells with GFP in endomembrane systems 997 Fig. 4 Cyclical changes in the fluorescent images and the level of the expressed GFP during the growth of the transformant SP-GFP-2SC/BY2 cells. (A) The 10-day-old transformant cells were transferred to a new medium and were cultured for another 9 d. During the growth, the cells were inspected in the same field with a fluorescent (FL) or differential-interference-contrast (DIC) microscope. The numbers at the bottom represent days after inoculation of the transformant cells into fresh medium. Bars = 20 m. (B) The transformant cells at each day after inoculation as in A were collected. Each cellular extract containing 10 g total proteins was subjected to SDS-PAGE and subsequent immunoblot analysis with GFP-specific antibodies. The numbers represent days after inoculation as in A. the smallest size. Fluorescence was also detected in small particles within the cytosol of the cells (discussed below). The fluorescent vacuoles were found in the 4-day-old cells and the fluorescence increased up to 6 d after inoculation. It should be noted that the fluorescence rapidly disappeared in 7-day-old cells and only a slight fluorescence was detectable around the nuclear envelope in the 8- to 9-day-old cells. Interestingly, when the 10-day-old cells were transferred into fresh medium, the change in the above fluorescent patterns was repeated cyclically (data not shown). To clarify the change in the accumulation level of GFP during the cell growth, immunoblot analysis of the extract from the SP-GFP-2SC/BY2 cells was performed with GFP-specific antibodies (Fig. 4B). The molecular mass of the accumulated protein was the same as that of 28-kDa GFP, indicating that GFP itself was accumulated in the vacuoles after removal of 2SC peptide. The accumulation level of the GFP protein increased and reached the maximum at 6 d after inoculation of the cells and then dropped at 7 d after inoculation. The change in the GFP level during the growth was associated with the change in the fluorescent intensity found in the vacuoles (Fig. 4A). A C-terminal region including the transmembrane domain and the cytosolic tail of a vacuolar-sorting receptor, PV72, functions in recycling of the receptor to Golgi complex To clarify the mechanism for recycling of a vacuolar-sorting receptor, we focused on the C-terminal region of pumpkin PV72. We constructed SP-GFP-PV72C composed of SP-GFP fused with the C-terminal region (PV72C) that included the transmembrane domain and the cytosolic tail with a tyrosinebased motif, YMPL (Fig. 1). Figure 5A shows that the fluores- 998 GFP in endomembrane systems cence was localized in the small particles in the 3-day-old cells. A similar fluorescent image of the small particles in the cytosol was observed in the SP-GFP-2SC/BY2 cells (Fig. 3A, 4A). The image is consistent with fluoresced Golgi complex as reported by Nebenführ et al. (1999). These findings suggested that the C-terminal region including the transmembrane domain and the cytosolic tail of a vacuolar-sorting receptor is responsible for the presence of the receptor in Golgi complex. An immunoblot of the cellular extract showed that the 36-kDa protein was accumulated (Fig. 5C, lane 1). The molecular mass of 36 kDa was consistent with the calculated mass of 35,325 Da for GFP-PV72C. In contrast to the distinct localization of GFP-PV72C in Golgi complex of the suspension cultured cells, the fluorescence was observed within the vacuoles of the 10-day-old cells of the SP-GFP-PV72C/BY2 callus (Fig. 5B). The fluorescence within the vacuoles indicated that GFP-PV72C with a transmembrane domain was converted to soluble and diffusible GFP. An immunoblot of the cellular extract showed that the vacuoles accumulated the 28-kDa protein with the same molecular