Download Planta - University of Regina

Planta (2001) 214: 75±84
DOI 10.1007/s004250100586
O R I GI N A L A R T IC L E
Yasuyo Yamazaki á Dae-Yeon Suh
Worapan Sitthithaworn á Kazuhiko Ishiguro
Yukie Kobayashi á Masaaki Shibuya
Yutaka Ebizuka á Ushio Sankawa
Diverse chalcone synthase superfamily enzymes from the most
primitive vascular plant, Psilotum nudum
Received: 16 November 2000 / Accepted: 20 January 2001 / Published online: 13 June 2001
Ó Springer-Verlag 2001
Abstract Psilotum nudum Griseb is a pteridophyte and
belongs to the single family (Psilotaceae) of the division,
Psilophyta. Being the only living species of a once
populated division, P. nudum is the most primitive vascular plant. Chalcone synthase (CHS; EC 2.3.1.74)
superfamily enzymes are responsible for biosyntheses of
diverse secondary metabolites, including ¯avonoids and
stilbenes. Using a reverse transcription-polymerase
chain reaction strategy, four CHS-superfamily enzymes
(PnJ, PnI, PnL and PnP) were cloned from P. nudum,
and heterologously expressed in Escherichia coli. These
four enzymes of 396±406 amino acids showed sequence
identity of >50% among themselves and to other
higher-plant CHS-superfamily enzymes. PnJ and PnP
preferred p-coumaroyl-CoA and isovaleryl-CoA, respectively, as starter CoA and catalyzed CHS-type ring
formation, indicating that they are CHS and phlorisovalerophenone synthase, respectively. On the other
hand, PnI and PnL preferred cinnamoyl-CoA as starter
CoA and catalyzed stilbene synthase-type cyclization
and thus were determined to be pinosylvin synthases
(EC 2.3.1.146). In addition, PnE, which uniquely contains a glutamine in place of otherwise strictly conserved
histidine, had no apparent in vitro catalytic activity.
Phylogenetic analysis indicated that these P. nudum
clones form a separate cluster together with Equisetum
U. Sankawa (&)
International Traditional Medicine Research Center,
Toyama International Health Complex,
151 Tomosugi, Toyama 939-8224, Japan
E-mail: [email protected]
Fax: +81-76-4280834
Y. Yamazaki á D.-Y. Suh á W. Sitthithaworn á K. Ishiguro
Y. Kobayashi á U. Sankawa
Faculty of Pharmaceutical Sciences,
Toyama Medical and Pharmaceutical University,
2630 Sugitani, Toyama 930-0194, Japan
M. Shibuya á Y. Ebizuka
Graduate School of Pharmaceutical Sciences,
The University of Tokyo, 7-3-1 Hongo,
Bunkyo-ku, Tokyo 113-0033, Japan
arvense CHS. This cluster of pteridophytes is located next
to the cluster formed by pine (gymnosperm) enzymes,
in agreement with their evolutionary relationships.
Psilotum nudum represents a plant with the most diverse
CHS-superfamily enzymes and this ability to diverge
may have provided a survival edge during evolution.
Keywords Chalcone synthase (superfamily) á
Phlorisovalerophenone synthase á Pinosylvin
synthase á Psilotum
Abbreviations BNY: bisnoryangonin á CHS: chalcone
synthase á CTAL: p-coumaroyltriacetic acid lactone á
LC-APCIMS: liquid chromatography-atmospheric
pressure chemical ionization mass spectrometry á ORF:
open reading frame á PCR: polymerase chain reaction á
PIVPS: phlorisovalerophenone synthase á RACE: rapid
ampli®cation of cDNA ends á STS: stilbene synthase
Introduction
Psilotum nudum (whisk fern) is a pteridophyte and belongs to the single family (Psilotaceae) of the division,
Psilophyta. Having survived for 400 million years on
earth, it is the most primitive vascular plant and grows
in tropical and subtropical regions. Flavonoids, ubiquitous in higher plants, are produced by a high proportion of the bryophytes (liverworts and mosses) and
by virtually all of the pteridophytes (fern allies and
ferns) (Markham 1988). Flavonoids along with other
phenolics protect plants from UV radiation and played a
critical role in evolution of land plants from the sea.
Earlier phytochemical studies found that the predominant ¯avonoids in P. nudum are bi¯avones of the
amento¯avone type (Wallage and Markham 1978).
Psilotum nudum also produces a high level (2±5%) of
psilotin, a unique antimicrobial phenolic glycoside biosynthetically related to the ¯avonoids (Leete et al. 1982).
The ®rst committed step of ¯avonoid biosynthesis is
carried out by chalcone synthase (CHS; EC 2.3.1.74),
76
which catalyzes repetitive decarboxylative condensation
of a starter CoA derived from the phenylpropanoid
pathway with three C2-units from malonyl-CoA and
regiospeci®c cyclization to give chalcone (Fig. 1)
(Kreuzaler and Hahlbrock 1975). CHS is a typical homodimeric plant polyketide synthase with approx. 43kDa subunits. Based on the similarity in sequence and
function, stilbene synthase (SchoÈppner and Kindl 1984),
acridone synthase (Lukacin et al. 1999) and bibenzyl
synthase (Preisig-MuÈller et al. 1995) together with CHS
have been considered as members of the CHS superfamily (SchroÈder 1999). Recently, the family has been
expanded to include 2-pyrone synthase from Gerbera
hybrida (Eckermann et al. 1998), phlorisovalerophenone
synthase from Humulus lupulus (Paniego et al. 1999),
and p-coumaroyltriacetic acid synthase from Hydrangea
macrophylla (Akiyama et al. 1999). These enzymes share
approx. 60% of sequence identity and catalyze a speci®c
number of condensation reactions between starter-CoA
and malonyl-CoA molecules (Fig. 1). Thus, the members of this enzyme family are responsible for biosyntheses of a wide range of natural products.
