Download Functional characterization of polypeptide release factor 1b in the

Biosci. Rep. (2010) / 30 / 425–431 (Printed in Great Britain) / doi 10.1042/BSR20090154
Functional characterization of polypeptide release
factor 1b in the ciliate Euplotes
Yan WANG, Baofeng CHAI1 , Wei WANG and Aihua LIANG
Key Laboratory of Chemical Biology and Molecular Engineering of The Ministry of Education, Institute of Biotechnology, Shanxi University,
Taiyuan 030006, People’s Republic of China
'
$
Synopsis
In higher eukaryotes, RF-I (class I release factor) [eRF1 (eukaryotic release factor 1)] is responsible for stop codon
recognition and promotes nascent polypeptide release from the ribosome. Interestingly, two class I RFs, eRF1a and
eRF1b, have been identified among the ciliates Euplotes, which are variant code organisms. In the present study,
we analysed the comparative expression of eRF1a and eRF1b in Euplotes cells, demonstrating that the expression
of eRF1b was higher than that of eRF1a. An interaction between eRF1b and eRF3 was confirmed, suggesting that
an eRF1b function is facilitated by eRF3. Co-localization of both eRF1s indicated that they function in the same
subcellular location in Euplotes cells. We also analysed the characteristics of stop codon discrimination by eRF1b.
Like eRF1a, eRF1b recognized UAA and UAG as stop codons, but not UGA. This finding disagreed with the deduced
characteristics of eRF1a/eRF1b from the classic hypothesis of ‘anticodon-mimicry’ proposed by Muramatsu et al.
[Muramatsu, Heckmann, Kitanaka and Kuchino (2001) FEBS Lett. 488, 105–109]. Mutagenesis experiments indicated that the absolutely conserved amino acid motif ‘G31 T32 ’ (numbered as for human eRF1) in eRF1b was the key
to efficient stop codon recognition by eRF1b. In conclusion, these findings support and improve the ‘cavity model’ of
stop codon discrimination by eRF1 proposed by Bertram et al. [Bertram, Bell, Ritchie, Fullerton and Stansfield (2000)
RNA 6, 1236–1247] and Inagaki et al. [Inagaki, Blouin, Doolittle and Roger (2002) Nucleic Acids Res. 30, 532–544].
Key words: ciliate, comparative expression level, eukaryotic release factor 1a (eRF1a), eRF1b, Euplotes, stop
codon recognition
&
INTRODUCTION
Termination of protein biosynthesis occurs when the ribosome
elongation machinery encounters a termination codon. Two interacting polypeptide RFs (release factors) are required to complete protein biosynthesis in eukaryotes. One is codon-specific
RF-I (class I release factor), which is responsible for stop codon
recognition by the interacting protein–RNA and promotes hydrolysis of the ester bond linking the polypeptide chain with the
peptidyl site tRNA [1,2]; the other is codon-non-specific RF-II
(class II release factor), which acts as a GTPase. The presence
of two types of RF ensures efficient stop codon recognition and
fast polypeptide release [3]. In prokaryotes, there are two class I
RFs: RF1 and RF2. RF1 recognizes UAA/UAG by means of three
linear amino acids, Pro-Ala-Thr (PAT), whereas RF2 recognizes
UAA/UGA through Ser-Pro-Phe (SPF) [4,5]. In higher eukaryotes, there is only one RF-I, eRF1 (eukaryotic release factor 1),
which can decode all three stop codons [6–8].
%
The crystal structure of human eRF1 shows that it consists
of three domains (N, M and C) [9]. Results from computational
analyses, mutational and biochemical studies indicate that some
highly conserved amino acid motifs in the N domain, such as
‘NIKS’ and ‘YxCxxxF’, are important in stop codon recognition
[10–13]. A recent study suggested that stop codon recognition by
eRF1 is determined or affected by conformational change driven
by binding to eRF3 [14]. Collectively, different from the linear
model in prokaryotes [4], stop codon recognition in eukaryotes
is modulated by positive and negative determinants including
conformational change of eRF1 upon the formation of the eRF1–
eRF3–GTP complex. The conformational change in eRF1 leads
to a change in the relative positions of the amino acids that are
responsible for stop codon recognition through the formation of
hydrogen bonds [10]. The ‘cavity model’ proposed by Bertram
et al. [10] and Inagaki et al. [12] suggested that the three stop
codons each bound to one of the three pockets (P1, P2 and P3)
on the surface of the N-terminal domain of eRF1, to enable stop
codon recognition.
.................................................................. ............................................................. ................................................................. .............................................................. ..............................................