mass of GFP itself (Fig. 5C, lanes 2, 3). The proteolysis of GFP-PV72C into GFP might occur in the prevacuolar compartments of the 10-day-old callus cells. It has been shown that BY-2 cells under such conditions give a high proteolytic activity (Moriyasu and Ohsumi 1996). By the high proteolytic activity, GFP-PV72C could be cleaved off the PV72C region to produce GFP that was diffused within the vacuoles and caused the fluoresced vacuoles. Both TIP-GFP and TIP-GFP are similarly targeted to the vacuoles of BY-2 cells The next issue to be resolved concerned a selective sorting for protein-storage vacuoles and vegetative vacuoles. To answer the question of whether different targeting signals for -TIP and -TIP are involved in their sorting to the respective type of the vacuoles, we constructed TIP-GFP and TIP-GFP to be expressed in the BY-2 cells. Figure 6 shows that both TIP-GFP (Fig. 6A, B) and TIP-GFP (Fig. 6C, D) were localized on the vacuolar membranes of the 3-day-old cells in a similar pattern. This indicated that both the TIP-GFP fusion targeted to the same vacuoles in the BY-2 cells. One possibility that could not be excluded was that the free C-terminal region of each TIP functions as a selective targeting signal for the respective vacuole. To examine this possibility, we constructed the GFP-TIP and GFP-TIP fusion proteins to make the Cterminal regions of TIPs free as the authentic TIPs. These GFPTIP fusion proteins gave a fluorescent pattern on the vacuolar membrane of the transformed BY-2 cells similar to that of the TIP-GFP and TIP-GFP fusion proteins (data not shown). In the cells within several weeks after transformation, the localization of TIP-GFP on the ER network was found (Fig. 6F). The transformant cells with a DEX-inducible system also showed the localization of TIP-GFP on the ER-network with- Fig. 5 Developmental changes in fluorescent images and localization of the expressed GFP during the growth of the transformant SPGFP-PV72C/BY2 cells. BY-2 cells were transformed with a p35S::spgfp-pv72c to produce a transformant, SP-GFP-PV72C/BY2. The 3day-old suspension cells (A) and the 10-day-old callus (B) of the transformant were inspected with a confocal and fluorescent microscope, respectively. Fluorescent images of the transformant were changed from a Golgi-complex type (indicated by arrowheads) into a vacuole type (indicated by asterisks) during the growth of the cells. Bars = 20 m. (C) Each cellular extract containing 10 g total proteins from the 3-day-old cells and 10-day-old callus was subjected to SDS-PAGE and subsequent immunoblot analysis with GFP-specific antibodies. The 3-day-old cells accumulated a 36-kDa GFP-PV72C in the Golgi complex (lane 1) and the 10-day-old cells accumulated the 28-kDa GFP, but not GFP-PV72C, in the vacuoles (lane 2). The 28-kDa GFP from the SP-GFP/BY2 cells is also shown as a marker (lane 3). in a few days after treatment with DEX (Fig. 6G). These finding suggested that both TIP-GFP and TIP-GFP are first localized on the ER and then transported to vacuolar membranes. GFP in endomembrane systems 999 Fig. 6 Sorting of a fusion protein of a vacuolar membrane protein followed by GFP in the transformant TIP-GFP and TIP-GFP cells. BY-2 cells were transformed with each of a p35S::tip-gfp and a p35S::tip-gfp to produce transformants, TIP-GFP/BY2 and TIP-GFP/BY2, respectively. (A-D) The 3-day-old cells of both transformants were inspected in the same field with a fluorescent (FL; A, C) or differential-interferencecontrast (DIC; B, D) microscope. Similar accumulation patterns of TIP-GFP (A, B) and TIP-GFP (C, D) on the vacuolar membranes were observed. (E) A confocal image of the 3-day-old TIP-GFP/BY2 cells shows the distinct localization of TIP-GFP on the vacuolar membranes of the cells. (F) A