Download Transcriptional Control of Estrogen Receptor in

(CANCER RESEARCH 53, 3472-3474,
August I. 1993]
Advances in Brief
Transcriptional Control of Estrogen Receptor in Estrogen Receptor-negative
Breast Carcinoma1
Ronald J. Weigel2 and Ellen C. deConinck
Department tif Surgery, Stanford University, Stanford, California 94305
Abstract
The mechanisms which control estrogen receptor (ER) expression in
breast carcinoma have not been elucidated. The MCF-7 (ER-positive) and
MDA-MB-231 (ER-negative) breast carcinoma cell lines have been used to
examine ER gene expression. Northern blot analysis of mRNA isolated
from these two cell lines demonstrates that MCF-7 cells express an ex
pected 6.5-kilobase ER mRNA whereas MDA-MB-231 do not make de
purified by precipitation with polyethylene glycol as described previously (6).
Genomic DNA was analyzed by Southern blotting as described previously (6).
RNA Isolation and Analysis. Polyadenylated RNA was isolated using the
Fast-Track RNA isolation kit (Invitrogen. San Diego, CA) according to the
recommendations of the supplier. Total cell RNA was isolated from cell lines
which were washed once with phosphate-buffered saline and then lysed in
RNA lysis buffer (200 mw NaCI-100 ITIMTris-HCI, pH 7.5-50 nut EDTA-1%
sodium dodecyl sulfate -200 fig/ml proteinase K) and incubated at 37°Cfor 45
tectable ER message. Reverse polymerase chain reaction, which offers
greater sensitivity, confirms these Northern blot results. The nuclear
run-on assay was used to examine directly transcription in these two cell
lines. MCF-7 cells actively transcribe the ER gene whereas no ER tran
scription is detected in MDA-MB-231. Southern analysis of genomic DNA
confirms that the ER gene is present in MDA-MB-231. We conclude that
the ER gene is controlled transcriptionally in this ER-negative breast
min. The lysates were extracted with an equal volume of phenolxhloroform
(1:1) and the nucleic acid was precipitated with 2.5 volumes of ethanol. DNA
was digested in a DNase buffer containing 100 units/ml DNase I (Boehringer-
carcinoma line.
Elmer. Norwalk, CT). Primers used for amplification across the first splice site
of the ER gene are TACTGCATCAGATCCAAGGG
and ATCAATGGTG-
Introduction
ER3 expression is intimately associated with the biology of breast
carcinoma. However, little is known about mechanisms which control
ER expression. The cDNA for ER was originally cloned from the
MCF-7 breast carcinoma cell line (1, 2). The receptor is an inducible
frans-activator which becomes functional when bound to estradici (3).
The gene for ER has been localized to chromosome 6q24-27 (4). The
gene spans 140,000 base pairs and is composed of 8 exons which are
spliced to yield a mature 6.5-kilobase mRNA (5). The promoter for the
ER gene has not been defined. The central focus of these experiments
is to determine the mechanism for the lack of expression of ER in
certain breast cancers. Two breast carcinoma cell lines were used in
these experiments both of which were derived from malignant effu
sions. The MCF-7 cell line was used as a representative line which has
retained ER expression. MDA-MB-231 cells were used as a breast
cancer line which lacks receptor expression.
Materials and Methods
Cell Lines. All cell lines were obtained from American Type Culture Col
lection, Rockville, MD. Cells were maintained in minimal essential medium
(Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal bovine sera
(Hyclone, Logan, UT), 25 ITIM4-(2-hydroxyethyl)-l-piperazineethanesulfonic
acid, 26 min sodium bicarbonate, 5000 units/ml penicillin G (Gibco BRL),
5000 n.g/ml streptomycin (Gibco BRL), and 6 ng/ml bovine insulin (Sigma
Chemical Company, St. Louis, MO). Cells were incubated at 37°Cin 5% CO2.