Abbreviations used: 5-FOA, 5-fluoro-orotic acid; GFP, green fluorescent protein; qRT–PCR, quantitative real time–PCR; RF, release factor; eRF, eukaryotic RF; RF-I, class I RF; RFP, red
fluorescent protein
1 To whom correspondence should be addressed (email [email protected]).
www.bioscirep.org / Volume 30 (6) / Pages 425–431
425
Y. Wang and others
Variant code organisms are organisms that deviate from the
standard genetic code. These include many ciliate species, in
which one or more stop codons have been reassigned. For example, the ciliates Euplotes reassign UGA to a cysteine codon
and retain UAA and UAG as stop codons. Interestingly, Euplotes octocarinatus, which is a member of Euplotes, has two
genes encoding class I RFs: eRF1a and eRF1b [15]. The function of eRF1a has been characterized by in vivo assays [16].
In the present study, we measured the comparative expression levels of eRF1b and eRF1a in E. octocarinatus cells using qRT–PCR (quantitative real time–PCR). The high expression level of eRF1b indicates that it may play the primary role
in the termination process of protein biosynthesis. An interaction between eRF1b and eRF3 was confirmed, and the activity
and key motifs for stop codon recognition by eRF1b were
determined using in vivo assays. Besides the motifs previously determined [17], the completely conserved ‘GT’ motif at
amino acids 27 and 28 of eRF1b is also key to determining the
activity of eRF1b. Cellular co-localization studies suggested that
both eRF1s had a similar function in E. octocarinatus.
MATERIALS AND METHODS
Cell cultivation
E. octocarinatus cells were grown in synthetic medium SMB-III
(1.5 mM NaCl, 0.05 mM KCl, 0.4 mM CaCl2 , 0.05 mM MgCl2 ,
0.05 mM MgSO4 and 2 mM sodium phosphate buffer, pH 6.8) in
flasks as described by Schulze Dieckhoff et al. [18]. The photosynthetic flagellate Chlorogonium elongatum was used as a food
source.
Plasmids, oligonucleotides and strains
All plasmids, oligonucleotides and strains used are listed in
supplementary Tables S1 and S2 at http://www.bioscirep.org/
bsr/030/bsr0300425add.htm.
Hybrid gene construction and mutagenesis
The eRF1b gene (GenBank® accession no. AF245454) of
E. octocarinatus was used to construct a hybrid E. octocarinatus/Saccharomyces cerevisiae eRF1 gene containing domain
N (1–137 amino acids) of E. octocarinatus eRF1b and domains
M and C of the S. cerevisiae SUP45 gene, and was named Eob/Sc
eRF1. The Eob/Sc eRF1 gene was subcloned into pDB948 [16],
substituting the eRF1a gene between the SalI and XhoI sites,
yielding the plasmid pDBF001. The amino acid mutagenesis
of G27 K/S and T28 R/I in eRF1b was carried out according to
the protocol for the QuikChange® Site-Directed Mutagenesis kit
(Stratagene).
Analysis of gene expression levels
The comparative expression levels of eRF1a and eRF1b were
evaluated by qRT–PCR. In brief, total RNA from E. octocarinatus
was extracted from cultured cells and was used to generate cDNA
by reverse transcription with a PrimeScriptTM RT reagent kit
(TaKaRa, Dalian, China). The resulting cDNA was amplified
by PCR with a SYBR® PrimeScriptTM RT–PCR kit (TaKaRa)
using the CFX96® Real-Time system (Bio-Rad, California, CA,
U.S.A.). Standard curves that were used to determine the PCR
efficiency for each primer set were conducted on 100 ng of cDNA,
which was serially diluted five times from 1:10 to 1:100 000.
Primers were used at 200 nM, giving a PCR efficiency of between
90 and 110%. S. cerevisiae eRF1 depletion experiments were
performed following the protocol of Salas-Marco et al. [16] to
ensure that the eRF1b and its mutants were the sole source of
eRF1. The relative expression levels of wild-type Sc eRF1 and
hybrid Eob/Sc eRF1 were analysed by qRT–PCR before and after
a galactose-to-glucose shift.
Viability assays and dual luciferase read-through
assays
The S. cerevisiae strain YDB447 and dual luciferase readthrough reporter plasmids were kindly provided by David M.
Bedwell (Department of Microbiology, University of Alabama at
Birmingham, Birmingham, AL, U.S.A.). The viability assays and
dual luciferase read-through assays followed the Bedwell Laboratory protocols [16]. A plasmid shuffle technique was used to assess whether the Eob/Sc eRF1 constructs could support viability
of yeast cells as the only source of eRF1 in the cell. The strains
were streaked on to plates containing 5-FOA (5-fluoro-orotic
acid), which inhibits the growth of cells expressing the URA3
gene but allows the growth of cells that have lost pUKC802. The
SUP45(eRF1) strain (YDB447) containing co-expressed wildtype Sc eRF1 under the control of the GAL promoter (pDB967)
and the hybrid Eob/Sc eRF1 under the control of the SUP45
promoter were grown in SM galactose medium (0.67% yeast nitrogen base without amino acids, 0.11 mM galactose, 7.41 mM
Ade, 12.9 mM His, 20.5 mM Lys, 13.4 mM Met, 24.5 mM Trp,
16.6 mM Tyr and 17.8 mM Ura) for several generations at 30◦ C.