fluorescent image of the TIP-GFP/BY2 cells within several weeks after transformation shows the predominant localization of TIP-GFP on the ER-network (indicated by arrowheads) rather than on the vacuolar membrane. (G) BY-2 cells were transformed with a fusion gene of tip-gfp under the control of a DEX-inducible promoter. A confocal image of the transformant cells within a few days after induction with DEX shows the localization of TIP-GFP both on the ER-network (indicated by arrowheads) and on the vacuolar membranes. (H) A three-dimensional structure of vacuoles in the TIP-GFP/BY2 cells was reconstituted with sequential confocal images taken along the optical z-axis through a complete cell. Bars = 20 m. This reflects the transport pathway of the integral membrane proteins to vacuolar membranes. The fluorescent images of TIP-GFPs clearly showed a complex structure of vacuoles. The three-dimensional structure of the vacuoles of the =TIP-GFP/BY2 cells was reconstituted with sequential confocal images (Fig. 6H). The three-dimensional image of vacuoles revealed that several large central vacuoles were folded within a cell. This reflects the several compartments found as vacuoles in the thin focal plane (Fig. 3). Discussion Visualization of various compartments in a vacuolar-sorting pathway of the living cells of tobacco BY-2 The ER-networks was visualized with GFP in the SPGFP-HDEL/BY2 cells, as expected because of the ER-reten- tion signal HDEL (Fig. 1E). The strong and stable fluorescent image of SP-GFP-HDEL/BY2 can be the best marker of ER in the living cells. SP-GFP-HDEL has also been reported to be stably expressed in the transformed Arabidopsis plants (Haseloff et al. 1997). In addition, the ER-network was also fluoresced transiently in the transformed cells expressing the modified GFPs that were synthesized on the ER to be secreted or transported to vacuoles. The SP-GFP/BY2 cells that secreted GFP into the culture medium exhibited a similar fluorescent image, but the intensity was much lower than that of the SPGFP-HDEL/BY2 cells (Fig. 1A). The SP-GFP-2SC/BY2 and TIPs-GFP/BY2 cells gave a transient fluorescence on the ERnetwork, where both the soluble and membrane proteins are synthesized to be transported to vacuoles (Fig. 4A). On the other hand, the fluorescence on the ER network in the SP-GFP-PV72C cells was very weak, because of the low expression level of the GFP fusion. The 36-kDa GFP-PV72C 1000 GFP in endomembrane systems protein was found to be localized in small particles of the cytosol. The particles moved along with cytoplasmic streaming in the transvacuolar strands of the cells (data not shown). The particles were less than 1 m in diameter (Fig. 5A). Similar structures in BY-2 cells have been reported by Nebenführ et al. (1999). They expressed a fusion protein GmMan1::GFP composed of a Golgi-complex resident protein, -1,2 mannosidase I (GmMan1), fused with N terminus of GFP. They confirmed the localization of GmMan1::GFP in Golgi complex by an immunoelectron microscopic analysis. Thus, the GFP-PV72Ccontaining particles are identical to the Golgi complex. This is also supported by the evidence that BP-80 (Hinz et al. 1999) and AtELP (Sanderfoot et al. 1998) are localized in the Golgi complex. A similar fluorescence on the small particles was also found in the GFP-2SC/BY2 cells (Fig. 4A), an indication that GFP-2SC passed through the Golgi complex, together with a vacuolar-sorting receptor. In contrast, TIP-GFP fusions did not give such fluoresced small particles at all, in spite of giving the fluoresced ER-networks (Fig. 6). The results suggested that integral membrane proteins such as TIPs might be transported to the vacuoles bypassing the Golgi complex. This is consistent with the report that TIP is sorted to vacuoles in a