Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Adoptive cell transfer wikipedia , lookup
Duffy antigen system wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Molecular mimicry wikipedia , lookup
Cancer immunotherapy wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Vaccination wikipedia , lookup
Gene Therapy (1997) 4, 969–976 1997 Stockton Press All rights reserved 0969-7128/97 $12.00 Induction of antibody response to human tumor antigens by gene therapy using a fusigenic viral liposome vaccine T Okamoto1, Y Kaneda2, D Yuzuki1, SKS Huang1, DDJ Chi1 and DSB Hoon1 1 Department of Molecular Oncology, John Wayne Cancer Institute, Santa Monica, CA, USA; and 2Institute for Molecular and Cellular Biology, Osaka University, Osaka 565, Japan Development of effective cancer vaccines would help prevent and control tumor progression. A novel approach of immunizing against tumor antigens is in vivo gene vaccination. We have developed a fusigenic viral liposome vector using HVJ (hemagglutinating virus of Japan) and liposome to deliver human tumor antigen genes effectively to cells in vivo. Plasmids containing the human tumor antigen genes MAGE-1 and MAGE-3 were encapsulated in fusigenic viral liposomes and injected into mice intramuscularly. MAGE-1 and -3 recombinant proteins were used in Western blotting and affinity ELISA for assessment of antibody responses. Mice immunized with MAGE-1 and -3 gene vaccine individually were shown to produce anti- MAGE-1 and -3 IgG antibody responses, respectively. Animals immunized with plasmid alone did not induce antiMAGE-1 or -3 IgG responses. Antibody responses could be enhanced on reimmunization with the gene vaccines. Muscle biopsies taken after vaccine injection were verified to express gene-specific mRNA transcripts. Mice immunized with MAGE-1 or -3 gene vaccines were shown to induce antibodies that could cross-react with the respective recombinant proteins. This study demonstrates that in vivo immunization using HVJ–liposome containing human tumor antigen genes can effectively deliver and induce immune responses to the respective whole proteins. Keywords: vaccine; cancer; antibody; liposome; gene therapy Introduction DNA vaccines have recently been shown to be a promising approach for immunization against a variety of infectious diseases.1–3 Delivery of naked DNAs containing microbial antigen genes can induce antigen-specific immune responses in the host. The induction of antigenspecific immune responses using DNA-based vaccines has shown some promising effects.4 Overall the DNAbased vaccination principle is similar to live attenuated virus immunization however with a greater degree of control of antigen expression, toxicity and pathogenicity, although improvements in in vivo delivery and transgene expression are needed. The majority of studies reported to date on DNA immunization are with microbial antigen genes that are known to be immunogenic in animals or humans. DNA immunization strategy may be useful to develop new effective cancer vaccines. In general, studies on tumor antigen protein/peptide vaccines in human and animal studies to date have been encouraging but not as efficient as microbial antigen vaccines.5 Human tumor antigens are in general weakly immunogenic. The method of antigen presentation and the route of antigen delivery are important to induce effective immunity as well. Correspondence: DSB Hoon, Department of Molecular Oncology, John Wayne Cancer Institute, 2200 Santa Monica Boulevard, Santa Monica, CA 90404, USA Received 21 February 1997; accepted 8 May 1997 At present there are multiple approaches being assessed in immunizing cancer patients with tumor antigens.5 Purification of natural or recombinant tumor antigens is tedious and not always logistically practical. To date there are only a few human cancer vaccines showing consistent and significant effective augmentation of immunity with soluble antigens (proteins/peptides). This problem is partially due to antigen presentation and host major histocompatibility complex (MHC) polymorphism. Studies to date suggest that cellular cancer vaccines expressing the antigens may be more effective than soluble antigens alone.5 This may be due to tumor antigen expression, processing and presentation by the cell. Using the host normal cells (nonhemopoietic) to express and present the tumor antigens to the immune system may be an effective immunization strategy. In general, when a cytopathic virus infects a host normal cell, the viral proteins are endogenously processed and presented on the cell surface, or in fragments by MHC molecules. Foreign defined DNA transfected and expressed by normal cells can mimic viral infections. Although in vivo DNA vaccination protocols are available, there are still problems in effective in vivo delivery of DNA to the cells and expression of genes. One of the problems is introduction of DNA into specific cells without degradation of the DNA by endosomes or lysosomes.6 Current approaches of in vivo delivery of DNA by retroviral or adenoviral vectors have problems related to efficacy, viral gene integration, potential pathogenic activity and immune response to viral vector encoding Human tumor antigen gene vaccination T Okamoto et al 970 proteins. To get around some of these problems, we have developed an