During mid-exponential growth, the cells were harvested and
resuspended in SM glucose medium at a cell density of A600
0.01/ml. After approximately six generations, cells were harvested and assayed for read-through levels using a dual luciferase
assay kit (Promega).
RESULTS AND DISCUSSION
Interaction between eRF1b and eRF3
The formation of the eRF1–eRF3–GTP complex is a precondition of effective and quick translation termination in eukaryotes
[19]. The stop codon recognition and hydrolysis of the ester
bonds of peptidyl-tRNA by eRF1 require a particular conformational change in eRF1, which is promoted by its binding to eRF3
[14]. The interaction between eRF1a and eRF3 of E. octocarinatus has been confirmed in vivo and in vitro [20], suggesting
that stop codon recognition by eRF1a in Euplotes cells is facilitated by eRF3. In the current study, we demonstrated that eRF1b
also interacts with eRF3 in vivo using a yeast two-hybrid assay
..........................................................................................................................................................................................................................................................................................................................................................................
426
C The
Authors Journal compilation
C 2010
Biochemical Society
Functional characterization of polypeptide release factor 1b
Figure 1 Analysis of the interaction between eRF1 and eRF3 using
yeast two-hybrid analysis
The previously confirmed interaction between Euplotes eRF1a and eRF3
was used as the control.
(Figure 1). This suggests that eRF1b also needs to cooperate
with eRF3 to ensure efficient stop codon recognition and fast
polypeptide release.
Comparison of eRF1a and eRF1b expression in
E. octocarinatus
To determine the transcript levels of the eRF1a and eRF1b genes,
we designed two pairs of primers using unique sequences that
would not cross-react, and performed real-time qPCR on prepared cDNA from Euplotes cells. The results showed that the
transcription level of eRF1b was 16-fold higher than that of
eRF1a (Figure 2).
A previous study showed that two genes encode two distinct
forms of eRF3, eRF3a and eRF3b in mammals. Both bind eRF1
and stimulate its release activity in vitro. However, the eRF3b
protein was barely detected in the embryonic stages in mouse
brain, while eRF3a was continuously expressed [21]. La Terza
et al. [22] reported that, in ciliates, the expression level of a
gene was determined by its copy number in the macronucleus. In
Euplotes, both eRF1a and eRF1b, 79% identical in sequence, are
expressed in the macronucleus and have an equal copy number
of about 27000 [15]. Therefore, the different transcription levels
indicate that eRF1b may play the primary role and infer that copy
number is not the sole determinant of expression level in ciliates.
Interestingly, the two E. octocarinatus RF-I genes, eRF1a
and eRF1b, recognize UAA and UAG (assayed below), meaning
that their functions are similar to RF1 in bacteria, which binds
UAA and UAG. However, sequence similarity between RF1 in
bacteria and eRF1a/eRFb in Euplotes is difficult to detect. Therefore, it is unclear whether they have an evolutionary relationship.
Figure 2 Comparative expression level determination of eRF1a
and eRF1b genes by quantitative real-time PCR
Equal amounts of eRF1a and eRF1b cDNA were used as templates,
and amplification of a fragment of the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) gene (D3702; TaKaRa) was used as the internal
control. The values are represented as means +
− SEM.
Localization of eRF1a and eRF1b in E. octocarinatus
To verify the intracellular localization of eRF1b and eRF1a
in Euplotes cells, eRF1a and eRF1b were subcloned into
the plasmids pBTub-Tel [23] and pDsRed1-N1-Tel, containing
EoMAC-G and EoMAC-R respectively, and then transfected into
E. octocarinatus cells using a LipofectamineTM 2000 kit (Invitrogen) [23]. The distributions of the fusion proteins eRF1a–GFP
(green fluorescent protein) and eRF1b–RFP (red fluorescent protein) in Euplotes cells were observed using a laser confocal microscope (Leica, Germany). We found that both eRF1s were mainly
distributed on the inner side of the ‘C’-shaped macronucleus (Figure 3). This is consistent with the distribution of the endoplasmic
reticulum that connects to the nuclear membrane to generate a
field for protein biosynthesis. The shared localization indicates
that eRF1a and eRF1b probably have the same function in cells,
i.e. protein biosynthesis.
