Download Detection of Five Rare Cystic Fibrosis Mutations Peculiar to

Clinical Chemistry 45:7
957–962 (1999)
Molecular Diagnostics
and Genetics
Detection of Five Rare Cystic Fibrosis Mutations
Peculiar to Southern Italy: Implications in
Screening for the Disease and Phenotype
Characterization for Patients with Homozygote
Mutations
Giuseppe Castaldo,1,2 Antonella Fuccio,1 Cécile Cazeneuve,3 Luigi Picci,4
Donatello Salvatore,5 Valeria Raia,6 Maurizio Scarpa,4 Michel Goossens,3 and
Francesco Salvatore1*
Background: The search for the eight most frequent
mutations (i.e., DF508, G542X, W1282X, N1303K, 17171G3 A, R553X, 2183AA3 G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of
396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic
fibrosis alleles suggested that a few mutations could
account for a large number of unidentified alleles.
Methods: We screened most of the coding sequence of
the cystic fibrosis transmembrane regulator gene by
denaturing gradient gel electrophoresis to determine the
spectrum of these mutations in 68 unrelated cystic
fibrosis patients bearing one or both unidentified mutations.
Results: The screening revealed five mutations, R1158X,
71111G3 T, 4016insT, L1065P, and G1244E, each of
which had a frequency of 1.3–1.8% (7% collectively). The
7% increase in the detection rate (85% vs 78%) reduces
by >50% the residual risk of being cystic fibrosis
carriers for couples who had tested negative by molec-
ular analysis. We therefore designed a second allelespecific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient
homozygous for the L1065P mutation expressed a mild
pulmonary and intestinal form of the disease with
pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype.
Conclusions: Five cystic fibrosis mutations are peculiar
to patients from Southern Italy. The method described
for their analysis is efficient, inexpensive, and can be
semi-automated by use of a robotic workstation. The
results obtained in patients from Southern Italy may
have an impact on laboratories in other countries, given
the large migrations of populations from Southern Italy
to other countries in the last two centuries.
© 1999 American Association for Clinical Chemistry
Cystic fibrosis (CF)7 is the most frequent lethal inherited
disease among Caucasians, having a prevalence of ;1 in
2500 newborns. Since the cloning of the cystic fibrosis
transmembrane regulator (CFTR) gene in 1989 (1–3 ),
.800 mutations have been detected. A few mutations (i.e.,
DF508, N1303K, G542X, and R553X) are frequent worldwide; the other mutations are regional or “private” mutations. Several mutations are peculiar to specific ethnic
groups, i.e., W1282X is frequent among Ashkenazi (4 ),
1
Centro di Ingegneria Genetica scarl and Dipartimento di Biochimica e
Biotecnologie Mediche, Università di Napoli “Federico II”, 80131 Naples, Italy.
2
Facoltà di Scienze, Università del Molise, I-86170 Isernia, Italy.
3
Laboratoire de Biochimie et de Génétique Moléculaire, INSERM U468,
Hôpital Henri-Mondor, F-94010 Créteil, France.
4
Dipartimento di Pediatria, Università di Padova, I-35100 Padua, Italy.
5
Divisione di Pediatria, Ospedale Civile, I-85100 Potenza, Italy.
6
Dipartimento di Pediatria, Università di Napoli “Federico II”, 80131
Naples, Italy.
*Address correspondence to this author at: Dipartimento di Biochimica e
Biotecnologie Mediche, Università di Napoli “Federico II”, via S. Pansini 5,
80131 Napoli, Italy. Fax 39 081 746 3650; e-mail [email protected].
Received January 22, 1999; accepted April 1, 1999.
7
Nonstandard abbreviations: CF, cystic fibrosis; CFTR, cystic fibrosis
conductance regulator; DGGE, denaturing gradient gel electrophoresis; and
ASO, allele-specific oligonucleotide.
957
958
Castaldo et al.: Cystic Fibrosis Mutations Peculiar to Southern Italy
T338I is typical among Sardinians (5 ), and 2183AA3 G
and R1162X are frequent in Northeastern Italy (5 ).
Consequently, to be able to provide the molecular
analysis of CF for diagnostic purposes, laboratories must
know the most frequent mutations in an individual’s
ethnic group. Mutation mapping is fundamental for “cascade” screenings of CF families (6 ), because screening
programs on general populations are limited by the
genetic heterogeneity of the disease.