in vivo delivery system using a nonviral DNA vector. The delivery system also includes protein encapsulated in a fusigenic viral liposome that is a hybrid vector of viral and nonviral reagents. Briefly, anionic liposomes are fused with HVJ (Sendai virus member of paramyxovirus family).7–10 HVJ proteins are known for their unique fusing properties to cell membranes of nonhemopoietic nucleated cells.11,12 This hybrid vector allows targeting to normal nonhemopoietic cells and delivery of encapsulated DNA into the cytoplasm of cells without lysosome/endosome degradation. Another advantage of the fusigenic viral liposome system is that it can deliver DNA and protein molecules together. Most gene transfer methods are limited to the low level of expression of the transfected gene.8,11 To facilitate gene transcription, we incorporated a high mobility group-1 protein (HMG) which is a non-histone DNA-binding protein. HMG-1 protein enhances gene transcription. This delivery system has been demonstrated to be highly effective in in vivo gene transfer and delivery of genes and antisense DNA oligomers.13,14 Our objective was to utilize the HVJ–liposome DNAmediated transfer technique in vivo to immunize against human tumor antigens MAGE-1 and MAGE-3. The MAGE-1 and -3 antigens were first described in melanoma and subsequently demonstrated in various other cancers. MAGE-1 and -3 genes are expressed in .30% of melanomas and carcinomas such as lung, breast, liver and gastrointestinal cancers,15–17 but not in normal tissues except testes. The MAGE-1 and -3 antigens were assessed to study tumor antigen DNA vaccination primarily because they have been shown to be immunogenic, expressed by a wide variety of human cancers and not expressed by normal tissues.15–17 These are important criteria in the overall design of an effective vaccine against multiple cancers. Studies have demonstrated that the MAGE-1 and MAGE-3 proteins are immunogenic in which antigen-specific cell-mediated and humoral immune responses have been demonstrated in humans.14,16 However the MAGE-1 and -3 are generally weakly immunogenic. Previously, we have demonstrated that anti-MAGE-116 and -3 (Huang et al, submitted) IgG antibodies responses can be induced in melanoma patients immunized with a melanoma cell vaccine. In this study we demonstrate that by immunization with HVJ– liposome containing MAGE-1 and -3 genes, anti-MAGE1 or -3 IgG antibodies could be induced. The antibody responses could be enhanced by reimmunization and maintained for several weeks. Results Production of HVJ–liposomes A schematic diagram of the production of HVJ–liposomes encapsulated with plasmid pcDNA3 containing MAGE-1 (pMAGE-1) or MAGE-3 (pMAGE-3) and HMG1 protein is shown in Figure 1. In the study we will refer to the HVJ–liposome complex containing pMAGE-1 and pMAGE-3 plus HMG-1 protein as MAGE-1 or -3 vaccine, respectively. Preparation of HVJ–liposomes with plasmid DNA was carried out on the day or within 24 h of injection into animals. The starting amount of plasmid DNA used in liposome encapsulation was 100 mg per tube. The Figure 1 DNA immunization protocol: schematic diagram of HVJ–liposomes plus plasmid DNA preparation and immunization of mice. amount of encapsulated plasmid DNA injected per animal was approximately 7–10 mg. This dose was the most efficient amount of HVJ–liposome DNA complex needed for in vivo gene expression. This was also the most logistically feasible dose of vector to produce a significant rapid and consistent immune response to the MAGE proteins. Optimization and control experiments with individual components of the fusigenic viral liposome for in vivo delivery of genes has been previously reported.8,9,11 Immunization of mice immediately after HVJ–liposome preparation was performed to obtain optimal results. Through experimentation an optimal vaccine immunization schedule was determined. No necrosis, inflammation or visible injury was observed after multiple injections at the same site. Groups of animals injected with plasmid DNA were kept for over 12 months and no visible injury or change in physical activity was observed compared with nonimmunized animals. HVJ–liposome solution did not affect the well-being of the animals or hind leg function (site of injections). Detection of anti-MAGE-1 and MAGE-3 antibody by Western blot To assess the induction of anti-MAGE-1 and -3-specific antibody responses after vaccination recombinant human MAGE-1 (rMAGE-1) and recombinant human MAGE-3 (rMAGE-3) were produced and purified for immunoassays (Figure 2). MAGE-1 protein has 309 amino acids with a predicted molecular weight of 34 kDa. The purified rMAGE-1 run on SDS-PAGE under reducing conditions was approximately 42 kDa. MAGE-3 protein has 314 amino acids with a predicted molecular weight of 35 kDa. The purified rMAGE-3 run on SDS-PAGE under reducing conditions was approximately 48 kDa. The possible reasons for the differences in protein calibrated weight by gel electrophoresis versus predicted weight has been previously discussed.16 Both proteins have additional amino acids used as affinity tags. Whole protein was essential to assess the overall immune response since antigenic peptide sequences in mice are not known. Western blots with rMAGE-1 and rMAGE-3 were performed with sera of mice immunized at