Stop codon recognition activity of eRF1b
It has been demonstrated that domain N of E. octocarinatus
eRF1a was sufficient to recapitulate variant stop codon recognition [16]. In the present study, we fused domain N of Euplotes
eRF1b to domains M and C of S. cerevisiae eRF1, and the resulting hybrid protein (Eob/Sc eRF1) was assessed for its ability
to complement a knockout of the essential SUP45 (yeast eRF1)
gene. The YDB447/pUKC802/Eob/Sc eRF1 transformants were
streaked on a 5-FOA plate for plasmid shuffle assays. The results demonstrated that the hybrid protein Eob/Sc eRF1 could not
support the viability of transformants as the sole source of eRF1
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 30 (6) / Pages 425–431
427
Y. Wang and others
Figure 3 Co-localization of eRF1a and eRF1b in E. octocarinatus
(Eo) cells
Euplotes cells were transfected with eRF1a–GFP and eRF1b–RFP. The
nuclei were stained with DAPI (4 ,6 -diamino-2-phenylindole). Green,
eRF1a; red, eRF1b; blue, DAPI. The merged image shows the colocalization of eRF1a and eRF1b on the inner side of the macronucleus.
in yeast cells (Figure 4a). This suggests that hybrid eRF1 cannot
recognize all three stop codons UAA, UAG and UGA to correctly
complete the termination process of protein biosynthesis.
The read-through assay was performed to address why Eob/Sc
eRF1 could not support the viability of the above yeast cells.
The hybrid gene Eob/Sc eRF1 was transformed into yeast strain
YDB447 containing the support plasmid pDB967 (wild-type
SUP45) and a dual luciferase reporter (the Firefly and Renilla
luciferase genes separated by three stop codons). The results
demonstrated that eRF1b exhibited low read-through (<2%) at
UAA and UAG stop codons, but > 10% read-through at UGA
codons (Figure 4b). As the positive control, Sc eRF1 recognized
all stop codons, with a read-through lower than 1%, while the
negative control, eRF1 depletion, showed read-through at UAA,
UAG and UGA of approx. 7, 12 and 16% respectively. In other
words, eRF1b could not accomplish recognition of all termination codons, leading to cell growth that slowed considerably
after a carbon source shift (results not shown). These results indicate that, similar to eRF1a, eRF1b might reassign UGA as a
sense codon, while retaining UAA and UAG as stop codons. This
is inconsistent with a previous ‘anticodon mimicry model’ proposed by Muramatsu et al. [24]. According to this model, the
amino acid residues 57/58 and 60/61 of eRF1s (numbered as for
human eRF1) are proposed to be responsible for stop codon recognition in protein synthesis by interacting with the second and
the third positions of the stop codon respectively. In addition, it
also suggests that the α2-helix is able to assume a partly relaxed
or tight conformation depending on the stop codon recognition
[24]. Specifically, the unconventional Tetrahymena eRF1 could
only recognize UGA as a stop codon. However, experimental results indicated that the N-terminal domain of Tetrahymena eRF1
was not the sole determinant of stop codon recognition [16]. On
the other hand, the model presumed that another unconventional
eRF1a, in Euplotes, was specific only for UAA, and that eRF1b
was specific for UAA and UAG, with only poor recognition of
the UAG stop codon. This assumption is contradicted by experimental results that both eRF1a and eRF1b use UAA and UAG
as stop codons equally [16,17]. In conclusion, our results found
that this model cannot be correct.
To confirm that S. cerevisiae eRF1 was depleted following the
carbon source shift, we carried out real-time qRT–PCR to examine the steady transcript level of the eRF1s in cells. Total RNAs
were prepared before and after a culture shift from galactose
to glucose and continuing cultivation for six generations. We
found that, in the galactose-grown cultures, the expression levels
of Eob/Sc eRF1 under the control of the SUP45 promoter YCplac111 and Sc eRF1 under the control of the GAL promoter were
relatively high in transformed cells indicated as Gal690/Eu1b and
Gal691/Eu1b in Figure 4(c). After six generations of growth with
glucose as the carbon source, the level of Sc eRF1 under the control of the GAL promoter was reduced to approx. 0 (the control
level), while the expression level of Eob/Sc eRF1 under the control of the SUP45 promoter YCplac111 increased (indicated as
Glu690/Eu1b and Glu691/Eo1b in Figure 4c). This indicates the
efficient depletion of wild-type Sc eRF1 and the high expression
level of hybrid eRF1 in carbon source-shifted cells.
‘GT’ mutations reduce stop codon recognition
by eRF1b
It has been suggested that highly conserved amino acid motifs in
standard code organisms might represent key residues that mediate stop codon recognition [17,25]. Computational analysis of
the amino acid sequences of eRF1 from standard code and variant
code organisms has demonstrated that there are three absolutely
conserved motifs (‘G31 T32 ’, ‘I61 K62 S63 ’ and ‘Y125 xC127 xxxF131 ’,
numbered as for human eRF1) in the N-terminal domain of eukaryotic RF-I [13]. Many experimental results have confirmed that
the TASNIKS and YxCxxxF motifs are implicated in stop codon
recognition [17]. In the present study, we performed mutagenesis
studies on the ‘G27 T28 ’ motif in Euplotes eRF1b. Considering the
charge and size of the amino acids, we carried out three double
mutations (G27 K/T28 R, G27 S/T28 I and G27 S/T28 R) in eRF1b. The
non-polar, hydrophobic amino acid glycine and the uncharged
threonine were substituted by the polar and positively charged
amino acids lysine and arginine.