DNA Isolation and Analysis. The HEO plasmid containing the estrogen
receptor cDNA was obtained as a gift from Professor Pierre Chambón, Stras
bourg, France. Plasmid DNA was isolated by the alkaline lysis method and
Received 5/6/93; accepted 6/17/93.
The costs of publication of this article were defrayed in pan by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 17.34 solely to indicate this fact.
1This research was supported in part by American Cancer Society Institutional Re
search Grant IRG-32-34.
2 To whom requests for reprints should be addressed, at Department of Surgery, MSOB
X300, Stanford University, Stanford, CA 94305.
3 The abbreviations used are: ER. estrogen receptor; cDNA. complementary DNA;
PCR, polymerase chain reaction.
Mannheim, Indianapolis, IN), 200 units/ml RNase inhibitor, and 5 ITIMMgCl2
at 37°Cfor 60 min. The lysates were extracted with phenol :chloroform, and
RNA was ethanol precipitated, resuspended in water, and stored at -20°C.
Reverse PCR was accomplished
using the RNA amplification
kit (Perkin-
CACTGGTTGG. Primers for amplification across the last splice site are
GCACCCTGAAGTCTCTGGAA
and TGGCTAAAGTGGTGCATGAT.
The
primer pair used to amplify actin mRNA is GCAATGGAAGAAGAGATCGC
and ACATGGCCGGGGTGTTGAAG.
Nuclear run-on assays were performed as described previously (7). Nuclei
were labeled at 30°C for 15 min using [a12P]-UTP. Hybridizations were
performed at 42°Cin 50% formamide. Fillers were stringently washed in 0.1 x
150 MM NaCI, 15 MM Na Citrate standard saline-citrate 0.5% sodium dodecyl
sulfate at 65°Cand were treated with RNase A to further increase specificity.
Results
The central focus of these studies is to determine the mechanism for
the lack of expression of ER in certain breast cancers. Two breast
carcinoma cell lines were used in these experiments, both of which
were derived from malignant effusions. The MCF-7 cell line was used
as a representative line which has retained ER expression (8). MDAMB-231 cells were used as a breast cancer line which lacks receptor
expression (9). Cytoplasmic RNA was isolated from these two cell
lines to determine if ER mRNA is synthesized. Fig. 1 shows that
MCF-7 cells make an expected 6.5-kilobase mRNA which hybridizes
to an ER cDNA probe whereas this mRNA was not detected in
MDA-MB-231 cells. An identical blot probed with actin confirms the
presence of intact mRNA in both samples.
The lack of detectable ER mRNA in MDA-MB-231 cells could be
due to a lack of transcription, abnormal processing of primary tran
script, degradation of message, or an inability to transport message to
the cytoplasm. To determine if there were low levels of ER mRNA or
possibly partially processed nuclear RNA, a reverse PCR technique
was used to identify ER mRNA. Primers were constructed across the
first and last introns of the ER mRNA. As a control, primers across the
first splice site of 7-actin were also synthesized. These primers were
used to amplify cDNA synthesized using random primers and reverse
transcriptase from total cell RNA from MCF-7 and MDA-MB-231
cells. Fig. 2 shows the results of this experiment. When using RNA
from MCF-7 cells, an expected 650-base pair fragment using the
primer pair across the first intron is amplified. No band is detected
when RNA from MDA-MB-231 cells is used. Similarly, a 469-base
3472
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
TRANSCRIPTION
OF ER IN BREAST
CARCINOMA
positive control. ADNA, a 900-base pair fragment of the ER 5'flanking region cloned in a CAT plasmid, and a CAT expression
plasmid served as negative controls. Fig. 3 shows the results of the
nuclear run-on assay. Whereas actin is actively transcribed to the same
extent in both cell lines, ER gene appears to be transcribed only in
MCF-7 cells. A, a region upstream of the ER-transcribed region and a
CAT-derived plasmid are all negative as expected. These results con
firm that the lack of expression of ER in MDA-MB-231 cells is due
to a lack of transcription of the gene.