Similarly, given the migration and genetic mixing that
started at the beginning of this century, awareness of CF
mutations “peculiar” to each ethnic group is necessary to
increase the “detection rate” of CF alleles and to evaluate
correctly the residual risk of being a CF carrier after
molecular analysis. Finally, analysis of the clinical expression of CF patients homozygous for rare mutations can
improve our knowledge of the genotype-phenotype correlation of the disease (7, 8 ).
In a “pilot” study, we identified a panel of the most
frequent mutations in CF patients from Southern Italy (9 ).
Eight mutations led to the identification of ;80% of CF
chromosomes. In the same study, we reported that a few
CF haplotypes, determined by the study of three polymorphisms, were frequently observed on CF chromosomes carrying an unknown mutation. This observation
prompted us to: (a) search for these unidentified mutations by screening most of the coding regions and intronic
boundaries of the CFTR gene, using denaturing gradient
gel electrophoresis (DGGE); and to (b) set up a rapid
detection method to analyze the five most frequent mutations identified through the screening.
first analyzed for eight CF mutations, i.e., DF508, N1303K,
G542X, W1282X, 1717-1G3 A, R553X, 2183AA3 G, and
I148T (9 ). The 68 patients bearing one or both unknown
mutations (88 CF alleles remained uncharacterized) were
screened by DGGE for most of the coding regions and
intronic boundaries of the CFTR gene (excluding the
following exons: 1, 2, 10, 16, and 22). The same patients
were also analyzed for four intragenic (i.e., IVS8CA,
IVS17bTA, IVS17bCA, and M470V) and two extragenic
(i.e., XV2c and KM19) polymorphisms (10 –15 ).
methods
The eight CF mutations (i.e., DF508, N1303K, G542X,
W1282X, 1717-1G3 A, R553X, 2183AA3 G, and I148T)
were identified with a semi-automated procedure based
on a single multiplex PCR amplification followed by the
allele-specific oligonucleotide (ASO) identification we described previously (9 ). XV2c and KM19 polymorphisms
were analyzed by PCR amplification followed by TaqI and
PstI digestion, respectively (10, 11 ). Polymorphisms
IVS8CA (12 ), IVS17bTA, and IVS17bCA (13 ) were identified by PCR amplification followed by polyacrylamide
gel electrophoresis. The DGGE screening of the CFTR
exons was performed as described previously (14, 15 ).
The M470V polymorphism was also analyzed by DGGE
of exon 10 (14, 15 ). The CFTR exons displaying a shift in
the DGGE pattern were sequenced using the Sanger
protocol (16 ) with an automated procedure in which the
four terminator reactions are marked with fluorescent
dideoxynucleotides. The fragments were analyzed with
the 373A apparatus of Applied Biosystems (PerkinElmer).
Patients and Methods
patients
We studied 198 unrelated patients bearing CF, from the
Campania (6 3 106 inhabitants) and Basilicata (1 3 106
inhabitants) regions of Southern Italy at least up to the
second generation. These patients represent the whole
known CF population of the Basilicata region and 85% of
the known CF population of Campania. The diagnosis,
based on clinical data, was always confirmed by the sweat
analysis of chloride (cutoff, 60 mEq/L). All patients were
aso dot-blot procedure for the analysis of the
five “rare” cf mutations
To analyze routinely the five mutations (i.e., L1065P,
71111G3 T, R1158X, 4016insT, and G1244E) we set up a
procedure based on a single multiplex PCR amplification
followed by ASO dot-blot hybridization. The amplification was performed using the primers shown in Table 1,
in a mixture (50 mL) containing the following: 50 mmol/L
KCl, 10 mmol/L Tris-HCl (pH 8.5), 2.5 nmol of each of the
Table 1. Primers for a multiplex PCR amplification and internal oligonucleotides for the ASO dot-blot analysis of the five CF
mutations newly identified in Southern Italy.