There is growing evidence that CHS and other condensing enzymes (b-ketoacyl-acyl carrier protein synthase) in primary fatty acid metabolism may have a close
evolutionary relationship (Jez et al. 2000) and that other
CHS-superfamily enzymes, in turn, may have evolved
from CHS (Tropf et al. 1994; SchroÈder 1999). Genes of
more than 100 CHSs and CHS-superfamily enzymes
have been cloned from various plants, but none from the
lower vascular plants. In order to gain insights into the
evolution of CHS and other CHS-superfamily enzymes,
it is invaluable to study the CHS-superfamily enzymes
from primitive plants. Herein, we report cloning and
characterization of ®ve diverse CHS-superfamily
proteins from P. nudum. In addition, a CHS was also
cloned from the green sprouts of Equisetum arvense
Fig. 1 Plant CHS-superfamily
enzymes catalyze repetitive
condensation reactions between
a starter CoA and three molecules of malonyl-CoA. Diversity in the choice of starter CoA,
the mode of cyclization and,
possibly, the number of condensation reactions allows these
enzymes to produce a wide
range of natural products. ACS
Acridone synthase, BPS benzophenone synthase (Beerhues
1996), STS stilbene synthase,
CHS chalcone synthase, PIVPS
phlorisovalerophenone
synthase
(Equisetaceae, horsetail) which is one of the most ancient
living vascular plants, second only to the Psilotaceae.
Materials and methods
Plant material and cloning
Shoots of Psilotum nudum Griseb were collected at the Botanical
Garden of Toyama Medical & Pharmaceutical University. Total
RNA was isolated from the shoots (1.0 g) by the phenol-SDS
procedure and lithium chloride precipitation, and mRNA was
poly(A)+-selected using an oligo(dT)-cellulose mRNA puri®cation
kit (Pharmacia) as directed by the supplier. cDNA was synthesized
from 4 lg of mRNA using Superscript II reverse transcriptase
(BRL) and the oligo(dT)16 primer according to the manufacturer's
instructions. Following RNase H treatment, the resulting singlestrand cDNA mixture was used as a template for the polymerase
chain reaction (PCR). For PCR ampli®cation of the core region of
the cDNA encoding CHS-like enzymes, two sets of degenerate
oligonucleotide primers (see Fig. 2) were synthesized according to
the highly conserved amino acid sequences of chalcone synthases
(Akiyama et al. 1998). The ®rst PCR was performed using Ex Taq
DNA polymerase (Takara, Kyoto, Japan) with the external sets of
degenerate primers (CHS112S, 5¢-(A/G)A(A/G) GCI ITI (A/
C)A(A/G) GA(A/G) TGG GGI CA-3¢ and CHS380A, 5¢-TCI
A(C/T)I GTI A(A/G)I CCI GGI CC(A/G) AA-3¢). The numbering
of the primers corresponds to the sequence of Pueraria lobata CHS
(GenBank Accession No. D10223). The PCR program was: 1 min
of denaturation at 94 °C, 30 cycles of 30 s at 94 °C, 30 s at 42 °C,
30 s at 72 °C, and 10 min of ®nal extension at 72 °C. A nested PCR
was performed with the internal sets of degenerate primers
(CHS174S, 5¢-GCI AA(A/G) GA(C/T) ITI GCI GA(A/G)
AA(C/T) AA-3¢ and CHS368A, 5¢-CCC (A/C)(A/T)I TCI A(A/G)I
CCI TCI CCI GTI GT-3¢) using the same PCR program. The ca.
600-bp PCR products were cloned using the Perfectly Blunt
Cloning kit (Novagen). Positive clones were selected by colonyPCR, grouped by double restriction mappings, and then sequenced
by PCR-based sequencing using the Dye Terminator Cycle
Sequencing kit (Applied Biosystems).
The four core sequences thus obtained were used to design
speci®c primers for the rapid ampli®cation of cDNA ends (RACE)
(Frohman et al. 1988) to determine full-length nucleotide sequences
including 5¢- and 3¢-untranslated regions of ®ve CHS-like cDNAs
77
Fig. 2 Alignment of Psilotum
nudum CHS-superfamily protein sequences predicted from
cDNA sequences. The sequence
of Equisetum arvense chalcone
synthase (EaCHS) is also included. Conserved active-site
amino acids are highlighted in
bold. Sequences used to design
degenerate primers for cloning
of core fragments are shown by
arrows
(designated as PnJ, PnP, PnI, PnE and PnL). Both 5¢- and 3¢RACE were performed using a cDNA ampli®cation kit (GIBCO).
For 3¢-RACE, total RNA was reverse-transcribed using the
adapter primer (5¢-¢GGC CAC GCG TCG ACT AC (T)17-3¢). The
PCR program was: 1 min of denaturation at 94 °C, 30 cycles of
30 s at 94 °C, 30 s at the selected annealing temperature (Ta, 42±
64 °C), 1 min at 72 °C, and 10 min of ®nal extension at 72 °C with
the universal ampli®cation primer (GIBCO) as the antisense
primer. The sense primers (Table 1) during the ®rst PCR were PnJ270 S (Ta=56 °C) for PnJ, 3¢-185S (42 °C) for PnP, PnI-251S
(55 °C) for PnI, PnE-319S (50 °C) for PnE, and 3¢-185S (42 °C) for
PnL. For the nested second PCR, PnJ-321S (56 °C), PnP-290S
(55 °C), PnI-296S (55 °C), PnE-345S (64 °C), and 3¢-198S (42 °C)
were used for each clone.
Likewise, 5¢-RACE procedures including terminal deoxynucleotidyl transferase tailing were performed according to the manufacturer's protocol (GIBCO). The antisense primers used for the
reverse transcription were PnJ-245A, PnP-269A, PnI-268A, PnE293A, and PnL-293A. For the ®rst and nested second PCR reactions, the primers PnJ-216A, PnP-254A, PnI-255A, PnE-236A,
PnL-260A, and PnJ-141A, PnP-238A, PnI-240A, PnE-207A, PnL94A were used, respectively. The Ta during PCR varied in the range
of 50 to 60 °C. The PCR products were subcloned into pT7Blue T
Vector (Novagen), and the resulting plasmids were transformed
into Escherichia coli NovaBlue (Novagen) competent cells for selection and sequencing. The nucleotide and amino acid sequences
of P. nudum CHS-like proteins obtained in this study have been
deposited in the EMBL/GenBank/DDBJ databank (Accession
Nos. PnJ, AB022682; PnP, AB022683; PnI, AB022685; PnE,
AB040027; PnL, AB022684).