least twice to verify specificity of antibody responses (Figure 2). No antibody (IgG) responses to rMAGE-1 or -3 were detected Human tumor antigen gene vaccination T Okamoto et al 971 Figure 2 Analysis of rMAGE proteins and representative antibody responses. Purified rMAGE-1 and rMAGE-3 run under reducing condition in a 10% SDS-PAGE and stained with coomassie blue (left side). Lanes: A, rMAGE-1; B, rMAGE-3; M, molecular weight standards (kDa). Analysis of antibody response to rMAGE-1 (a) and rMAGE-3 (b) by Western blot (right side). Representative experiments of analysis of antiMAGE-1 IgG and anti-MAGE-3 IgG in sera. Lanes 1 and 2, analysis of non-immunized mice, respectively. For MAGE-1 vaccine immunization (a): lanes 3 and 4, sera from mice immunized three times biweekly with MAGE-1 vaccine. For MAGE-3 vaccination (b): lanes 3 and 4, sera from mice immunized three times biweekly with MAGE-3 vaccine. Representative serum analysis for two mice for each group at 1:100 dilution is shown. in non-immunized mice. Mice immunized several times with HVJ–liposome complex containing pcDNA3 without a MAGE-1 or -3 gene insert also had no antigenspecific antibody response. Naked DNA given in vivo and taken up by cells degrades rapidly in lysosomes/endosomes (data not shown). Mice immunized with MAGE-1 vaccine three times and assessed 6 weeks after immunization showed an induction of a strong antibody response to rMAGE-1 (Figure 2a). Similarly mice immunized with MAGE-3 vaccine three times and followed-up after 6 weeks showed a strong antibody response to rMAGE-3 (Figure 2b). These studies indicated that antigen-specific IgG responses could be induced rapidly and maintained for at least 8 weeks after immunization. IgM anti-MAGE-1 and -3 responses were also assessed after various numbers of immunization. The level of response was weak or non-detectable in sera tested; therefore we did not pursue further analysis of IgM responses. Detection of anti-MAGE-1 and MAGE-3 IgG antibody by ELISA Anti-MAGE-1 IgG antibodies were detected after immunization at various time-points by a MAGE-1 affinity ELISA. The selective affinity binding of Ni2+ and hexaHis tagged protein insured higher specificity and less steric conformation variation as opposed to conventional absorbance of proteins to ELISA plates. A representative experiment of antibody response after MAGE-1 immunization is shown in Figure 3: mice were immunized on day 0, 7 and 14, and then reimmunized approximately 1 year after. IgG antibody levels were enhanced after 7 days of booster immunization and maintained at day 14. Figure 3 Representative experiments of serial bleed analysis after MAGE1 vaccine immunization. Affinity ELISA with rMAGE-1 was performed to detect IgG responses at 1:100 dilution of sera. Representative experiment of mice (four per group) immunized on days 0, 7, 14 and reimmunized 1 year later and assessed 28 days later. Mean absorbency of triplicates ± s.e. of all mice shown at specific time-points. Experiments were performed several times to confirm results. Anti-MAGE-1 IgG antibody was induced and could be elevated with subsequent immunizations. Immunized mice were also assessed at different dilutions of serum ranging from 1:50 to 1:800. In general, after two immunizations on day 14 IgG anti-MAGE-1 antibody titers were 1/200 to 1/400. A positive antibody dilution was considered when it was 2 s.d. above negative serum background at a dilution of 1:100. One year after three immunizations antibody levels went back down to background level as expected. Animals were reimmunized and evaluated after 4 weeks. Anti-MAGE-1 IgG responses were shown to be boosted to early immunization levels. These studies indicated that repeated immunization with the HVJ–liposome system does not induce any significant inhibiting immune response to the HVJ–liposome components or plasmid vector to prevent antigen-specific immunization. Cross-reactivity between MAGE-1 and MAGE-3 antibodies Mice were immunized with MAGE-1 or -3 vaccine on days 0, 14 and 28. The objective of the study was to determine whether anti-MAGE-1 IgG antibodies induced by MAGE-1 vaccine immunization cross-reacted with MAGE-3, and whether anti-MAGE-3 IgG antibodies induced by MAGE-3 vaccine immunization cross-reacted with MAGE-1. Western blot analyses with rMAGE-1 and rMAGE-3 were performed with sera from MAGE-1 and MAGE-3 vaccine immunized mice (Figure 4). The studies demonstrated cross-reactivity of anti-MAGE-1 and -MAGE-3 sera with both rMAGE-1 and rMAGE-3. Further analysis of the cross-reactivity was shown by ELISA (Figure 5). There were no significant differences between the antibody responses against MAGE-1 (Figure 5a). However, anti-MAGE-3 IgG activity in MAGE-1 immunized mice was lower than that of MAGE-3 immunized mice (Figure 5b). Although both MAGE-1 and MAGE-3 have been shown to have distinct antigenic determinants in humans, and antigenic determinants have not been defined in the murine system. Human tumor antigen gene vaccination T Okamoto et al 972 Figure 4 Analysis of cross-reactivity of anti-MAGE-3 and anti-MAGE1 antibody response to rMAGE-1 and rMAGE-3, respectively by Western blotting. (a) Lanes 1 and 2 are representative of experiments with mice immunized three times biweekly with MAGE-3 and assessed for antibody against