Mutation
Forward primer (5*)
Reverse primer (3*)
Wild-type oligo for ASO dot blota
Mutated oligo for ASO dot blota
L1065P
(exon 17b)
59TTCAAAGAATGGCACCAGTGT
39ATAACCTATAGAATGCAGCA
59ATGGACACTTCGTGCCT (52 °C)
59TGGACACCTCGTGCCT (52 °C)
4016insT
(exon 21)
59AATGTTCACAAGGGACTCCA
39CAAAAGTACCTGTTGCTCCA
59AGTATTTATTTTTTCTGGAAC (52 °C)
59GTATTTATTTTTTTCTGGAAC (52 °C)
71111G3T
(intron 5)
59ATTTCTGCCTAGATGCTGGG
39AACTCCGCCTTTCCAGTTGT
59TTGATGAAGTATGTACCTAT (52 °C)
59TTTGATGAATTATGTACCTAT (52 °C)
R1158X
(exon 19)
59GCCCGACAAATAACCAAGTGA
39GCTAACATTGCTTCAGGCT
59TTCAGATGCGATCTGTGA (52 °C)
59TTTCAGATGTGATCTGTGA (52 °C)
G1244E
(exon 20)
59GGTCAGGATTGAAAGTGTGCA
39CTATGAGAAAACTGCACTGGA
59CCTCTTGGGAAGAACTGGA (53 °C)
59CCTCTTGGAAAGAACTGGA (51 °C)
a
For each oligonucleotide, the optimal washing temperature of the filter is reported.
Clinical Chemistry 45, No. 7, 1999
Fig. 1. Multiplex DGGE analysis of CFTR exons 11, 17b, and 14b.
(A), an example of an altered homozygote pattern of exon 17b (lane 1) compared
with a wild-type pattern (lane N). (B), two examples of an altered heterozygote
DGGE pattern of exon 17b (lanes 1 and 2) compared with a wild-type pattern
(lane N). The sequence analysis revealed the L1065P mutation.
four deoxyribonucleoside triphosphates, 20 pmol of each
of the two primers, and 1 U of Taq DNA polymerase
(Perkin-Elmer Cetus). The PCR conditions were as follows: 10 PCR cycles of 30 s at 94 °C, 30 s from 65 °C to
56 °C, and 30 s at 72 °C; and 25 PCR cycles of 30 s at 94 °C,
30 s at 55 °C, and 30 s at 72 °C. After the multiplex PCR
amplification, the five mutations were analyzed using
ASO dot-blot analysis, using the pair of oligonucleotides
shown in Table 1 for each hybridization.
Results
The DGGE screening allowed us to identify 20 different
mutations; five of these, i.e., R1158X, G1244E, 4016insT,
959
71111G3 T, and L1065P, were observed with a frequency
.1.0% among 396 CF alleles from Southern Italy.
An example of the multiplex DGGE analysis is shown
in Fig. 1. The homozygote (Fig. 1A) and heterozygote (Fig.
1B) patterns of exon 17b are clearly altered; sequence
analysis revealed the L1065P mutation. The mutation
creates a restriction site for both MnlI and BslI. The
incidence of the L1065P mutation in our series of 396 CF
chromosomes was 1.3%. One patient homozygous for
L1065P showed a mild pulmonary and gastrointestinal
form of CF, with a moderate pancreatic insufficiency and
mild liver involvement. The patient (present age, 18
years), born without meconium ileus, was diagnosed at
the age of 1 year; the sweat chloride result was 93 mEq/L.
Fig. 2 shows an example of the DNA sequences in a
homozygote and a heterozygote patient for the 4016insT
mutation (exon 21), compared with the wild-type sequence. In the heterozygote patient, the mutation produced an overlapping of the sequence of the mutated
allele with the wild-type allele after nucleotide 4016. The
mutation neither creates nor suppresses restriction sites.
In the series of 396 CF chromosomes, the 4016insT mutation was observed in seven chromosomes (1.8%), among
which was one homozygote patient. The latter, born
without meconium ileus, was diagnosed at the age of 2
years; the sweat chloride result was 70 mEq/L. The
patient expressed a severe respiratory phenotype with
pancreatic insufficiency and cholestasis.
The R1158X mutation was identified through the altered DGGE pattern of exon 19, followed by sequence
Fig. 2. Sequence analysis of the
4016insT (exon 21) mutation in a
homozygote (bottom) and in an heterozygote (top) patient.
Wild-type sequence is shown in the
middle.
960
Castaldo et al.: Cystic Fibrosis Mutations Peculiar to Southern Italy
Table 2. Phenotypic features of three CF patients homozygous for rare mutations.