Using essentially identical methods but with speci®c primers
(Table 1), the full-length nucleotide sequence (AB030004) of a CHS
cDNA (EaCHS) was also cloned from the green sprouts of
Equisetum arvense.
Heterologous expression and puri®cation
The cloned CHS-superfamily proteins were expressed as thioredoxin-HisTag-fusion protein (Trx-CHS) using pET-32a(+) vector
(Novagen) for improved solubility and easy puri®cation. First, the
open reading frames (ORFs) of the cloned cDNAs were PCRampli®ed with the cDNA mixture as template. The 5¢-¯anking
primers used were PnJ-N, PnP-N, PnI-N, PnL-N, PnE-N, and
EaCHS-N and the 3¢-¯anking primers were PnJ-C, PnP-C, PnI-C,
PnL-C, PnE-C, and EaCHS-C (Table 1). The ampli®ed PCR
product was gel-puri®ed, digested with restriction enzymes and
subcloned into pET-32a(+) (Novagen).
Escherichia coli BL21(DE3)pLysE cells transformed with expression plasmid were grown at 37 °C until A600=0.6 in LuriaBertani medium containing 100 lg/ml ampicillin and 34 lg/ml
chloramphenicol, and expression was induced with 1 mM isopropyl-b-D-thiogalactopyranoside. After an induction period of 18 h at
25 °C, the cells were harvested after centrifugation at 5,000 g for
10 min, and subjected to a cycle of freeze/thaw to e€ect lysis. The
cell lysate was suspended in 1/10 culture volume of bu€er A
78
Table 1 Oligonucleotide primers used in this study. The restriction-enzyme sites are
underlined and the 5¢-start and
3¢-stop codons are in italics.
The numbering of the primers is
based on the Pueraria lobata
chalcone synthase sequence
Primer
3¢-RACE
3¢-185S
3¢198S
PnJ-270S
PnJ-321S
PnP-290S
PnI-251S
PnI-296S
PnE-319S
PnE-345S
EaCHS-214S
EaCHS-272S
5¢-RACE
PnJ-141A
PnJ-216A
PnJ-245A
PnP-238A
PnP-254A
PnP-269A
PnI-240A
PnI-255A
PnI-268A
PnE-207A
PnE-236A
PnE-293A
PnL-94A
PnL-260A
PnL-293A
EaCHS-183A
EaCHS-241A
EaCHS-291A
ORF ampli®cation
PnJ-N
PnP-N
PnI-N
PnL-N
PnE-N
EaCHS-N
PnJ-C
PnP-C
PnI-C
PnL-C
PnE-C
EaCHS-C
Sequence (5¢®3¢)
CGA(A/G)T(T/C)(T/C)T(A/T)GTIGT(T/G)TG(T/C)AG(T/C)AG(T/C)A
TTC(A/C)GIGG(A/G)CC(T/G)(A/C)ITGAA(A/G)(A/C)TCA
GATGTACCAGGACTCATATCCA
ACAACTAAGACCCGAGAAATTGGC
ATGTTTGATGCATGTAACCCAAG
GCCAAGCTATTGCAGGGCAG
TAACCGACTGGAATGATATATTT
GTCTCAATTAAACCTGCAGCCCC
CCGTGTGTCCCTTTCATCTTGGACTACATG
TTGTTTGGTGACGGTGCGGCA
GCCAGGGATCATCTCCAAGAACATT
TCAGCACCAGGCATATCCACACCACT
TGAACACGGCTTGCCCCACGAGACTGTCCAA
TTGGATCCAGTCCAGTGCAT
TTCGAAGGAGGCATTCTCTGCGTGTGG
GACAGCATCGTCGCTGTCAGGTACCACACT
GCAAAGTGTGTATGTTCTGCCC
CCTTATCTCAAACCACGGCTTCTCAAGATC
GCAATAGCTTGGCCGCTTTCCGGAATCAAGTAC
AGAGACATCTCTGGT
CTGAACAAGTCCTGCCCCATGGAACTC
TCAGTCCAGTGGATTTCGAAGT
TCCGGAACCTCTTCG
CGCACATCAAGGGAAGGCTCCCAATAAATTCC
TTCCTTGAGGTGTCCCGCGATCGCGGGGCT
TCCATCGAAGGCGTCTTG
GCAAACAACCAAGACCCGAGCTCCC
GGTAGAATGTTTGATCCGCTCCAA
CATTCCCTGACTCATCAAAC
CTCCAGATATCTCATCCCGGAGAGTCGAAAGA (EcoRV)
GAATCGATATCATTCAGAATTCAGACTCTGCT (EcoRV)
CAGGAGCCATGGCCACCGGTGAGGCCAGC (NcoI)
CGAAAGATATCGTTTCTGGTGAGGCCAACGGT (EcoRV)
CTCCCATGGCGTCCAGGAGAGCCCACACT (NcoI)
CCTTGACCATGGCTGTCCTTGAAGAGTCTGCC (NcoI)
CCACCGAATTCATGACTCGCGCCCATCATCCTCCTC (EcoRI)
AAAAAAAGCTTAGAAATACTTGAATGCTTGAGTGGG (HindIII)
CCCCGAAGCTTATGAAGCTACTGTCCATGTGGGTAC (HindIII)
ATATAGGATCCATGATGAAAGTAGTGATGCTATGGGGAC (BamHI)
GGTGGCGGATCCTCAGCCCTGGCTGCTCTTCTGCTC (BamHI)
CAAAGGGATCCTGATCAACAAGCTAATCGTATGCT (BamHI)
[20 mM sodium phosphate bu€er (pH 7.4), 10% glycerol, 300 mM
NaCl, 0.1% Triton X-100, 5 mM imidazole, 5 mM b-mercaptoethanol]. The resulting solution was brie¯y sonicated (3´10 s) and
the soluble fraction was recovered after centrifugation at 12,000 g
for 15 min.