rMAGE-1. (b) Lanes 1 and 2 are representative of experiments with mice immunized three times biweekly with MAGE-1 and assessed for antibody against rMAGE-3. Representative serum analysis for two mice for each group at 1:100 dilution is shown. Detection of MAGE-1 DNA Muscle biopsies were analyzed for presence and expression of pcDNA3 and pMAGE-1 after selected periods of immunization. Tissue biopsies at the sites of vaccine injections were dissected out and nucleic acids were extracted. RT-PCR and DNA PCR plus Southern blots were performed on RNA and DNA, respectively, from muscle tissue of immunized mice and non-immunized mice (Figure 6). Muscle biopsies of mice immunized with pcDNA3 alone were assessed 7, 14 and 28 days after immunization. Two mice from each time period were killed and assessed. A 218 bp RT-PCR and DNA PCR cDNA product was detected in all animals indicating the presence of pcDNA3. RT-PCR analysis of muscle biopsies of mice immunized with MAGE-1 vaccine was carried out on days 7 (two mice), 14 (three mice) and 28 (two mice) after immunization. All tissues examined were shown to express specific MAGE-1 mRNA 7, 14 and 28 days after immunization. MAGE-1 gene expression was further verified using a separate set of specific primers to MAGE-1 (RT-PCR cDNA product 920 bp). RT-PCR analysis of muscle biopsies at the site of MAGE-1 vaccine injection also showed the presence of the pcDNA3 plasmid alone (218 bp). This may be due to incomplete transcription of the MAGE-1 gene insert in pcDNA3 or contamination of pcDNA3 without MAGE-1 gene insert in vector preparations. This was observed in only a few animals injected with different HVJ–liposome. Normal muscle and other body organs (lung, kidney, liver) RNA of nonimmunized mice were evaluated by RT-PCR and Southern blotting and were shown not to express MAGE-1 mRNA. MAGE-1 DT DNA immunization A plasmid containing MAGE-1 plus diphtheria toxin peptide DNA hybrid (MAGE-1 DT) was constructed to determine if genetically engineering an immunogenic determinant to MAGE-1 gene product would enhance antibody responses to MAGE-1. Mice were immunized Figure 5 Representative experiments of anti-MAGE-1 and anti-MAGE3 IgG after three biweekly immunizations. Affinity ELISA with rMAGE1 (a) and rMAGE-3 (b) was performed with sera at 1:100 dilution. Assessment of mice immunized with MAGE-1 vaccine (P) or MAGE-3 vaccine (p) is shown. Data are shown as mean absorbency of triplicates ± s.e. of all mice. Figure 6 DNA PCR and RT-PCR analysis of mice muscle biopsies after immunization of pcDNA3 and MAGE-1 vaccine. RT-PCR or DNA PCR was performed on isolated RNA and DNA from tissues, respectively, followed by Southern blotting with specific cDNA probes. Lanes 1 and 2 represent DNA PCR analysis 14 days after immunization with pcDNA3. Lanes 3 and 4 represent RT-PCR analysis 14 and 28 days after immunization, respectively, with pcDNA3. Lanes 5, 6 and 7 represent RT-PCR analysis 7, 14 and 28 days after immunization, respectively, with MAGE1 vaccine. Lane 8 represents DNA PCR of pcDNA3 (standard control; 218 bp). Lane 9 represents DNA PCR of MAGE-1 vaccine (standard control; 1136 bp). Lane 10 represents RT-PCR of pMAGE-1(standard control; 1136 bp). These are representative Southern blot analyses of several experiments. Human tumor antigen gene vaccination T Okamoto et al Figure 7 Analysis of antibody response to rMAGE-1 by Western blotting. Comparison of the anti-MAGE-1 IgG induction after immunization with MAGE-1 or MAGE-1 DT vaccines. Lanes 1 and 2, sera from nonimmunized mice. Lanes 3 and 4, sera from mice immunized three times biweekly with MAGE-1 vaccine. Lanes 5 and 6, mice immunized with MAGE-1 DT vaccine. Representative serum analysis for two mice for each group at 1:100 dilution is shown. (three times) with MAGE-1 DT vaccine as for MAGE-1 vaccine. The 16mer diphtheria toxin (DT) peptide sequence was tagged with a his-tag to allow peptide affinity ELISA to be performed. The antibody response to rMAGE-1 assessed by Western blot after immunization with MAGE-1 DT vaccine was not better than MAGE-1 vaccine immunization (Figure 7). In assessment of mice immunized with MAGE-1 DT by affinity ELISA there was some enhancement (not significant) of antibody response to DT peptide above control MAGE-1 vaccine (Figure 8). Overall, adding a second immunogenic determinant did not improve antibody responses to rMAGE-1. Discussion In this study we have demonstrated a novel efficient approach using a fusigenic viral liposome system to deliver human tumor antigen genes in vivo to immunize Figure 8 Representative example of anti-DT peptide IgG detection by affinity ELISA after three biweekly immunizations with MAGE-1 DT vaccine (l) or MAGE-1 vaccine (P). Mice serum was analyzed as mean absorbency triplicates ± s.e. of all mice. the host. Human cancer vaccines being studied today require culturing tumor cells, purifying tumor antigens, or producing specific peptide/recombinant proteins. The HVJ–liposome system avoids many of the tedious processes involved in vaccine preparation. Quality control and purity of plasmid DNA can be more easily monitored. Gene expression in muscle has been successful by injection of naked DNA of microbial antigens.4 However, we found that HVJ–liposome-mediated gene transfer was 30–100 times more efficient in