Golgi-independent manner (Jiang and Rogers 1998). Figure 3 shows that GFP-2SC was finally transported to the vacuoles. This indicated that the C-terminal-18-amino-acid is responsible for targeting to vacuoles. The SP-GFP-2SC/BY2 cells can be used to investigate the molecular mechanism in the protein-trafficking to plant vacuoles. Cyclical change in fluorescent pattern of GFP depend on the cell growth The SP-GFP-2SC/BY2 cells show a cyclical change in fluorescent image and the accumulation level of GFP during the cell culture (Fig. 4). Such cyclical change has not been reported in the stable transformants, although a time-dependent transition of fluorescent images was observed in the tobacco cells with a transient expression of GFP fused with the C-terminal peptide of tobacco chitinase (Sansebastiano et al. 1998). The chimeric gene driven by CaMV 35S promoter should generate a constitutive expression of GFP-2SC in the SP-GFP2SC cells. Thus, the cyclical change in the GFP level in the vacuoles might be reflected by the cyclic ups and downs of the accumulation of proteinases in the vacuoles. We observed the highest activity of vacuolar processing enzyme in the 7- to 9day-old cells and the lowest activity in the 3-day-old cells (data not shown). Vacuolar processing enzyme have been suggested to be responsible for the maturation and activation of vacuolar proteinases (Kinoshita et al. 1999). Proteolytic activity of the vacuoles might be the highest in the 7-day-old cells. The rapid disappearance of GFP in the 7-day-old cells might be caused by the proteolytic degradation within the vacuoles. It has been also shown that the BY-2 cells under sucrose starvation conditions accumulated proteolytic enzymes in the cells to degrade cellular components (Moriyasu and Ohsumi 1996). The soluble GFP fusions incorporated into the vacuoles could be degraded in transformed BY-2 cells as found in the GFP-2SC cells. This might be one of the reasons why GFP fluorescence has not been observed in the acidic and lytic vacuoles in plants. Recycling of a vacuolar-sorting receptor between the Golgi complex and prevacuolar compartments The SP-GFP-PV72C/BY2 cells showed that the fluorescence of the 36-kDa membrane protein of GFP-PV72C in the Golgi complex disappeared followed by the appearance of fluorescence of the 28-kDa soluble GFP within the vacuoles (Fig. 5). This suggested that PV72 might be recycled between the Golgi complex and prevacuolar compartments, as pea BP-80 (Jiang and Rogers 1998). We have reported that PV72 has an affinity with the C-terminal peptide (2SC) of pumpkin 2S albumin (Shimada et al. 1997). It is likely that PV72 in the Golgi complex transport pro2S albumin to the prevacuolar compartments with itself and is retrieved to the Golgi complex after releasing the ligand in the compartments. Thus, we could visualize the recycling process visible in the living SP-GFP-PV72C cells. Prolonged culture reduced the fluorescence of GFP in the vacuoles of the SP-GFP-PV72C/BY2 cells (data not shown), as in the vacuoles of the SP-GFP-2SC cells (Fig. 4). This might be also caused by the proteolytic degradation of GFP in the cells. The non-specific degradation occurred in the vacuoles of the cells. In contrast, the disappearance of the fluorescence of GFP within the vacuoles, the fluorescence on the vacuolar membranes was extremely stable during the growth of the TIPGFP/BY2 cells, since the GFP moiety was exposed to the cytosol but not to the vacuolar interior. Sorting of both types of TIPs to the same vacuoles -TIP and -TIP are useful markers for protein-storage vacuoles and lytic vacuoles, respectively (Paris et al. 1996). Both TIPs are localized in different vacuoles in the same cells of barley roots (Okita and Rogers 1996, Paris et al. 1996) and of maturing