Taking advantage of the (His)6-tag, the fusion proteins were
puri®ed to high purity by a metal ion-anity chromatography. The
soluble fraction was applied to a column of Ni2+-iminodiacetic
acid Sepharose (Chelating Sepharose Fast Flow; Pharmacia)
equilibrated with bu€er A. Following washing steps with bu€er A
(10Vb) and 80 mM imidazole in bu€er A (6Vb), the enzyme was
eluted with 300 mM imidazole in bu€er A (3Vb). The enzyme solution was bu€er-changed to bu€er B [100 mM potassium phosphate bu€er (pH 7.2), 10% glycerol, 0.1% Triton X-100, 1 mM
DTT] using a PD-10 column (Pharmacia) for functional assay.
In vitro functional assay and steady-state kinetic analysis
The standard assay mixture (0.1 ml) contained puri®ed enzyme
(3 lg), 0.1 mM starter CoA (e.g. p-coumaroyl-CoA) and 16.8 lM
[2-14C]malonyl-CoA (2.2 GBq/mmol; NEN) in bu€er B. After
incubation at 37 °C for 15 min, the reaction was terminated by
acidi®cation (7.5 ll of 1 N HCl) and the reaction products were
extracted with 200 ll of ethyl acetate. After a brief centrifugation, a
portion (50 ll) of the extract was analyzed by TLC on RP18 plates
(Merck) with methanol:H2O:acetic acid (60:40:1, by vol.) as solvent. The radioactive products were quanti®ed with an imaging
plate analyzer (BAS2000; Fuji) using standards of known speci®c
activity. The speci®c enzyme activity was expressed in pmol of the
product produced s±1 mg±1 (pkat/mg). Some reaction products were
identi®ed by carrier dilution assay and liquid chromatographyatmospheric pressure chemical ionization mass spectrometry
(LC-APCIMS) as previously described (Akiyama et al. 1999;
Yamaguchi et al. 1999).
Malonyl-CoA decarboxylase activity was determined following
acetyl-CoA formation (Eckermann et al. 1998).
The Km(app) values were determined from Michaelis-Menten
plots using ®ve di€erent substrate concentrations covering the
range of 0.2±3 Km(app) as previously reported (Suh et al. 2000).
Other methods
Various starter CoA esters were prepared from the respective
N-hydroxysuccinimide esters according to StoÈckigt and Zenk
79
(1975). The purity of the CoA-ester was checked by HPLC (Cosmosil 5C 18-MS; 150 mm long, 4.6 mm i.d.; 0.25 M NaH2PO4:CH3CN = 4:1; 0.6 ml/min; UV 254 nm) and was higher than
90%. The protein concentration was determined using BioRad's
adaptation of the Bradford dye assay (Bradford 1976) with BSA as
standard.
Pueraria lobata CHS and Arachis hypogaea stilbene synthase
(STS) were overexpressed in E. coli as thioredoxin fusion proteins as
previously described (Suh et al. 2000). Recombinant hop (Humulus
lupulus) phlorisovalerophenone synthase (PIVPS; AB015430) was a
kind gift from Dr. Yukio Okada (Sapporo Breweries, Japan).
Site-directed mutagenesis of PnE was performed using a megaprimer strategy (Ke and Madison 1997) as described previously
(Suh et al. 2000). The mutagenic primer for the Q303H mutant was
5¢-CTGGATCGCGCACCCTGGCTG-3¢ (the mutated residue in
bold).
Strictly conserved CHS active-site residues, Cys164,
Phe215, Phe 265, His303 and Asn336 (numbering in
Ferrer et al. 1999) are present in all ®ve P. nudum CHSsuperfamily proteins and in EaCHS except that His303
is replaced with Gln in PnE and Phe265 is replaced with
Leu in PnP. Another highly conserved family signature
sequence (372G(F/L)GPG) common to CHS-superfamily
enzymes is also found (Fliegmann et al. 1992; Suh et al.
2000). Phylogenetic analysis (Fig. 3) using exon nucleotide sequences indicated that the P. nudum clones form
a separate cluster together with CHS from E. arvense
(a pteridophyte) which is located next to the cluster formed
by CHSs and STSs from pine (Pinaceae), a gymnosperm,
in agreement with their evolutionary relationship.
Results
Expression in E. coli
CHS-superfamily cDNAs from P. nudum
and E. arvense
Nested PCR with two sets of degenerate primers and
cDNAs prepared from total mRNAs as template yielded
four approx. 600-bp core sequences. Full-length cDNA
sequences including 5¢- and 3¢-untranslated regions of
the four clones (PnJ, PnP, PnI and PnE) were obtained
by employing the RACE method with primers derived
from these core sequences. When a set of degenerate
primers (3¢-185S and 3¢-198S) (Table 1) designed from
the highly conserved regions of the core sequences was
used in 3¢-RACE, an additional clone (PnL) was identi®ed and its full sequence was also obtained. The ORFs
encode proteins of 396 to 406 amino acids with calculated size of approx. 45 kDa. The deduced amino acid
sequences (Fig. 2) were found to closely resemble other
CHS sequences. Pairwise comparisons of the amino acid
sequences with other CHS-superfamily enzymes from
higher plants are listed in Table 2. The sequence identity
varies from 50 to 77%. Notable are higher sequence
identity found between PnJ and PnE (77%) and PnI and
PnL (73%) and relatively lower identity of <60% found
between PnP and other proteins. A translated BLAST
search (Altschul et al. 1997) of the PnJ sequence against
the entries in the Swiss-Prot databank yielded 87 CHS
enzymes with amino acid identity of higher than 72% (E
value of 10±159). A CHS cDNA cloned from E. arvense
(EaCHS) showed the highest identity of 75%. A similar
search with the PnP sequence yielded 98 CHS enzymes
with identity higher than 60%.