gene expression in skeletal muscle than naked DNA transfer (unpublished data). Fusigenic viral liposomes can provide an efficient vehicle to package, deliver and direct DNA to specific targets and at the same time protect against nucleic acid degrading enzymes in body fluids and cytoplasmic organelles.8 The delivery system using the HVJ–liposome is safe and to date there have been no side effects observed in animals. Our approach of in vivo gene therapy using the host normal cells is an effective attenuated form of human tumor antigen gene vaccination. In this type of situation tumor antigen is expressed on a background of normal cell(s) as opposed to a tumor cell. The latter has many negative type regulating elements that may suppress immune responses as well as altered physiologic functions which can modify antigen expression. Gene vaccination provides an opportunity for molecular immunophysiologic manipulation of antigen expression that can be a useful tool in cancer vaccine design. Intramuscular injection has been shown in the past to be an important delivery route for induction of immunity. Skeletal muscle has properties such as vascularization, multi-nucleation, nonreplicating and capability of expressing recombinant proteins;18 these offer advantages to intramuscular site injection for gene therapy. The mechanism of how muscle presents the protein and induces immune response is still unknown. One suggestion is that recombinant protein is produced and released into the vascular network of the muscle and eventually presented by professional antigenpresenting cells such as dendritic cells or macrophages infiltrating the muscle.19 Another suggestion is that at the injection site muscle injury induces myoblast proliferation and activation of infiltrating macrophages/dendritic-like cells and they then present antigens through MHC class II antigens.18,19 Since IgG responses were detected the mechanism of antigen presentation is most likely through a T helper2 subset response and MHC class II antigen presentation. Analysis of muscle biopsies at the site of immunization showed that the plasmid DNA was being expressed after 28 days of immunization. The study verified that the expression of the plasmid DNA was transient and maintained in the cells at the site of injection for at least 1 month. This potentially provides a continual exposure of antigen to the host immune system as opposed to a single antigen injection. The advantage of the HVJ–liposome system over retroviral or adenoviral vectors is that it is not incorporated into the genome. The inactivated HVJ virus is safe and induces no pathogenic effect. The other advantage of the HVJ–liposome system is that it does not incorporate into hemopoietic-derived cells such as lymphocytes as do other liposome delivery systems.11,12 Also repetitive immunization did not appear to induce strong immune responses towards the vector system to inhibit 973 Human tumor antigen gene vaccination T Okamoto et al 974 gene transfer. This is likely due to the rapid incorporation of the fusigenic viral liposome into the host cells. We and others have shown human cancer vaccines are an effective method of immunization of patients against tumor antigens to control tumor progression and improve survival.5,20,21 Although there are many formulations of human cancer vaccines, there have been problems in efficiently inducing specific antitumor antigen responses. Immunization protocols have not succeeded very well in consistently inducing anti-MAGE immune responses in humans. In this study we demonstrate consistent induction of anti-MAGE-1 and -3 antibody responses shortly after vaccination and maintenance of activity for several weeks. The antibody titers generated were as expected for a weak immunogenic tumor antigen. There is a possibility that T cell responses were induced, however, at this time we do not know the antigenic determinants of the antigens in mice to allow assessment. Future studies will examine the induction of MAGE-1 and/or -3-specific T cells. To date, anti-MAGE1 and -3 T cell responses in mice have not been documented. Two highly homologous sequences of MAGE-1, referred to as Smage1 and Smage2 are expressed in the murine testes but not normal murine tissue.22 There may be host immune tolerance to the MAGE family proteins. Studies reported on generation of anti-MAGE-1 and -3 in mice by recombinant protein administration with adjuvants have in general not produced high antibody titers.23 We assessed the incorporation of an immunogenic determinant DT as a ‘helper’ antigen on the MAGE-1 gene to improve its efficacy. Diphtheria toxin B fragment COOH-terminal region has been shown to be immunogenic in mice.24 The failure to enhance anti-MAGE-1 responses could be due to the lack of full expression of MAGE-1 DT hybrid protein in vivo, conformation of the recombinant MAGE-1 DT protein, or lack of recognition of DT peptide by the host as an immunogenic determinant due to presentation. A low level of response was observed against DT peptide alone suggesting some induction of immune response. Alternatively, a T cell response may have been induced. Further work needs to be carried out in the development of chimeric gene constructs for gene vaccination to improve immunogenicity and polyvalency. Both MAGE-1 and MAGE-3 