Viability assays indicated that cells could not grow when expressing the mutants as the sole source of eRF1 (Figure 4a),
suggesting that the mutations did not alter the codon specificity
of eRF1b. We then conducted experiments to test the stop codon
discrimination activity of the mutants, using dual luciferase readthrough assays. Results showed that the read-through rate of all
mutants at the three stop codons was higher than that of wildtype eRF1b (Figure 4b). The read-through efficiency of mutant
GT/KR was 2-fold higher at UAG and increased by approx. 30%
..........................................................................................................................................................................................................................................................................................................................................................................
428
C The
Authors Journal compilation
C 2010
Biochemical Society
Functional characterization of polypeptide release factor 1b
Figure 4
Efficiency of stop codon recognition mediated by Eob/Sc eRF1 and mutant Eob/Sc G27 K/S and T28 R/I eRF1
(a) Plasmid shuffling assay to test the ability of hybrid Eob/Sc eRF1 wild-type and mutant proteins to support cell
viability. Strains were streaked on SM glucose plates supplemented with 5-FOA to select colonies that had lost the
URA3-based plasmids carrying wild-type eRF1. Streak growth indicates that the hybrid Eob/Sc eRF1 could not support
cell viability. (b) Read-through levels of Sc-eRF1 as positive control, hybrid wild-type (WT) Eob/Sc eRF1 and mutant Eob/Sc
G27 K/T28 R eRF1, Eob/Sc G27 S/T28 R eRF1 and Eob/Sc G27 S/T28 I eRF1. The negative control strain carried SUP45 under
the control of the GAL promoter. Read-through tests in strains carrying Eob/Sc eRF1 and its mutants that cannot support
cell growth as the sole source of eRF1 were carried out using a carbon source shift procedure. Read-through values
are represented as means +
− SD. (c) Analysis of expression levels of the indicated eRF1s in yeast cells before and
after carbon source shift, using quantitative real-time PCR. Glu690/Eu1b and Glu691/Eu1b indicate the hybrid Eob/Sc
eRF1 transformed strains YDB447/pDB690CGA /pDB967/pDBF001 and YDB447/pDB691UGA /pDB967/pDBF001 grown
in galactose medium respectively. Glu690/Eu1b and Glu691/Eu1b are the strains grown on glucose medium. Gal800/690
and Gal800/691, and Glu800/690 and Glu800/691, indicate the positive controls containing the wild-type SUP45 gene
under the control of the SUP45 promoter, before and after carbon source shift respectively. Gal967/690 and Gal967/691,
and Glu967/690 and Glu967/691, indicate the negative controls containing the SUP45 gene under the control of the GAL
promoter, before and after carbon source shift respectively. The values are represented as means +
− SEM.
at UGA codons, compared with wild-type eRF1b. In addition, the
read-through level of GT/SI and GT/SR was increased 2-fold at
UAA and UAG, and considerably increased at UGA (Figure 4b).
Based on our results, we suggest that the conserved ‘GT’
motif in eRF1 plays a key role in stop codon recognition. Specifically, in the model of Bertram et al. [10], it was proposed that the
three pockets on the surface of the N-terminal domain, composed
by a range of amino acids, bind with the three bases of stop
codon respectively [10] (Figure 5b). Bedwell and co-workers
strengthened this model by pointing out crucial function of C127
positioned between P2 and P3 [17]. Inagaki et al. [12] favoured
the model proposed by Bertram et al. [10], but they suggested the
stop codon may bind in the opposite orientation to the original
model [12] (Figure 5c). Our results show that the ‘GT’ located
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 30 (6) / Pages 425–431
429
Y. Wang and others
Figure 5
Cavity models of stop codon recognition by eukaryotic eRF1
The N-terminal domain of eRF1 is shown in a space-filling model. (a) Entire three-dimensional structure of the human
eRF1. The coordinate data are from the Protein Data Bank (human eRF1:1DT9) and displayed using the Cn3D program
version for 4.1 Windows (http://www.ncbi.nlm.nih.gov). The N domain of the eRF1 is shown in white, while the M and C
domains are shown in black. (b) Residues marked with M51 , V71 , S123 , L126 , D128 and H132 constitute the three pockets and
are presumably involved in contacting the bases of stop codons. This cavity model was proposed by Bertram et al. [10].