One simple explanation of these results would be that both alÃ-eles
of the ER gene are deleted in MDA-MB-231. Previous studies have
not detected a deletion of the ER gene by restriction analysis (10). Fig.
4 shows the results of a Southern blot of genomic DNA from MCF-7
or MDA-MB-231 cells digested with EcoRl or Hindlll and probed
with the ER cDNA. Identical restriction patterns are obtained in both
cell lines. These results are also identical to those of previous reports.
These data, however, do not exclude the possibility of subtle muta-
Probe:
Actin
ER
Fig. 1. Northern blots of ER mRNA. Polyadenylated cytoplasmic RNA was isolated
from MCF-7 and MDA-MB-231 cells. RNA was resolved on 1% agarose-formaldehyde
gels and blotted to Nytran membrane. Identical blots were probed with ER cDNA (left}
or actin cDNA (righi).
Actin —¿ ME»
XDNA —¿
ER —¿ »«
primers:
0X174
i
ERSPL1
MCF MDA
7
231
ii
ERSPL7
MCF MDA
7
231
ActlnSPLI
11
1
5'-ER —¿
MCF MDA
7
231 0X174
pCAT —¿
Fig. 3. Nuclear run-on. Nuclei were isolated from MCF-7 or MDA-MB-231 and were
labeled with |a-32P]UTP for 15 min at 30°C.RNA was extracted and used as a probe on
slot blots in which 5 |¿gof actin DNA, A DNA, ER cDNA, DNA upstream of the ER
transcriptional start site, and a CAT plasmid were each immobilized on Nytran membrane.
After hybridization, filters were stringently washed and treated with RNase A to increase
specificity.
Fig. 2. Evaluation of ER RNA with PCR. Primers were constructed across the first
(ERSPLI) and last (ERSPL7) splice sites of the ER gene. Additionally, a set of primers
across the first splice site of -v-actin (ActinSPLl) were used as a control. cDNA was
synthesized from total cell RNA using random primers and reverse transcriptase. The
cDNA was then amplified using PCR. The sizes of amplified regions from cDNA corre
sponding to the first splice site of ER. seventh splice site of ER. and actin splice site are
650, 469 and 400 base pairs, respectively. Markers are <i>X174Waelll digests.
pair DNA fragment is expected using primers across the seventh splice
site of the ER mRNA. This band is seen only with RNA from MCF-7.
A 400-base pair band is expected when using primers across the
y-actin splice site. RNA from both MCF-7 and MDA-MB-231 gave
the expected PCR product. Although not proof, these results never
theless suggest that the lack of ER mRNA in MDA-MB-231 was not
due to degradation or abnormal nuclear transport. Abnormal splicing
could still be a possibility but is unlikely since identical results are
obtained for two different ER splice sites.
To further substantiate these results, nuclear run-on assays were
performed to examine directly the transcription of the ER gene. Nuclei
were isolated from MCF-7 and MDA-MB-231 cells and in vitro RNA
synthesis using [a32P]UTP was carried out for 15 min at 30°C.RNA
was then isolated from these nuclei and used as a probe on slot blots
in which ER cDNA was immobilized. Actin cDNA was used as a
3
-
•¿
Enzymes:
EcoRI
HindlU
Fig. 4. Southern blots of genomic DNA. Genomic DNA from MCF-7 or MDA-MB23 I cells was cut with £cv>Rl
or Hindlll. electrophoresed in 0.8% agarose gels, and blotted
to Nytran membrane. Blots were hybridized with ER cDNA probe.
3473
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
TRANSCRIPTION
OF ER IN BREAST
lions within the gene or even sizable deletions which might occur
within introns which may affect transcription.