have been shown to be immunogenic in humans. There are other MAGE gene family members with similar homologies.25 The strategy of using two dominant immunogenic MAGE family antigens may be beneficial in that they can elicit immunity to a wide spectrum of MAGE antigens expressed by different human tumors. The cross-reactivity of the antiMAGE-1 and MAGE-3 responses demonstrated is not surprising since the proteins express 66% amino acids homology.17 Cross-reactivity to MAGE-1 and MAGE-3 has not been previously well documented. The availability of the recombinant MAGE proteins and immunized mice sera has allowed us to assess these events. The study also indicated that vaccination with MAGE-1 or -3 could potentially induce immune responses to tumors expressing either antigen. MAGE-1 and MAGE-3 are not always coexpressed in the same tumor biopsy or cell lines. Multiple genes can be incorporated into our delivery system to produce a polyvalent DNA cancer vaccine. It is becoming clearer now that effective tumor vaccination requires a polyvalent antigen vaccine to control human tumor progression effectively. 5 Recent studies have demonstrated the potential feasibility of immunization using a polynucleotide-mediated vaccine for carcinoembryonic antigen (CEA) and MUC-1.26,27 Further work on cancer gene vaccines will determine if such approaches are significantly effective in controlling tumor progression. Materials and methods MAGE-1 gene plasmid MAGE-1 gene was cloned and isolated as previously described.16 The MAGE-1 gene was cloned into the pcDNA3 plasmid vector designed for expression of proteins in eukaryotic cells (InVitrogen, San Diego, CA, USA). The pcDNA3 has an enhancer–promotor sequence from the immediate–early gene of the human cytomegalovirus, and a polyadenylation signal and transcription termination sequence from the bovine growth hormone gene. The MAGE-1 gene insert in pcDNA3 was verified by DNA sequencing. The pcDNA3 containing MAGE-1 gene (pMAGE-1) was purified by equilibrium ultracentrifugation using CsCl-ethidium bromide gradient. Purified plasmid DNA was dissolved in 10 mm Tris-HCl, pH 8.0, 0.1 mm EDTA, assessed by spectrophotometry and shown to have an A260/A280 ratio of 1.9 or higher. Further analysis by gel electrophoresis was carried out to verify the purity of the purified plasmid. Expression and purification of rMAGE-1 rMAGE-1 was expressed as previously described and purified by an affinity column containing Ni2+–NTA resin (Qiagen, Chatsworth, CA, USA).16 The rMAGE-1 construct was tagged at the amino terminal end with the sequence Gly-Ser-hexaHis for affinity purification and affinity ELISA. The recombinant protein was further purified by gel electrolution and a Biologic FPLC system (Bio-Rad, Richmond, CA, USA) for analysis. Recombinant proteins were run in Laemmli 10% SDS-PAGE gel under reducing conditions. MAGE-3 gene plasmid cDNA (942 bp) encoding full-length MAGE-3 was amplified by PCR from a human testis library (Clontech, Palo Alto, CA, USA). The PCR cDNA product obtained was digested with restriction enzyme and the appropriate size fragment was subcloned into the vector pET30b (Novagen, Madison, WI, USA) with hexaHis on the Cterminus, resulting in a plasmid designated pSH007. The full length MAGE-3 cDNA was sequenced by dideoxynucleotide sequencing method using T7 DNA polymerase (USB, Cleveland, OH, USA). Plasmid pSH007 was digested by EcoRV and NotI and the EcoRV-NotI fragment containing MAGE-3 gene was then inserted into the pcDNA3 plasmid. The pcDNA3 containing MAGE-3 gene (pMAGE-3) was purified and prepared as pMAGE-1. A DNA Expression and purification of rMAGE-3 DNA fragment of MAGE-3 gene with the terminal hexaHis affinity tag was removed from pSH007 and inserted into the SmaI site of pGEX-2T (Promega, Madison, WI, USA). This expression plasmid was transformed into E. coli strain BL21 cells. Recombinant fusion protein was Human tumor antigen gene vaccination T Okamoto et al induced by isopropyl-d-thiogalactoside (IPTG) and purified from bacterial lysates by affinity chromatography using Glutathione Sepharose 4B (Pharmacia, Piscataway, NJ, USA). Before the elution of fusion protein, rMAGE-3 was cleaved from the GST carrier by adding thrombin to the bound fusion protein and eluted off. The FPLC purified rMAGE-3 was verified by SDS-PAGE gel and Western blotting using Ni2+–NTA conjugate (Qiagen), and then used for ELISA and Western blotting. MAGE-1 DT gene plasmid The complementary oligonucleotide sequences (sense: 5′ AGCTTACGCAACCATTTCTTCATGACGGGTATGCTG TCAGTTGGAACACTGTT G-3′; antisense: 5′TCGACAA CAGTGTTCCAACTGACAGCATACCCGTCATGAAG A AATGGTTGCGTA-3′), derived from diphtheria toxin fragment B nucleotide sequence, corresponding to the Cterminal end 16 amino acid residue TQPFLHDGY AVSWNTV were synthesized. The sequences were hybridized and inserted into the HindIII–SalI sites of pBluescript. cDNA encoding full length of MAGE-1 was then inserted into BamHI–EcoRV sites, fusing it to the Nterminus of the DT peptide nucleotide sequence. The cDNA clone was sequenced by the dideoxynucleotide sequencing method using T7 DNA polymerase (USB). The BamHI–XhoI fragment containing MAGE-1 DT gene was then inserted into the pcDNA3 plasmid. The plasmid MAGE-1 DT was purified as described for pMAGE-1. PCR and Southern blot analysis