(c) M51 , E55 , V71 , S123 , Y125 , L126 , D128 , C127 and H132 constitute the three pockets and are presumably involved in
contacting the bases of stop codons. This cavity model was proposed by Inagaki et al. [12]. Residues marked with G31 ,
T32 , bold typeface were subjected to mutagenesis in this study. The black circles with white numbers (1, 2 and 3) indicate
the three pockets composed of the circled residues. 1st, 2nd and 3rd indicate the stop codon base number that binds to
each pocket. The white broken line indicates the hydrogen bond formed between Thr32 and Asn67 . The residue designations
and numbering correspond to human eRF1 (+4 relative to Euplotes eRF1).
directly between P2 and P3 is involved in the recognition by
maintaining the conformational stability of eRF1 and restricting
the relative positions of P2 and P3 in the cavity model (Figures 5b
and 5c). Firstly, the hydrogen bonds formed between Thr31 and
Asn67 , and between Ser33 and Ser70 , help to maintain a stable
size and orientation of P2 and P3, which are in close proximity
to each other. The hydrophobicity of the amino acids glycine and
threonine might also be responsible for this. In addition, because
glycine is the smallest amino acid, it can facilitate the formation of
corners or curves in protein secondary structure. The substitution
of small amino acids by large ones might lead to a change of
pocket size, therefore affecting the binding between amino acids
and the bases of stop codons [26]. Second, Hatin et al. [26] pointed
out that the electrostatic charge of amino acids could affect the
binding to the rRNA. Our results demonstrated that a change
from the non-polar and uncharged amino acids G31 T32 to positive
amino acids decreased the termination efficiency, suggesting that
a change in environment for the specific interaction between
the nucleotides of stop codons and particular amino acids might
influence the entry of stop codons to P2 and P3.
plotes eRF1b interacted with eRF3, which is a precondition to
accomplish the termination of protein biosynthesis. The introduction of point mutations proved that the highly conserved motif
‘GT’ is essential for stop codon recognition by eRF1. Our findings also strengthen the assertions of a previous study that the
‘cavity model’ is the most suitable explanation of stop codon
recognition.
ACKNOWLEDGMENTS
We thank David M Bedwell (Alabama University at Birmingham, AL,
U.S.A.) for providing the yeast strains and dual luciferase reporter
gene constructs.
FUNDING
This work was supported by grants from The National Natural
Scientific Foundation of China [Nos. 30770294, 30670282 and
30940043] and The Natural Scientific Foundation of Shanxi [No.
2009011040-1].
REFERENCES
CONCLUSION
Accumulating evidence strongly supports a key role for Euplotes
eRF1b as the main RF-I in protein translation termination. First,
eRF1a and eRF1b recognized stop codons UAA and UAG, but
reassigned UGA as cysteine. However, the expression level of
eRF1b was much higher than that of eRF1a. In addition, Eu-
1
2
Ito, K., Ebihara, K., Uno, M. and Nakamura, Y. (1996) Conserved
motifs in prokaryotic and eukaryotic polypeptide release factors:
tRNA-protein mimicry hypothesis. Proc. Natl. Acad. Sci. U.S.A. 93,
5443–5448
Nakamura, Y., Ito, K. and Isaksson, L. A. (1996) Emerging
understanding of translation termination. Cell 87, 147–150
..........................................................................................................................................................................................................................................................................................................................................................................
430
C The
Authors Journal compilation
C 2010
Biochemical Society
Functional characterization of polypeptide release factor 1b
3 Zhouravleva, G., Frolova, L., Le Goff, X., Le Guellec, R.,
Inge-Vechtomov, S., Kisselev, L. and Philippe, M. (1995)
Termination of translation in eukaryotes is governed by two
interacting polypeptide chain release factors, eRF1 and eRF3.
EMBO J. 14, 4065–4072
4 Ito, K., Uno, M. and Nakamura, Y. (2000) A tripeptide ‘anticodon’
deciphers stop codons in messenger RNA. Nature 403, 680–684
5 Nakamura, Y. and Ito, K. (2002) A tripeptide discriminator for stop
codon recognition. FEBS Lett. 514, 30–33
6 Frolova, L., Le Goff, X., Rasmussen, H. H., Cheperegin, S.,
Drugeon, G., Kress, M., Arman, I., Haenni, A. L., Celis, J. E.,
Philippe, M. et al. (1994) A highly conserved eukaryotic protein
family possessing properties of polypeptide chain release factor.
Nature 372, 701–703
7 Drugeon, G., Jean-Jean, O., Frolova, L., Le Goff, X., Philippe, M.,
Kisselev, L. and Haenni, A. L. (1997) Eukaryotic release factor 1
(eRF1) abolishes readthrough and competes with suppressor
tRNAs at all three termination codons in messenger RNA. Nucleic
Acids Res. 25, 2254–2258
8 Kisselev, L., Ehrenberg, M. and Frolova, L. (2003) Termination of
translation: interplay of mRNA, rRNAs and release factors EMBO J.