Discussion
The expression of estrogen receptor plays a central role in the
biology of breast cancer. ER-positive tumors tend to have a less
aggressive phenotype than cancers which lack receptor expression
(11). Little is known about the regulation of ER expression in breast
carcinoma. These studies were undertaken to clarify the mechanism
whereby ER-negative cancers fail to express receptor. By utilizing a
breast cancer cell line model, we have shown that the estrogen recep
tor gene is controlled transcriptionally in the ER-negative breast can
cer line MDA-MB-231. Although it is possible that other mechanisms
may exist to control ER expression, these data clearly demonstrate
that transcriptional control is one mechanism which is responsible for
the ER-negative phenotype.
Two possibilities exist for the transcriptional control of ER. ERpositive and ER-negative cells may have intrinsic differences in tran
scriptional machinery defined by a difference in /raws-acting tran
scription factors. Alternatively, there may be cis alterations of the ER
promoter in ER-negative cells which result in a transcriptionally in
active promoter. No such alterations have yet been defined at the level
of Southern blot analysis. However, there may be subtle mutations not
identified by Southern analysis or possibly deletions of important
control regions which lie outside regions examined. For example,
there could be deletions of important control regions within the ER
introns or far upstream of the transcriptional start site which would not
be identified in the Southern analysis performed here.
These data allow the focus of subsequent work to center on the ER
promoter. Further work is presently under way to functionally map the
ER promoter. A functional definition of the ER promoter would allow
CARCINOMA
a more detailed description of the mechanism which silences ER
expression in certain breast carcinomas. These studies will also need
to be expanded to include fresh cancer isolates to show that this breast
cancer cell line model is representative of in situ carcinomas. Under
standing ER promoter control in breast cancer will help to clarify
the relationship between ER expression and the biology of breast
carcinoma.
References
1. Greene. G. L., Gilna. P.. Waterfield. M. Baker. A.. Hem, Y.. and Shine. J. Sequence
and expression of human estrogen receptor complementary DNA. Science (Washing
ton DC), 231: 1150-1154, 1986.
2. Green. S., el al. Human oestrogen receptor cDNA: sequence, expression and homology to v-crfe-A. Nature (Lond), 320: 134-139. 1986.
3. Ponglikitmongkol. M., White. J. H., and Chambón, P. Synergistic activation of tran
scription by the human estrogen receptor bound to tandem responsive elements.
EMBOJ., 9: 2221-2231, 1990.
4. Gosden. J. R.. Middleton. P. G., and Rout. D. Lwalization of the human oestrogen
receptor gene to chromosome 6q24-q27 by in silu hybridization. Cytogenet. Cell
Genet.,«.- 218-220, 1986.
5. Ponglikitmongkol, M., Green. S., and Chambón, P. Genomic organization of the
human oestrogen receptor gene. EMBO J.. 7: 3385-3388, 1988.
6. Sambrook, J., Fritsch, E., and Maniatis, T. (eds.). Molecular Cloning, A Laboratory
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
7. Weigel, R. J.. and Nevins. J. R. Adenovirus infection of differentiated F9 cells results
in a global shut-off of differentiation-induced gene expression. Nucleic Acids Res..
18: 6107-6112. 1990.
8. Soule, H. D.. et til. A human cell line from a pleural effusion derived from a breast
carcinoma. J. Nati. Cancer Inst., 51: 1409-1416. 1973.
9. Cailleau. R..el al. Breast tumor cell lines from pleural effusions. J. Nati. Cancer Inst.,
53: 661-674, 1974.
10. Watts, C. K. W., Malcolm. L. H., King. R. J. B.. and Sutherland. R. L. Oestrogen
receptor gene structure and function in breast cancer. J. Steroid Biochem. Mol. Biol..
41: 529-536, 1992.
11. Knight. W. A., Ill, Livingston. R. B., Gregory, E. J.. and McGuire. W. L. Estrogen
receptor as an independent prognostic factor for early recurrence in breast cancer.
Cancer Res.. 37: 4669^(671, 1977.
3474
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
Transcriptional Control of Estrogen Receptor in Estrogen
Receptor-negative Breast Carcinoma
Ronald J. Weigel and Ellen C. deConinck
Cancer Res 1993;53:3472-3474.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/53/15/3472
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.