RT-PCR and DNA PCR plus Southern blot analyses of MAGE-1 were performed as previously described.28 PCR cDNA products of MAGE-1 were evaluated by gel electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining under UV light. Southern blot analysis of gel electrophoresed PCR cDNA product was performed using a MAGE-1-specific cDNA probe. The pcDNA3, pMAGE-1 and MAGE-1 gene insert alone PCR cDNA products were 218 bp, 1136 bp and 920 bp, respectively. The sequences of the primers were as follows: pcDNA3; 5′ primer was 5′-TAATACGACTCACTATAGGG-3′ and the 3′ primer was 5′-AGGGGCAAACAACAGATGGC-3′ that gave a 218 bp cDNA product for pcDNA3 alone and a 1136 bp cDNA product for pcDNA3 with MAGE-1 insert. Mouse tissue was obtained from animals killed at designated time-points after vaccinations. The hind muscle at the site of injection was aseptically dissected, minced into small pieces and processed for RNA and DNA. Total RNA and DNA from the tissue biopsies was extracted, isolated and purified using Tri-Reagent (Molecular Research Center, Cincinnati, OH, USA) protocol according to the manufacturer’s instructions. RNA and DNA extraction was carried out in a designated sterile laminar flow hood with RNase and DNase-free labware. Purified RNA and DNA was quantified and assessed for purity by UV spectrophotometry. Normal muscle and other body organs were assessed from nonimmunized animals of the same sex and age group. Preparation of HVJ–liposomes HVJ–liposomes were prepared as previously described.11 Briefly, HVJ (Z strain) was prepared from chorioallantoic fluid of virus inoculated embryonated chick eggs and the hemagglutinating units (HAU) of the virus titer was determined by spectrophotometry. Preparation of liposomes involved mixing bovine brain l-a-phosphatidylserine sodium salt (Avanti Polar-lipids, Alabaster, AL, USA), egg yolk l-a-phosphatidylcholine (Sigma, St Louis, MO, USA), and cholesterol (Sigma) in a glass tube at a weight ratio of 1:4, 8:2 with tetrahydrofuran (Nakarai, Kyoto, Japan). The tube of lipid mixture was evaporated using a rotary evaporator while under 400 mm vacuum pressure and immersed in a 45°C water bath. HMG-1 protein was purified from calf thymus as previously described.11 Purified plasmid DNA (200 mg) was mixed with HMG-1 (65 mg) and BSS (137 mm NaCl, 5.4 mm KCl, 10 mm Tris-HCl, pH 7.6) in nuclease-free tubes. The mixture was incubated in a water bath at 20°C for 1 h. The HMG-1:DNA mixture was then added to the lipid mixture and agitated intensely by vortexing, water bath sonication and incubation in a 37°C water bath for eight cycles. Balanced salt solution (BSS) was added to the unilamellar liposomes:HMG-1:DNA, incubated in a 37°C water bath (shaking) and then put in an ice bath. Purified HVJ was inactivated with UV irradiation 10 J/m2 /s for 3 min. Inactivated HVJ (30 000 HAU) was added to the DNA:liposome solution, incubated on ice for 10 min and then incubated in a 37°C shaking water bath for 1 h. Free HVJ was then removed from HVJ–liposomes by sucrose density gradient centrifugation. HVJ–liposomes were then carefully removed from the density gradient, washed, precipitated by centrifugation (27 000 g, 30 min), resuspended in sterile BSS plus 2 mm CaCl 2 and kept on ice until used. Immunization protocol The HVJ was treated with detergent, heat and UV light inactivating any pathogenic effects in the host. C57BL/6 male mice 6 to 8-weeks old in groups of three or four were used in each experiment. Mice were lightly anesthetized with ether vapor and injected (150 ml) with HVJ– liposome solution in the right quadricep hind leg muscle only with a sterile 26-gauge needle syringe. Animals were bled before vaccination and at designated timepoints. Before bleeding animals were anesthetized using ether vapor and subsequently retro-orbital bled using sterile glass polished Pasteur pipettes. Blood (approximately 250 ml) was collected in 0.5 ml Eppendorf tubes, clotted at 4°C and centrifuged at 700 g for 5 min. The serum was carefully removed and aliquoted into Eppendorf tubes and stored at −30°C until used. Western blotting Affinity purified recombinant proteins (5 mg) were prepared and Western blotting was carried out as previously described.16 The blots were blocked with SuperBlock blocking buffer (Pierce, Rockford, IL, USA) overnight at room temperature. Blots were tested with various mouse serum dilutions in PBS. After washing several times blots were incubated with alkaline phosphatase-conjugated goat anti-mouse IgG (g-chain specific) or IgM (m-chain specific) (Caltag, San Francisco, CA, USA). Blots were washed and developed using 5-bromo-4-chloro-3-indolyl-1-phosphate and Nitro blue tetrazolium (Promega). Negative controls were conjugate alone with developing solution, non-immunized mice sera (age and sex matched), and pcDNA3 alone immunized mice. 975 Human tumor antigen gene vaccination T Okamoto et al 976 ELISA An anti-rMAGE-1 or -3 affinity ELISA was developed to detect mouse anti-MAGE-1 or -3 antibodies. Briefly, purified rMAGE-1 or rMAGE-3(4 mg per well) with hexaHis tag in 10 mm Tris-HCl plus 50 mM NaCl buffered saline pH 7.5 (TBS) was incubated overnight at room temperature in Ni2+ chelate coated ELISA microplates (Xenopore, Hawthorne, NJ, USA). Microplates were washed three times with TBS, incubated with 5% SuperBlock