Genotype
Ethnic origin
Present age
Age at diagnosis
Meconium ileus
Nasal polyposis
Lung involvement
FEV 1, % of predicted
Liver involvement
Pancreatic insufficiency
Sweat chloride
4016insT/4016insT
Southern Italy
23 years
2 years
No
No
Severe
38
Cholestasis
Moderate
70 mEq/L
analysis. The mutation suppresses a restriction site for
SfaNI. The incidence of R1158X among CF chromosomes
from our regions was 1.3%. The mutation was identified
in homozygosity in a patient expressing a severe respiratory and gastrointestinal form of the disease with a
moderate pancreatic insufficiency. The patient, born without meconium ileus, was diagnosed at the age of 3 months
on the basis of pulmonary distress and failure to thrive.
The sweat chloride result was 98 mEq/L. After the
diagnosis, the patient showed a very severe pulmonary
expression. At the age of 19 years, he experienced lung
transplantation; 1 year later he died. Table 2 shows the
main phenotypic features of the three homozygous patients described.
Mutation 71111G3 T (exon 5) was identified in five
CF patients (1.3%), always in compound heterozygosity
with other CF mutations; the mutation cannot be analyzed by restriction enzymes. Finally, the G1244EG3 A
mutation was identified through the DGGE screening of
exon 20 followed by DNA sequence analysis in five
chromosomes from our series (1.3%). The mutation suppresses a restriction site for MboII. Table 3 shows the
haplotype associated with the five mutations for six
polymorphisms.
An example of the improved ASO dot-blot procedure
used to analyze the five mutations is shown in Fig. 3 for
R1158X (Fig. 3A), L1065P (Fig. 3B), 4016insT (Fig. 3C),
71111G3 T (Fig. 3D), and G1244EG3 A (Fig. 3E). The
ASO dot-blot clearly distinguishes homozygous, heterozygous, and wild-type subjects. The ASO analysis
confirmed the presence of the five mutations in all of the
patients identified by DGGE and gave negative results for
a control group of 50 CF patients bearing other mutations.
R1158X/R1158X
Southern Italy
Death at 20 years
3 months
No
No
Very severe
18
Moderate
Moderate
98 mEq/L
L1065P/L1065P
Southern Italy
18 years
1 year
No
No
Mild
62
Mild
Moderate
93 mEq/L
on a single CF allele in a Welsh subject (19 ). Mutation
R1158X has a frequency of 0.8% in Greece (20 ); only one
allele bearing the mutation has been described in Spain
(21 ), and two alleles have been described in France (22 ).
Our data confirm some genetic differences in the CF
mutations between Southern and Northern Italy (5 ). Several mutations highly frequent in Northern Italy (R1162X
and 71115G3 A) have not been detected in Southern
Italy, neither has T338I, which is peculiar to Sardinia (5 ).
On the contrary, none of the five mutations described in
the present study has been identified during screening of
the whole coding region of the CFTR gene in Northeastern
Italy (5, 23 ). Mutation L1065P has been reported in ;3%
of CF chromosomes (24 ) from Sicily (Southern Italy).
The concordant haplotype obtained for all five mutations among our patients indicates the recent origin of
these mutations (25 ) and excludes a recurrent origin.
Different haplotypes have been described only for
R1158X, which suggests a recurrent origin (19 ) or rather,
several recombinant events. Mutation R1158X, which has
a frequency of 0.8% in the Greek population (18, 20 ),
could have been introduced into Southern Italy by the
ancient Greeks who colonized this geographic area. More
recently, the mutation could have spread from Southern
to Northern Italy and Europe. This hypothesis is reinforced by the analysis of the polymorphism associated to
the CFTR gene. We observed the same haplotype in all
five alleles bearing the R1158X mutation, i.e., 1, 2, 6, 7, 17
(XV2c, KM19, IVS8CA, IVS17bTA, and IVS17bCA). The
chromosome described in Northern Italy has the same
haplotype 1,2 for XV2c and KM19 (26 ). Of the two
chromosomes bearing the R1158X mutation described in
France, one showed haplotype 2, 2, 16, 7, 17, and the other
Discussion
The DGGE screening of the CFTR coding regions revealed
five mutations frequent in Southern Italy. These mutations, although detected sporadically in other population
cohorts, seem to be peculiar to Southern Italy. In fact,
none of them was described during the screening of the
whole coding region of the CFTR gene in a German
population (17 ); only 71111G3 was reported in ,1.0% of
600 French CF patients (18 ), and 4016insT was reported
Table 3. Haplotype of CFTR polymorphisms associated with
the five mutations listed in Table 1.