pea cotyledons (Robinson et al. 1995). This suggested that these TIPs are delivered to their respective vacuoles according to each targeting signal on their polypeptide chains. However, unexpectedly, both TIP-GFP and TIP-GFP fusion proteins targeted to the same vacuole in the transformed BY-2 cells (Fig. 6). Within several weeks after transformation or within a few days after DEX-induction, TIP-GFP and TIP-GFP were detected on the ER, but not on the Golgi complex. These findings suggested that both TIP-GFP and TIPGFP are transported to vacuolar membranes via the same pathway that might be bypassed or quickly passed through the Golgi complex. It remains to be solved how these TIPs are sorted and delivered to the respective type of vacuole in the plant cell. GFP in endomembrane systems Acknowledgements We are grateful to Dr. Niwa of University of Shizuoka for his kind donation of the modified GFP gene with a strong fluorescence and both Dr. Aoyama of Kyoto University and Dr. Chua of Rockefeller University for their kind donation of pTA7002 to generate a glucocorticoid-inducible system. This work was supported by Grants-inAids for ‘Research for the Future’ Program (JSPS-RFTF96L60407) from the Japan Society for the Promotion of Science and for Scientific Research (nos. 10440244 and 10182102) from the Ministry of Education, Science, Sports and Culture of Japan. References Ahmed, S.U., Rojo, E., Kovalentina, V., Venkataraman, S., Dombrowski, J.E., Matsuoka, K. and Raikhel, N.V. (2000) The plant vacuolar sorting receptor AtELP is involved in transport of NH2-terminal propeptide-containing vacuolar proteins in Arabidopsis thaliana. J. Cell Biol. 149: 1335–1344. Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti, I., Morelli, G. and Chua, N.-H. (1995) Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco. Plant Cell 7: 1773– 1785. Bednarek, S.Y. and Raikhel, N.V. (1991) The barley lectin carboxy-terminal propeptide is a vacuolar protein sorting determinant in plants. Plant Cell 3: 1195–1206. Berger, S., Bell, E., Sadka, A. and Mullet, J.E. (1995) Arabidopsis thaliana Atvsp is homologous to soybean VspA and VspB, genes encoding vegitative storage protein acid phosphatases, and is regulated similarly by methyl jasmonate, wounding, sugars, light and phosphate. Plant Mol. Biol. 27: 933– 942. Cao, X., Rogers, S.W., Butler, J., Beevers, L. and Rogers, J.C. (2000) Structural requirements for ligand binding by a probable plant vacuolar sorting receptor. Plant Cell 12: 493–506. Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H. and Sheen, J. (1996) Engineered GFP as a reporter in plants. Curr. Biol. 6: 325–330. Haseloff, J., Siemering, K.R., Prasher, D.C. and Hodge, S. (1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94: 2122–2127. Hinz, G., Hilmer, S., Baumer, M. and Hohl, I. (1999) Vacuolar storage proteins and the putative vacuolar sorting receptor BP-80 exit the Golgi apparatus of developing pea cotyledons in different transport vesicles. Plant Cell 11: 1509–1524. Holwerda, B.C., Padgett, H.S. and Rogers, J.C. (1992) Proaleurain vacuolar targeting is mediated by short contiguous peptide interactions. Plant Cell 4: 307–318. Hood, E.E., Helmer, G.L., Fraley, R.T. and Chilton, M.D. (1986) The hypervirulence of Agrobacterium tumefacience A281 is encoded in a region of pTiBo542 outside of T-DNA. J. Bacteriol. 168: 1291–1301. Inoue, K., Motozaki, A., Takeuchi, Y., Nishimura, M. and Hara-Nishimura, I. (1995) Molecular characterization of proteins in protein-body membrane that disappear most rapidly during transformation of protein bodies into vacuoles. Plant J. 7: 235–243. Jauh, G.Y., Phillips, T.E. and Rogers, J.C. (1999) Tonoplast intrinsic protein isoforms as markers for vacuolar functions. Plant Cell 11: 1867–1882. 