blocking buffer for 2 h at room temperature and washed three times with PBS. Mouse serum was diluted in PBS and added to microwells and incubated at room temperature for 2 h and subsequently washed three times with PBS. Goat anti-mouse IgG (g-chain specific) horseradish peroxidase conjugate (Caltag) was added and plates were incubated for 2 h at room temperature, washed five times with PBS and developed with ortho-phenylenediamine sodium citrate solution plus 6 n HCl. Plates were then read at 490 nm by using an ELISA reader (Molecular Devices, Palo Alto, CA, USA), and data were analyzed using the instrument software. The DT C-terminal peptide with a four histidine tag TQPFLHDGYAVSWNTVHHHH was synthesized by Research Genetics (Huntsville, AL, USA). The purity of the his tagged peptide used in the affinity ELISA was >97%. The peptide (100 pmoles per well) was incubated in Ni2+ chelate coated ELISA microplates. Procedures for ELISA were the same with anti-rMAGE-1 and -3 affinity ELISA. Rabbit anti-DT peptide serum (1:104 dilution) was used as a positive control for DT-his tag peptide binding in the affinity ELISA plates. Acknowledgements This work was supported in part by the National Institutes of Health-NCI grant CA-12582 and Joseph Drown Foundation (DSBH). References 1 Michel ML et al. DNA-mediated immunization to the hepatitis B surface antigen in mice: aspects of the humoral response mimic hepatitis B viral infection in humans. Proc Natl Acad Sci USA 1995; 92: 5307–5311. 2 Huygen K et al. Immunogenicity and protective efficacy of a tuberculosis DNA vaccine. Nature Med 1996; 2: 893–898. 3 Wang B et al. Gene inoculation generates immune responses against human immunodeficiency virus type 1. Proc Natl Acad Sci USA 1993; 90: 4156–4160. 4 Wolff JA et al. Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle. Hum Mol Genet 1992; 1: 363–369. 5 Hoon DSB, Irie RF. Current status of melanoma vaccines. Can they control malignant melanoma? BioDrug 1997; 1: 66–84. 6 Cotten M, Wagner E, Birnstiel ML. Receptor-mediated transport of DNA into eukaryotic cells. Meth Enzymol 1993; 217: 618–643. 7 Kaneda Y, Iwai K, Uchida T. Increased expression of DNA cointroduced with nuclear protein in adult rat liver. Science 1989; 243: 375–378. 8 Dzau VJ, Mann MJ, Morishita R, Kaneda Y. Fusigenic viral liposome for gene therapy in cardiovascular diseases. Proc Natl Acad Sci USA 1996; 93: 11421–11425. 9 Yanagihara I et al. Expression of full-length human dystrophin cDNA in mdx mouse muscle by HVJ–liposome injections. Gene Therapy 1996; 3: 549–553. 10 Uchiyama A et al. Transfection of interleukin 2 gene into human melanoma cells augments cellular immune response. Cancer Res 1993; 53: 949–952. 11 Kaneda Y. Virus (Sendai virus envelope)-mediated gene transfer. Cell Biology: A Laboratory Handbook. Academic Press: San Diego, 1994, pp 50–57. 12 Okada Y. Sendai virus-induced cell fusion. Meth Enzymol 1993; 221: 18–39. 13 Isaka Y et al. Gene therapy by skeletal muscle expression of decorin prevents fibrotic disease in rat kidney. Nature Med 1996; 2: 418–423. 14 Morishita R et al. A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo. Proc Natl Acad Sci USA 1995; 92: 5855–5859. 15 van der Bruggen P et al. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 1991; 254: 1643–1647. 16 Hoon DSB, Yuzuki D, Hayashida M, Morton DL. Melanoma patients immunized with melanoma cell vaccine induce antibody responses to recombinant MAGE-1 antigen. J Immunol 1995; 154: 730–737. 17 Gaugler B et al. Human gene MAGE-3 codes for an antigen recognized on a melanoma by autologous cytolytic T lymphocytes. J Exp Med 1994; 179: 921–930. 18 Hohlfield R, Engel AG. The immunobiology of muscle. Immunol Today 1994; 15: 269–274. 19 Kuhober A et al. DNA immunization induces antibody and cytotoxic T cell responses to hepatitis B core antigen in H-2b mice. J Immunol 1996; 156: 3687–3695. 20 Morton DL et al. Prolongation of survival in metastatic melanoma after active specific immunotherapy with a new polyvalent melanoma vaccine. Ann Surg 1992; 216: 463–482. 21 Morton DL et al. Polyvalent melanoma vaccine improves survival of patients with metastatic melanoma. Ann NY Acad Sci 1993; 690: 120–134. 22 De Backer O et al. Structure, chromosomal location, and expression pattern of three mouse genes homologous to the human MAGE genes. Genomics 1995; 28: 74–83. 23 Carrel S et al. Monoclonal antibodies against recombinantMAGE-1 protein identify a cross-reacting 72 kDa antigen which is co-expressed with MAGE-1 protein in melanoma cells. Int J Cancer 1996; 67: 417–422. 24 Autran B et al. Monoclonal B-cell response to diphtheria toxoid: evidence for cross-reactive epitopes. Immunol 1987; 60: 531–538. 25 De Plaen E et al. Structure, chromosomal localization, and expression of 12 genes of the MAGE family. Immunogenetics 1994; 40: 360–369. 26 Conry RM et al. Characterization of a messenger RNA polynucleotide vaccine vector. Cancer Res 1995; 55: 1397–1400. 27 Graham RA, Burchell JM, Beverly P, Taylor-Papadimitriou J. Intramuscular immunization with MUC1 cDNA can protect C57 mice challenged with MUC1-expressing syngeneic mouse tumor cells. Int J Cancer 1996; 65: 664–670. 28 Hoon DSB et al. Detection of occult melanoma cells in blood with a multiple-marker polymerase chain reaction assay. J Clin Oncol 1995; 13: 2109–2116.