CF mutation
XV2c
KM19
IVS18CA
IVS17bTA
IVS17bCA
M470V
R1158X
L1065P
71111G3T
4016insT
G1244EG3T
1
1
1
2
1
2
1
1
1
1
16
16
16
16
16
7
30
25
30
34
17
13
13
13
13
M
V
V
V
V
961
Clinical Chemistry 45, No. 7, 1999
Table 4. Risk prediction for having CF-affected children for
a couple after molecular analysis of CF mutations.
Risk prediction when
Number of known
mutations screened
8
13
Fig. 3. ASO dot-blot analysis of five CF mutations.
Mutations were hybridized with the wild-type oligonucleotide (left) and with the
mutated oligonucleotide (right). The numbers 1 to 4 refer to single individuals for
each of the tested mutations. For R1158X (A) and L1065P (B), 1 and 2 are
heterozygotes for the mutation, 3 is a homozygote for the mutation, and 4 is a
healthy control. For 4016insT (C), 1 and 2 are healthy controls, 3 is a
homozygote for the mutation, and 4 is a heterozygote for the mutation. For
71111G3 T (D) and G1244E (E), 1 and 2 are healthy controls, and 3 and 4 are
heterozygotes for the mutation.
showed haplotype 2, 2, 16, 45, 13, suggesting the recurrent
origin of the mutation or a recombinant event (18, 22 ).
The only difference between the first French patient and
the subjects in our study is the XV2c dimorphic locus, i.e.,
the one most distant from the CFTR gene. A recombinant
event between the XV2c locus and the CFTR gene is not
inconceivable. The mutation detected in the second
French patient could derive from a second, more recent,
recombinant event within the CFTR gene, between exons
8 and 19.
The mutation detection rate of 85% of CF alleles with
the analysis of only 13 CF mutations is surprising considering the genetic heterogeneity of the population of
Southern Italy (5 ). In Spain (21 ), .40 CF mutations
identify ;78% of CF alleles, whereas in France, 47 different mutations identify 86% of CF chromosomes (18 ). The
presence of several mutations peculiar to Southern Italy
could depend on the high rate of consanguinity among CF
carriers from our regions, as is suggested by the high
incidence of CF patients homozygous for rare CF mutations.
The possibility of identifying 85% of CF chromosomes
through a rapid molecular analysis allows us to estimate
the residual risk of being carrier or of having a CF-affected
child in couples for whom molecular analysis for CF was
negative (see Table 4). In fact, starting from an a priori risk
of being a CF carrier of 1:25 (4%), the negative molecular
analysis for CF mutations reduces the risk of being a
carrier to 1:112.5 (0.88%) if the panel of mutations has a
detection rate of 78% (4% of an a priori risk 3 22% risk of
carrying an unidentified mutation). The risk becomes
1:167 (0.60%) if the panel of mutations has a detection rate
of 85% (4% of an a priori risk 3 15% of risk of carrying an
unidentified mutation). Consequently, the risk of having a
One mutation is
found
1:450
1:668
0.22%
0.15%
No mutations are found
1:50 625
1:111 556
0.0020%
0.0009%
CF child for couples for whom molecular analysis for the
CF mutation was negative (see Table 4) is 1:50 625 if the
detection rate of the mutations analyzed is 78% (1/
112.5 3 1/112.5 3 1/4) and becomes 1:111 556 (1/167 3
1/167 3 1/4) at a detection rate of 85%. Similarly, if one
member of the couple is a CF carrier and the other is
negative by molecular analysis, the risk of having a child
affected by CF is 1:450 (1/112.5 3 1/4) if the test has a
detection rate of 78% and 1:668 (1/167 3 1/4) if the
detection rate is 85%. Consequently, on the basis of these
findings, cascade screening can be planned in the families
of CF patients (6 ). The ASO dot-blot procedure described
is very easy and efficient because it is based on a single
multiplex amplification, which can be semi-automated
with the use of a robotic workstation (9 ), allowing the
analysis of large series of DNA samples. Using this
procedure to analyze eight CF mutations, we have made
.1000 molecular CF diagnoses of homozygote or heterozygote CF subjects over the last 4 years. Similarly, the
ASO analysis of the five new mutations gave unequivocal
results in all CF patients that had been characterized by
DGGE and sequenced previously and in all 100 control
alleles. Furthermore, we now routinely screen CF patients
for the 13 mutations and have identified several other
alleles (data not shown) bearing the five new mutations in
both CF patients and subjects affected by congenital
bilateral agenesis of the vasa deferentes.