Table 2 Amino acid sequence
identity between CHS-superfamily enzymes from Psilotum
nudum and other higher plants.
ACS Acridone synthase, BBS
bibenzyl synthase
PnE
PnP (PIVPS)
PnI (STS)
PnL (STS)
Pueraria lobata CHS
Arachia hypogaea STS
Humulus lupulus PIVPS
Ruta graveolens ACS
Phalaenopsis sp. BBS
To determine the enzyme activities of the cloned proteins, the ORFs were cloned into an E. coli expression
vector, pET-32a(+), which introduces thioredoxin,
(His)6-tag and the enterokinase cleavage site upstream of
the N-end of the inserted foreign protein. Thus the expressed fusion protein (approx. 61 kDa) was readily
puri®ed to higher purity by a single step of Ni2+-chelation chromatography. Representative SDS-PAGE results are shown in Fig. 4. Expression level and solubility
of the recombinant thioredoxin fusion PnJ (Trx-PnJ)
and EaCHS were comparable to those of Pueraria lobata
CHS (Suh et al. 2000). However, a majority of the
overexpressed Trx-PnE was recovered in inclusion
bodies. Expression levels of Trx-PnI, Trx-PnL and TrxPnP were low, resulting in lower yields of puri®ed
enzymes (0.5±1 mg per 100 ml culture) than that of TrxPnJ (5 mg/100 ml culture). As earlier studies with CHSs
from other plants showed no functional di€erence
between thioredoxin fusion enzyme and native enzyme
recovered after removing the fusion part by enterokinase
(Stratagene) cleavage (Yamaguchi et al. 1999; Suh et al.
2000), the thioredoxin fusion proteins were used for
further analysis in this study.
PnJ and EaCHS are chalcone synthases
To characterize the cloned enzymes, enzyme assay was
carried out using p-coumaroyl-CoA and [2-14C]malonyl-
PnJ (CHS)
PnE
PnP (PIVPS)
PnI (STS)
PnL (STS)
77
56
56
60
70
61
61
59
55
55
55
60
66
56
59
55
54
50
57
57
53
56
54
52
73
56
52
53
51
52
62
59
59
57
56
80
Fig. 4 SDS-polyacrylamide gel electrophoresis of crude soluble (s)
and insoluble (i) fractions of Escherichia coli extracts showing the
expression levels of recombinant proteins. Puri®ed 61-kDa thioredoxin fusion protein (f) and 45-kDa native protein (n) recovered
by enterokinase cleavage were also shown. Although not shown,
the expression level and solubility of PnI and PnP were similar to
those of PnL. Proteins were separated on a 12% acrylamide mini
slab gel and stained with Coomassie Brilliant Blue R250. The
numbers on the left indicate Mr of standard markers
Fig. 3 Neighbor-joining phylogram analysis based on exon nucleotide sequences of CHS-superfamily enzymes. The sequences were
aligned with ClustalW (http://www.ddbj.nig.ac.jp; Thompson et al.
1994) with default settings and the tree was developed with
TREEVIEW (Page 1996) using P. nudum enzymes as an outgroup.
All known plant CHS-like enzymes and representative CHSs from
diverse families were included in the analysis
CoA as substrates under standard conditions. The reaction products were analyzed by radio-thin layer
chromatography (radio-TLC) and identi®ed by either
using internal standards or by their known Rf values
(Yamaguchi et al. 1999). As shown in Fig. 5, PnJ produced naringenin, which was formed by nonenzymatic
isomerization of naringenin chalcone, as a major product. p-Coumaroyltriacetic acid lactone (CTAL, the
derailed lactone after three condensations) and bisnoryangonin (BNY, the derailed lactone after two condensations) were also produced. This product pro®le
was identical to that of EaCHS (data not shown) as well
as other CHSs including Pueraria lobata CHS (Fig. 5)
and Hydrangea macrophylla CHS (Akiyama et al. 1999;
Yamaguchi et al. 1999). Next, the starter-CoA ester
preferences of PnJ and EaCHS were studied using
[2-14C]malonyl-CoA and various CoA esters as co-substrate. Under identical conditions, PnJ and EaCHS
showed comparable preference pro®les towards CoA
esters to that of Pueraria lobata CHS, exhibiting higher
rates of conversion to cyclization products with p-coumaroyl-CoA and dihydro-p-coumaroyl-CoA (Table 3,
Fig. 6a). The in vitro preference of PnJ and EaCHS for
p-coumaroyl-CoA as starter CoA agrees well with the
¯avonoid pro®le found in these plants. Amento¯avone
(by far the major component) and apigenin, both
derived from p-coumaroyl-CoA as the starter unit, have
been found in P. nudum and virtually all the ¯avonoids
known from E. arvense are also derived from p-coumaroyl-CoA (Markham 1988). Taken together, these
results indicate that the cloned PnJ and EaCHS are in
fact CHSs.