22, 175–182
9 Song, H., Mugnier, P., Das, A. K., Webb, H. M., Evans, D. R., Tuite,
M. F., Hemmings, B. A. and Barford, D. (2000) The crystal structure
of human eukaryotic release factor eRF1 – mechanism of stop
codon recognition and peptidyl-tRNA hydrolysis. Cell 100, 311–321
10 Bertram, G., Bell, H. A., Ritchie, D. W., Fullerton, G. and Stansfield,
I. (2000) Terminating eukaryote translation: domain 1 of release
factor eRF1 functions in stop codon recognition. RNA 6,
1236–1247
11 Frolova, L., Seit-Nebi, A. and Kisselev, L. (2002) Highly conserved
NIKS tetrapeptide is functionally essential in eukaryotic translation
termination factor eRF1. RNA 8, 129–136
12 Inagaki, Y., Blouin, C., Doolittle, W. F. and Roger, A. J. (2002)
Convergence and constraint in eukaryotic release factor 1 (eRF1)
domain 1: the evolution of stop codon specificity. Nucleic Acids
Res. 30, 532–544
13 Liang, H., Wong, J. Y., Bao, Q., Cavalcanti, A. R. and Landweber,
L. F. (2005) Decoding the decoding region: analysis of eukaryotic
release factor (eRF1) stop codon-binding residues. J. Mol. Evol.
60, 337–344
14 Cheng, Z., Saito, K., Pisarev, A. V., Wada, M., Pisareva, V. P.,
Pestova, T. V., Gajda, M., Round, A., Kong, C., Lim, M. et al. (2009)
Structural insights into eRF3 and stop codon recognition by eRF1.
Genes Dev. 23, 1106–1118
15 Liang, A., Brunen-Nieweler, C., Muramatsu, T., Kuchino, Y., Beier,
H. and Heckmann, K. (2001) The ciliate Euplotes octocarinatus
expresses two polypeptide release factors of the type eRF1. Gene
262, 161–168
16 Salas-Marco, J., Fan-Minogue, H., Kallmeyer, A. K., Klobutcher,
L. A., Farabaugh, P. J. and Bedwell, D. M. (2006) Distinct paths to
stop codon reassignment by the variant-code organisms
Tetrahymena and Euplotes. Mol. Cell Biol. 26, 438–447
17 Fan-Minogue, H., Du, M., Pisarev, A. V., Kallmeyer, A. K.,
Salas-Marco, J., Keeling, K. M., Thompson, S. R., Pestova, T. V.
and Bedwell, D. M. (2008) Distinct eRF3 requirements suggest
alternate eRF1 conformations mediate peptide release during
eukaryotic translation termination. Mol. Cell 30, 599–609
18 Schulze Dieckhoff, H., Freiburg, M. and Heckmann, K. (1987) The
isolation of gamones 3 and 4 of Euplotes octocarinatus. Eur. J.
Biochem. 168, 89–94
19 Inge-Vechtomov, S., Zhouravleva, G. and Philippe, M. (2003)
Eukaryotic release factors (eRFs) history. Biol. Cell 95,
195–209
20 Song, L., Chai, B. F., Wang, W. and Liang, A. H. (2006)
Identification of translational release factor eRF1a binding
sites on eRF3 in Euplotes octocarinatus. Res. Microbiol. 157,
842–850
21 Chauvin, C., Salhi, S., Le Goff, C., Viranaicken, W., Diop, D. and
Jean-Jean, O. (2005) Involvement of human release factors eRF3a
and eRF3b in translation termination and regulation of the
termination complex formation. Mol. Cell. Biol. 25, 5801–5811
22 La Terza, A., Miceli, C. and Luporini, P. (1995) Differential
amplification of pheromone genes of the ciliate Euplotes raikovi.
Dev. Genet. 17, 272–279
23 Li, N., Chai, B., Wang, J. and Liang, A. (2009) Construction of an
Euplotes octocarinatus macronuclear artificial chromosome
harboring codon-optimized EGFP gene. Chin. J. Biochem. Mol. Biol.
25, 436–441
24 Muramatsu, T., Heckmann, K., Kitanaka, C. and Kuchino, Y. (2001)
Molecular mechanism of stop codon recognition by eRF1: a wobble
hypothesis for peptide anticodons. FEBS Lett. 488, 105–109
25 Kim, O. T., Yura, K., Go, N. and Harumoto, T. (2005) Newly
sequenced eRF1s from ciliates: the diversity of stop codon usage
and the molecular surfaces that are important for stop codon
interactions. Gene 346, 277–286
26 Hatin, I., Fabret, C., Rousset, J. P. and Namy, O. (2009)
Molecular dissection of translation termination mechanism
identifies two new critical regions in eRF1. Nucleic Acids Res. 37,
1789–1798
Received 11 November 2009/28 January 2010; accepted 8 February 2010
Published as Immediate Publication 8 February 2010, doi 10.1042/BSR20090154
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 30 (6) / Pages 425–431
431
Biosci. Rep. (2010) / 30 / 425–431 (Printed in Great Britain) / doi 10.1042/BSR20090154
SUPPLEMENTARY ONLINE DATA
Functional characterization of polypeptide release
factor 1b in the ciliate Euplotes
Yan WANG, Baofeng CHAI1 , Wei WANG and Aihua LIANG
Key Laboratory of Chemical Biology and Molecular Engineering of The Ministry of Education, Institute of Biotechnology, Shanxi University,
Taiyuan 030006, People’s Republic of China
Table S1 Oligonucleotides used in the study
Underlining shows restriction enzymes, and bold nucleotides represent mutation sites.