1001 Jiang, L. and Rogers, J.C. (1998) Integral membrane protein sorting to vacuoles in plant cells: evidence for two pathways. J. Cell Biol. 143: 1183–1199. Kinoshita, T., Yamada, K., Hiraiwa, N., Nishimura, M. and Hara-Nishimura, I. (1999) Vacuolar processing enzyme is up-regulated in the lytic vacuoles of vegetative tissues during senescence and under various stressed conditions. Plant J. 19: 43–53. Mano, S., Hayashi, M. and Nishimura, M. (1999) Light regulates alternative splicing of hydroxypyruvate reductase in pumpkin. Plant J. 17: 309–320. Matsuoka, K., Higuchi, T., Maeshima, M. and Nakamura, K. (1997) A vacuolar type H+-ATPase in a nonvacuolar organelle is required for the sorting of soluble vacuolar protein precursors in tobacco cells. Plant Cell 9: 533–546. Matsuoka, K. and Nakamura, K. (1991) Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proc. Natl. Acad. Sci. USA 88: 834–838. Matsuoka, K. and Nakamura, K. (1992) Transport of a sweet potato storage protein, sporamin, to the vacuole in yeast cells. Plant Cell Physiol. 33: 453–462. Moriyasu, Y. and Ohsumi, Y. (1996) Autophagy in tobacco suspension-cultured cells in response to sucrose starvation. Plant Physiol. 111: 1233–1241. Nebenführ, A., Gallagher, L.A., Dunahay, T.G., Frohlick, J.A., Mazurkiewicz, A.M., Meehl, J.B. and Staehelin, L.A. (1999) Stop-and-go movements of plant golgi stacks are mediated by the acto-myosin system. Plant Physiol. 121: 1127–1141. Neuhaus, J.-M. and Rogers, J.C. (1998) Sorting of proteins to vacuoles in plant cells. Plant Mol. Biol. 38: 127–144. Neuhaus, J.-M., Sticher, L., Meins, F.J. and Boller, T. (1991) A short C-terminal sequence is necessary and sufficient for the targeting of chitinase to the plant vacuole. Proc. Natl. Acad. Sci. USA 88: 10362–10366. Okita, T.W. and Rogers, J.C. (1996) Compartmentation of proteins in the endomembrane system of plant cells. Annu. Rev. Plant Physiol. 47: 327–350. Paris, N., Rogers, A.W., Jiang, L., Kirsch, T., Beevers, L., Phillips, T.E. and Rogers, J.C. (1997) Molecular cloning and further characterization of a probable plant vacuolar sorting receptor. Plant Physiol. 115: 29–39. Paris, N., Stanley, C.M., Jones, R.L. and Rogers, J.C. (1996) Plant cells contain two functionally distinct vacuolar compartments. Cell 85: 563–572. Robinson, D.G. and Bäumer, M. (1998) Vesicle transfer of storage proteins to the vacuole: the role of the Golgi apparatus and multivesicular bodies. J. Plant Physiol. 152: 659–667. Robinson, D.G., Hoh, B., Hinz, G. and Jeong, B.-K. (1995) One vacuole or two vacuoles: Do protein storage vacuoles arise de novo during pea cotyledon development? J. Plant Physiol. 145: 654–664. Rogers, J.C. (1998) Compartmentation of plant cell proteins in separate lytic and protein storage vacuoles. J. Plant Physiol. 152: 653–658. Saito, T., Niwa, Y., Ashida, H., Tanaka, K., Kawamukai, M., Matsuda, H. and Nakagawa, T. (1999) Expression of a gene for cyclophoilin which contains an amino-terminal endoplasmic reticulum-tergeting signal. Plant Cell Physiol. 40: 77–87. Sanderfoot, A.A., Ahmed, S.U., Marty-Mazars, D., Rapoport, I., Kirchhausen, T., Marty, F. and Raikhel, N.V. (1998) A putative vacuolar cargo receptor partially colocalyzes with AtPEP12p on a prevacuolar compartment in Arabidopsis roots. Proc. Natl. Acad. Sci. USA 95: 9920–9925. Sansebastiano, G.-P.D., Paris, N., Marc-Martin, S. and Neuhaus, J.-M. (1998) Specific accumulation of GFP in a non-acidic vacuolar compartment via a Cterminal propeptide-mediated sorting pathway. Plant J. 15: 449–457. Shimada, T., Kuroyanagi, M., Nishimura, M. and Hara-Nishimura, I. (1997) A pumpkin 72-kDa membrane protein of precursor accumulating vesicles has characteristics of a vacuolar sorting receptor. Plant Cell Physiol. 38: 1414– 1420. (Received July 7, 2000; Accepted July 28, 2000)