The CHS-type cyclization products (pinocembrin
from cinnamoyl-CoA, phlorisovalerophenone from isovaleryl-CoA, etc., Fig. 7) were assigned based on their
independence of the pH of the reaction mixture during
extraction with organic solvent. As shown in Fig. 6b, the
amounts of extracted cyclization product (marked by
asterisk) remained virtually constant when the pH of the
reaction mixture was adjusted to 4, 7, or 9 prior to extraction. In contrast, the amounts of extractable derailment pyrones (such as CTAL and BNY) decreased
substantially at higher pH, as these pyrones are unstable
to alkali and would be hydrolyzed to become
Fig. 5 Radio thin-layer chromatograms of reaction products
produced by Pueraria lobata CHS (C), Arachis hypogaea stilbene
synthase (S), PnJ (J), PnP (P), PnI (I), PnL (L), and Humulus
lupulus PIVPS (HP) using p-coumaroyl-CoA (left) and isovalerylCoA (right) as starter CoA. TLC was performed as described in
Materials and methods and the Rf values of p-coumaroyltriacetic
acid lactone (CT), resveratrol (R), bisnoryangonin (B), naringenin
(N) and phlorisovalerophenone (PIVP) were 0.6, 0.5, 0.4, 0.32 and
0.25, respectively
81
Table 3 Starter CoA preference of P. nudum CHS-superfamily enzymes, Pueraria lobata and Equisetum arvense CHSs and Arachia
hypogaea stilbene synthase
Substrate
p-Coumaroyl-CoA
Propionyl-CoA
Butyryl-CoA
Isobutyryl-CoA
Isovaleryl-CoA
Cinnamoyl-CoA
Dihydro-cinnamoyl-CoA
Dihydro-p-coumaroyl-CoA
Benzoyl-CoA
a
Relative activitya (%)
PnJ
(CHS)
P. lobata
CHS
PnI
(STS)
PnL
(STS)
A. hypogaea
STS
PnP
(PIVPS)
E. arvense
CHS
100
14
31
16
37
65
22
102
0
100
9
42
45
51
82
59
128
0
100
17
9
3
11
156
27
5
0
100
37
27
5
15
244
46
7
0
100
2
4
5
3
98
14
3
0
2
11
43
29
100
4
3
4
0
100
n.d.
43
22
46
81
48
96
n.d.
Based on the production of cyclization product. n.d.: not determined
water-soluble free carboxylic acid derivatives at higher
pH. Zuurbier et al. (1998) also reported this pH-dependence of extraction of pyrone derivatives produced
by the CHS reaction. The results shown in Fig. 6a indicated that with p-coumaroyl-CoA, cinnamoyl-CoA
and dihydro-p-coumaroyl-CoA, the cyclization products
were clearly the major products produced by PnJ. The
chemical identity of the products was unambiguously
con®rmed by multistage LC-APCIMS (Table 4, Fig. 7).
With alkoxyl-CoA esters including isovaleryl-CoA, on
the other hand, derailment pyrones were the major
products (lanes 2, 3, 4 in Fig. 6a). These results indicated
that, although PnJ accepted alkoxyl-CoA as starter
CoA, it catalyzed the CHS-type cyclization reaction at
Fig. 6a, b Radio thin-layer chromatograms of reaction products
produced by PnJ (P. nudum chalcone synthase) and various starter
CoA esters. a The enzyme reaction was carried out with 100 lM
starter CoA and 16.8 lM [2-14C]malonyl-CoA and the products
were analyzed by RP-18 TLC as described in Materials and
methods. Cyclization products assigned on the basis of their
behavior during extraction at di€erent pH values are marked with
an asterisk (*) (see below). Starter CoAs used were p-coumaroylCoA (lane 1), isobutyryl-CoA (lane 2), isovaleryl-CoA (lane 3),
butyryl-CoA (lane 4), cinnamoyl-CoA (lane 5), dihydro-p-coumaroyl-CoA (lane 6), and dihydrocinnamoyl-CoA (lane 7). b
Assignment of cyclization product. Radio thin-layer chromatogram of the reaction products (dihydro-p-coumaroyl-CoA as
starter CoA) obtained after extraction at di€erent pH values
showed that the amounts of two products (presumed to be early
released pyrones) detected on TLC decreased as pH increased
during extraction, while that of the cyclization product (*)
remained constant. o TLC origin, f solvent front
much slower rates and released the growing intermediates as pyrones, similar to the results obtained with
parsley CHS (SchuÈz et al. 1983). PnJ was further characterized for its kinetic properties. The calculated
Km(app) values for p-coumaroyl-CoA and malonyl-CoA
were 56‹14 lM (mean ‹ SD) and 4.3‹1.0 lM, respectively. These kinetic values were comparable to
those of Pueraria lobata CHS (Suh et al. 2000) obtained
under similar conditions.
PnI and PnL are pinosylvin synthases
Using p-coumaroyl-CoA as starter CoA, PnI and PnL
produced resveratrol, as the major product, as well as
CTAL and BNY as derailment byproducts, indicating
PnI and PnL are stilbene synthases (Fig. 5). Resveratrol
production by PnI and PnL were con®rmed by carrier
dilution assay (Yamaguchi et al. 1999). To radioactive
products obtained from enzyme reaction with p-coumaroyl-CoA and [2-14C]malonyl-CoA, non-labeled
Fig. 7 Chemical structures of the representative products (Table 4)
82
Table 4 LC-APCIMS data of P. nudum CHS-superfamily enzyme products
Enzyme
Starter CoA
Product
MS (m/z)
p-Coumaroyl-CoA
Naringenin, C15H12O5
Cinnamoyl-CoA
Pinocembrinb, C15H12O4
Dihydro-p-coumaroyl-CoA
Dihydronaringenin chalconeb, C15H14O5
Dihydrocinnamoyl-CoA
Dihydropinocembrinb, C15H14O4
PnI
p-Coumaroyl-CoA
Cinnamoyl-CoA
Resveratrol, C14H12O3
Pinosylvinb, C14H12O2
PnP
Isobutyryl-CoA
Phlorisobutyrophenone, C10H12O4
Isovaleryl-CoA
Phlorisovalerophenoneb, C11H14O4
PnJ
a
+
[M+H] 273
[M±H]± 271
[M+H]+ 257
[M±H]± 255
[M+H]+ 275
[M±H]± 273
[M+H]+ 259
[M±H]± 257
[M+H]+ 229
[M+H]+ 213
[M±H]± 211
[M+H]+ 197
[M±H]± 195
[M+H]+ 211
[M±H]± 209
MS/MS (m/z)
153, 147
151
153, 131
211, 152
149, 107
167
133, 127, 105
213, 125
211, 135, 119
195, 135
187, 167, 116
179 (151)a
151 (109)a
193 (165)a, 155
165 (123)a
Numbers in parenthesis are m/z values of the major fragments obtained in MS/MS/MS
Chemical structures are shown in Fig. 7
b
resveratrol was added as internal standard. Then, the
mixture was separated on HPLC and the fractions
containing resveratrol were collected. Successive rounds
of recrystallization of radioactive product in the presence of non-labeled compound in two di€erent solvent
systems (methanol and hexane/ethyl acetate) gave crystals of constant speci®c radioactivity (data not shown).