Code
Sequence of oligonucleotides (5 –3 )
Purpose
BF44
GCCGUGTCGACUATGGCAAAGCTTGACGACAACGTTGAAAC
Cloning of the N-terminal domain encoding the gene of
Euplotes eRF1b
BF45
GCGCUCTCGAGUTTCTAGTAACTCAAAGAGTGGCTCA
BF46
AGCTGGUCCATGGUTCATGGCAAAGCTTGACGACAACGTTGAAAC
BF47
CCGGUCTTAAGUTGATTATATAAAGTCTTCGTCTGGG
BF48
CGGCUGAATTCUTGATGGCAAAGCTTGACGACAACGTTGAAAC
BF49
CGGTUGGATCCUGCTATAAAGTCTTCGTCTGGG
BF52
GCTTAGAGGAGATAAAAGAAGCATGATTC
BF53
GAAATCATGCTTCTTTTATCTCCTCTAAGC
BF54
GCTTAGAGGAGATAGCTTAAGCATGATTTC
BF55
GAAATCATGCTTAAGCTATCTCCTCTAAGC
BF56
GCTTAGAGGAGATAGCAGAAGCATGATTC
BF57
GAAATCATGCTTCTGCTATCTCCTCTAAGC
BF58
CAATTCTCTAGAATTAGGAGCAGTAGGCAC
BF59
GTTTTGATCAATAAAGTACGAATAATTATTGTC
BF60
TCATTCTCTTGAAGTTGGGGCATTAGATCT
BF61
CTCGTTCTTGAAGTATTTTGAATCTTTTTCC
BF62
CTCTAAAGTTCAAGCTATGCTTG
BF63
TGAGTCATCCTCACCAATAACTGT
BF64
TCCACTGTACCAAAAAATGTTAA
BF65
TTTACCATCTTCAGTGATGATATC
Construction of the recombinant plasmid pGBKT7-eRF1b
Construction of the plasmid carrying EoAMC-R-eRF1b
Mutagenesis of G27K/T28R in eRF1b
Mutagenesis of G27S/T28I in eRF1b
Mutagenesis of G27S/T28R in eRF1b
Real-time PCR primers specific to eRF1a
Real-time PCR primers specific to eRF1b
Real-time PCR primers specific to eRF1b to confirm the
expression of eRF1b after carbon source shift
Real-time PCR primers specific to SUP45 to confirm the
expression of SUP45 after carbon source shift
.................................................................. ............................................................. ................................................................. .............................................................. ..............................................
1 To
whom correspondence should be addressed (email [email protected]).
www.bioscirep.org / Volume 30 (6) / Pages 425–431
Y. Wang and others
Table S2 Strains and plasmids used in this study
Designation
Description
Strain YDB447
MAT ura3-52 leu2-3,112 lys2- trp1- his3- suc2-Δ901 melsup45::HIS3 [psi-]
Source
[16]
Plasmids pDB967
YCplac22 carrying GAL1 HA-Sc eRF1, CEN4, TRP1, ampR
[16]
pUKC802
YCplac33 carrying SUP45, HA-Sc eRF1, CEN4, URA3, ampR
[16]
pDB948
YCplac111 carrying SUP45 Eo/Sc eRF1a, CEN4, LEU2, ampR
[16]
pDBF001
YCplac111 carrying SUP45 Eo/Sc eRF1b, CEN4, LEU2, ampR
The present study
pDB690/691
Dual luciferase construct containing CGA and UGA, respectively
[16]
pDB720/721
Dual luciferase construct containing UAG and CAG, respectively
[16]
pDB722/723
Dual luciferase construct containing CAA and UAA, respectively
[16]
pDBF002
pDBF001 carrying Eo/Sc eRF1b, G27K/T28R
The present study
pDBF003
pDBF001 carrying Eo/Sc eRF1b, G27S/T28R
The present study
pDBF004
pDBF001 carrying Eo/Sc eRF1b, G27S/T28I
The present study
pGADT7-eRF3
pGADT7 (Clontech) carrying Euplotes eRF3 gene between BamHI and XhoI
[27]
pGBKT7-eRF1a
pGBKT7 (Clonetech) carrying Euplotes eRF1a gene between BamHI and XhoI
The present study
pBTub-Tel
pEGFP-N1 carrying telomeres and 3 - and 5 -UTR sequences of β-tubulin gene flanked in EGFP gene
[23]
pDsRed1-N1-Tel
pDsRed-N1 carrying telomeres and 3 - and 5 -UTR sequences of β-tubulin gene flanked in RFP gene
The present study
Received 11 November 2009/28 January 2010; accepted 8 February 2010
Published as Immediate Publication 8 February 2010, doi 10.1042/BSR20090154
..........................................................................................................................................................................................................................................................................................................................................................................
C The
Authors Journal compilation
C 2010
Biochemical Society