This study confirms that polymorphism analysis is a
valid procedure with which to asses the genetic heterogeneity of a population with respect to a specific gene, and
to evaluate the recurrent origin of a mutation (22, 25, 27 ).
Similarly, we confirm the very high potential of DGGE as
a tool for screening large genes for unknown mutations
(14, 15 ).
The phenotype analysis in the three homozygous patients confirmed, in this case, the phenotype predicted by
the molecular analysis. The patient homozygous for
R1158X (a nonsense mutation) and the patient homozygous for 4016insT (a frameshift mutation) showed very
severe expression of CF (because the synthesis of the
wild-type protein was suppressed) compared with the
patient homozygous for L1065P, a missense mutation
associated with the synthesis of a protein with a single
amino acid substitution.
In conclusion, the five so-called rare CF mutations described here seem to be peculiar to Southern Italy. Their
analysis, added to the analysis of the eight most frequent
962
Castaldo et al.: Cystic Fibrosis Mutations Peculiar to Southern Italy
CF mutations (9 ), allows us to detect 85% of CF alleles
from these regions and to calculate a very low residual
risk of having a child affected by CF for couples for whom
molecular analysis of the 13 mutations was negative. The
use of an additional multiplex PCR associated with a
semi-automated ASO dot-blot analysis represents a step
forward in the strategy to eradicate the disease from the
regions studied. The identification of several rare homozygotic mutations adds useful information to the genotype-phenotype correlation for this disease. Lastly, the
results obtained in CF patients from Southern Italy may
have an impact on laboratories in other countries, given
the large migrations of populations from Southern Italy to
other regions of Italy (i.e., Northern Italy) or to countries
(i.e., Switzerland, Germany, and North and South America) in the last two centuries.
The work was funded in part by grants from the Ministero dell’Università e Ricerca Scientifica e Tecnologica
(Grant PRIN 1997), Rome, Italy; Regione Campania
(Grant LR 41/94), Consiglio Nazionale delle Ricerche
(P.F. Biotecnologie), and the Ministero della Sanità
(Rome).
11.
12.
13.
14.
15.
16.
17.
18.
References
1. Rommens JM, Iannuzzi MC, Kerem BS, Drumm ML, Melmer G,
Dean M, et al. Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 1989;245:1059 – 65.
2. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel R, Grzelczac Z, et al. Identification of the cystic fibrosis gene: cloning and
characterization of complementary DNA. Science 1989;245:
1066 –73.
3. Kerem BS, Rommens JM, Buchanan JA, Markiewicz D, Cox TK,
Chakravati A, et al. Identification of the cystic fibrosis gene:
genetic analysis. Science 1989;245:1073– 80.
4. Shoshani T, Augarten A, Gazit E, Bashan N, Yahav Y, Rivlin Y, et al.
Association of a nonsense mutation (W1282X), the most common
mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel,
with presentation of severe disease. Am J Hum Genet 1992;50:
222– 8.
5. Rendine S, Calafell F, Cappello N, Gagliardini R, Caramia G, Rigillo
N, et al. Genetic history of cystic fibrosis mutations in Italy. I.
Regional distribution. Ann Hum Genet 1997;61:411–24.
6. Super M, Schwarz MJ, Malone G, Roberts T, Haworth A, Dermody
G. Active cascade testing for carriers of cystic fibrosis gene. Br
Med J 1994;308:1462– 8.
7. Castaldo G, Rippa E, Raia V, Salvatore D, Massa C, De Ritis G,
Salvatore F. Clinical features of cystic fibrosis patients bearing
rare genotypes. J Med Genet 1996;33:475–9.
8. Castaldo G, Rippa E, Salvatore D, Sibillo R, Raia V, De Ritis G,
Salvatore F. Severe liver impairment in a cystic fibrosis affected
child homozygous for the G542X mutation. Am J Med Genet
1997;69:155– 8.