On the other hand, PnI and PnL were distinguishable
from a typical higher-plant STS in in vitro preference
towards starter CoA. PnI and PnL showed 1.6-fold and
2.4-fold higher activity with cinnamoyl-CoA than with
p-coumaroyl-CoA, whereas A. hypogaea STS showed
similar activity with both starter CoA esters (Table 3).
This suggested that PnI and PnL represent pinosylvin
synthases, similar to those cloned from Pinus species
(Schanz et al. 1992; Raiber et al. 1995). Kinetic analysis
indicated that the observed preference towards
cinnamoyl-CoA should be attributed more to increase in
the reaction rate than to increased anity to this starter
CoA. Km(app) values for cinnamoyl-CoA and p-coumaroyl-CoA were 29‹12 lM (mean ‹ SD) and
37‹15 lM for PnI and 27‹2.8 lM and 13‹12 lM for
PnL. Yet, PnI showed 3-fold higher speci®c activity with
cinnamoyl-CoA (14‹4.8 pkat/mg; mean ‹ SD) as
compared to p-coumaroyl-CoA (5.1‹2.2 pkat/mg).
Likewise, the speci®c activity of PnL was determined to
be 3.7‹0.6 pkat/mg with cinnamoyl-CoA and
0.8‹0.4 pkat/mg with p-coumaroyl-CoA.
PnP is a phlorisovalerophenone synthase
PnP showed a high selectivity towards isovaleryl-CoA as
substrate and other alkoxyl-CoA esters, butyryl-CoA
and isobutyryl-CoA, were accepted with 30±40% eciency (Table 3). These properties indicate that PnP acts
as a phlorisovalerophenone synthase (PIVPS) in vitro.
As shown in Fig. 5, PnP could not catalyze the formation of naringenin from p-coumaroyl-CoA and the
product pro®le produced by PnP using isovaleryl-CoA
as starter CoA was virtually identical to that of recombinant hop PIVPS. Earlier, Paniego et al. (1999)
reported that puri®ed hop PIVPS did not accept
p-coumaroyl-CoA as a substrate. However, the recombinant hop PIVPS did produce naringenin as a minor
product from p-coumaroyl-CoA at a reduced rate
(CTAL was the major product). In this regard, PnP is
distinct from hop PIVPS (data not shown).
Again, the observed preference of PnP for isovalerylCoA was a result of increased reaction rate with this
starter CoA. Kinetic anities for the starter CoA esters
were not signi®cantly di€erent; Km(app) values for
isovaleryl-CoA, butyryl-CoA and isobutyryl-CoA were
1.3‹0.2 lM (mean ‹ SD), 1.8‹0.2 lM and 0.9‹
0.1 lM, respectively. The chemical identities of the
reaction products were vigorously con®rmed by multistage LC-APCIMS (Table 4) and the data were in
agreement with the literature (Fung et al. 1994).
PnE is inactive with common starter CoA esters
Not only did PnE, which contains a Gln-303 instead of
an otherwise strictly conserved active site His (Fig. 2),
show no in vitro activity with any of the starter CoA
esters used in this study, but it was also devoid of
malonyl-CoA decarboxylation activity. Assuming that
the inactivity might be due to this His-to-Gln substitution, a Gln303His mutant of PnE was constructed,
overexpressed in E. coli, and its activity was measured.
However, no activity was detected with this mutant,
indicating that the Gln residue is not solely responsible
for its apparent lack of activity. At present, the function
of PnE remains unknown.
Discussion
In this study a total of ®ve CHS-superfamily proteins,
including a CHS (PnJ), two STSs (PnI and PnL), a
83
PIVPS (PnP) and one protein with unknown function
(PnE), were cloned from the most primitive vascular
plant, P. nudum. The in vitro activities of PnJ, PnL, PnI
and PnP were deciphered. However, aside from PnJ,
which likely catalyzes the production of amento¯avones
found in the plant, the physiological functions of the
others remain to be determined. As P. nudum is an endangered species and it is dicult to obtain in large
amounts, phytochemical studies have not been extensively carried out on P. nudum despite its scienti®c signi®cance in plant evolution. Although neither stilbene
nor phloroglucinol has been isolated from P. nudum,
cloning of PnI, PnL and PnP predicts the presence of
related compounds or their derivatives. In fact, structurally related bibenzyls are widely distributed in liverworts (Hepaticae) and acylphloroglucinols of dryopteris
(wood fern) have an ancient history as an antiparasitory
remedy (PenttilaÈ and Sundman 1970).
Even after using an exhaustive array of starter-CoA
esters, we failed to detect any in vitro activity of PnE.
The fact that PnE can not catalyze malonyl-CoA decarboxylation casts a serious doubt about whether PnE
by itself represents a catalytically active enzyme entity.
However, the fact that PnE was cloned from a cDNA
mixture indicates that it is expressed in the plant with
certain in vivo function. Psilotum nudum contains large
amounts of psilotin and its derivatives, which is postulated to arise by the condensation of one acetate unit
from malonyl-CoA with p-coumaroyl-CoA as starter
unit (Leete et al. 1982). A putative condensing enzyme
(psilotin synthase) has not yet been demonstrated. It
remains to be seen if PnE plays a role in psilotin biosynthesis.
As no information on CHS from the bryophytes is
available, PnJ and EaCHS represent CHSs cloned and
characterized from the primitive vascular plants.
Therefore, it is interesting to note that PnJ and EaCHS
share most enzymatic characteristics (byproduct production, starter-CoA preference, and kinetic properties)
with other higher-plant CHSs. This suggests that these
characteristics may be common to most of modern-day
naringenin chalcone synthases and that they have been
conserved during the course of plant evolution. Like
parsley (Petroselinum hortense) CHS (SchuÈz et al. 1983)
and Pueraria lobata CHS, PnJ accepted alkoxyl CoA
esters as starter CoA and produced phloroglucinol derivatives, albeit with less eciency (Table 3). Earlier,
SchuÈz et al. (1983) hypothesized that this ability of CHS
to accept alkoxyl CoA esters might be a relic of its close
evolutionary relationship to b-ketoacyl-(acyl carrier
protein) synthase components of fatty acid synthases.