9. Castaldo G, Rippa E, Sebastio G, Raia V, Ercolini, De Ritis G, et al.
Molecular epidemiology of cystic fibrosis mutations and haplotype
in southern Italy evaluated with an improved semi-automated
robotic procedure. J Med Genet 1996;34:475–9.
10. Rosenbloom CL, Kerem BS, Rommens JM, Tsui LC, Wainwright B,
Williamson R, et al. DNA amplification for detection of the XV-2c
19.
20.
21.
22.
23.
24.
25.
26.
27.
polymorphism linked to cystic fibrosis. Nucleic Acids Res 1989;
17:7117.
Feldman GL, Williamson R, Beaudet AL, O’Brien WE. Prenatal
diagnosis of cystic fibrosis by DNA amplification for detection of
KM19 polymorphism. Lancet 1988;ii:102.
Morral N, Nunes V, Casals T, Estivill X. CA/GT microsatellite
alleles within the cystic fibrosis transmembrane conductance
regulator (CFTR) gene are not generated by unequal crossing over.
Genomics 1991;10:692– 8.
Zielinski Y, Markiewicz D, Rininslaud F, Rommens JM, Tsui LC. A
cluster of highly polymorphic dinucleotide repeats in intron 17b of
the cystic fibrosis transmembrane conductance regulator (CFTR)
gene. Am J Hum Genet 1991;49:1256 – 62.
Costes B, Fanen P, Goossens M, Ghanem N. A rapid, efficient,
and sensitive assay for simultaneous detection of multiple cystic
fibrosis mutations. Hum Mutat 1993;2:185–91.
Fanen P, Ghanem N, Vidaud M, Besmond C, Martin J, Costes B, et
al. Molecular characterization of cystic fibrosis transmembrane
conductance regulator (CFTR) coding region and splice junction.
Genomics 1992;13:770 – 6.
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press, 1989:815 pp.
Dork T, Mekus F, Schmidt K, Bobhammer J, Fislage R, Heuer T, et
al. Detection of more than 50 different CFTR mutations in a large
group of German cystic fibrosis patients. Hum Genet 1994;94:
533– 42.
Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M,
Bozon D, et al. Mutation analysis in 600 French cystic fibrosis
patients. J Med Genet 1994;31:541– 4.
Cheadle JP, Goodchild MC, Meredith AL. Direct sequencing of the
complete CFTR gene: the molecular characterization of 99.5% of
CF chromosomes in Wales. Hum Mol Genet 1993;2:1551– 6.
Tzetis M, Kanavakis E, Antoniadi T, Doudounakis S, Adam G,
Cattamis C. Characterization of more than 85% of cystic fibrosis
alleles in the Greek population, including five novel mutations.
Hum Genet 1997;99:121–5.
Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N,
et al. Analysis of the CFTR gene confirms the high genetic
heterogeneity of the Spanish populations: 43 mutations account
for only 78% of CF chromosomes. Hum Genet 1994;93:447–51.
Clausters M, Desgeorges M, Moine P, Morral N, Estivill X. CFTR
haplotypic variability for normal and mutant genes in cystic
fibrosis families from southern France. Hum Genet 1996;98:
336 – 44.
Bonizzato A, Bisceglia L, Marigo C, Nicolis E, Bombieri C, Castellani C, et al. Analysis of the complete coding region of the CFTR
gene in a cohort of CF patients from North-Eastern Italy: identification of 90% of the mutations. Hum Genet 1995;95:397– 402.
Rady M, D’Alcamo E, Seia M, Iapichino L, Ferrari M, Russo S, et
al. Simultaneous detection of fourteen Italian cystic fibrosis
mutations in seven exons by reverse dot-blot analysis. Mol Cell
Probes 1994;9:1– 4.
Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, et al.
Haplotype analysis of 94 cystic fibrosis mutations with seven
polymorphic CFTR DNA markers. Hum Mutat 1996;8:149 –59.
Ronchetto P, Orriols J, Fanen P, Cremonesi L, Ferrari M, Magnani
C, et al. A nonsense mutation (R1158X) and a splicing mutation
(384914A3 G) in exon 19 of the cystic fibrosis transmembrane
conductance regulator gene. Genomics 1992;12:417– 8.
Morral N, Nunes V, Casals T, Chillon M, Gimenez J, Bertranpetit J,
Estivill X. Microsatellite haplotypes for cystic fibrosis: mutation
frameworks and evolutionary tracers. Hum Mol Genet 1993;2:
1015–22.