Further, similar arguments for their close evolutionary
relationship have recently been made based on the
similarity of overall folds (Ferrer et al. 1999) and conservation of key functional amino acids in CHSs and
b-ketoacyl-(acyl carrier protein) synthases (Jez et al.
2000; Suh et al. 2000).
In the phylogenetic tree prepared from exon nucleotide sequences (Fig. 3), most stilbene synthases and
other CHS-superfamily enzymes are found clustered
together with CHSs from the same plant families. This
result is consistent with an earlier proposition that STSs
have evolved from CHSs several times during the course
of evolution (Tropf et al. 1994) and successfully extends
the proposition to other CHS-superfamily enzymes as
well. Then, it is likely that the ancestral CHS might have
been evolved from an ancestral condensing enzyme of
primary metabolism by adopting phenylpropanoid CoA
as the starter unit and acquiring the ability to catalyze
the cyclization reaction. CHS further diverged to other
`specialized' CHS-superfamily enzymes during the
course of evolution to produce diverse secondary metabolites. This divergent evolution of the CHS-superfamily enzymes must have been an ancient event as
evidenced by the existence of multi-CHS-superfamily
enzymes in P. nudum. The result showing that at least
three distinct members of the CHS superfamily were
cloned in the most primitive vascular plant was rather
surprising, since no more than two members of the CHSsuperfamily enzymes have been found from a single
plant. Psilotum nudum is the only living species of a once
populated division. Therefore, it seems not unreasonable
to speculate that the unique ability to evolve such a
variety of CHS-superfamily enzymes has provided a
survival edge to P. nudum during evolution.
Acknowledgements We are grateful to Professor R. Verpoorte
(Lieden University) for standard phlorisovalerophenone and to the
Ministry of Education, Science, Sports and Culture of Japan for
Grants-in Aid for Scienti®c Research (B) (No. 09044212) and (C)
(No. 10680564). D.-Y. Suh thanks the Tokyo Biochemistry
Research Foundation for a fellowship (TBRF-98-10).
References
Akiyama T, Shibuya M, Ebizuka Y (1998) cDNA cloning of
polyketide synthases from Hydrangea macrophylla var. thunbergii. In: Ageta H, Aimi N, Ebizuka Y, Fujita T, Honda G
(eds) Towards natural medicine research in 21st Century.
Elsevier, Amsterdam, pp 411±420
Akiyama T, Shibuya M, Liu H-M, Ebizuka Y (1999) p-Coumaroyltriacetic acid synthase, a new homologue of chalcone synthase, from Hydrangea macrophylla var. thunbergii. Eur J
Biochem 263:834±839
Altschul SF, Madden TL, Scha€er AA, Zhang J, Zhang Z, Miller
W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Res 25:3389±3402
Beerhues L (1996) Benzophenone synthase from cultured cells of
Centaurium erythraea. FEBS Lett 383:264±266
Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 72:248±256
Eckermann S, SchroÈder G, Schmidt J, Strack D, Edrada RA,
Helariutta Y, Elomaa P, Kotilainen M, KilpelaÈinen I, Proksch
P, Teeri TH, SchroÈder J (1998) New pathway to polyketides in
plants. Nature 396:387±390
Ferrer J-L, Jez JM, Bowman ME, Dixon RA, Noel JP (1999)
Structure of chalcone synthase and the molecular basis of plant
polyketide biosynthesis. Nat Struct Biol 6:775±784
Fliegmann J, SchroÈder G, Schanz L, Britsch L, SchroÈder J (1992)
Molecular analysis of chalcone and dihydropinosylvin synthase
from Scots pine (Pinus sylvestris), and di€erential regulation of
84
these and related enzyme activities in stressed plants. Plant Mol
Biol 18:489±503
Frohman MA, Dush MK, Martin GR (1988) Rapid production of
full-length cDNAs from rare transcripts: ampli®cation using a
single gene-speci®c oligonucleotide primer. Proc Natl Acad Sci
USA 85:8998±9002
Fung S-Y, Brussee J, van der Hoeven RAM, Niessen WMA,
Sche€er JJC, Verpoorte R (1994) Analysis of proposed aromatic precursors of hop bitter acids. J Nat Prod 57:452±459
Jez JM, Ferrer J-L, Bowman ME, Dixon RA, Noel JP (2000)
Dissection of malonyl-coenzyme A decarboxylation from
polyketide formation in the reaction mechanism of a plant
polyketide synthase. Biochemistry 39:890±902
Ke S-H, Madison EL (1997) Rapid and ecient site-directed mutagenesis by single-tube megaprimer PCR method. Nucleic
Acid Res 25:3371±3372
Kreuzaler F, Hahlbrock K (1975) Enzymic synthesis of an aromatic ring from acetate units. Partial puri®cation and some
properties of ¯avanone synthase from cell-suspension cultures
of Petroselinum hortense. Eur J Biochem 56:205±213
Leete E, Muir A, Towers GHN (1982) Biosynthesis of psilotin from
[2¢,3¢-13C2,1¢-14C,4-3H]phenylalanine studied with 13C-NMR.
Tetrahedron 23:2635±2638
Lukacin R, Springob K, Urbanke C, Ernwein C, SchroÈder G,
SchroÈder J, Matern U (1999). Native acridone synthases I and
II from Ruta graveolens L. form homodimers. FEBS Lett
448:135±140
Markham KR (1988) Flavonoid distribution in lower plants. In:
Harborne JB (ed) The ¯avonoids. Chapman and Hall, London,
pp 428±468
Page RDM (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comp Appl Biosci 12:357±358
Paniego NB, Zuurbier KWM, Fung S-Y, Van der Heijden R,
Sche€er JJC, Verpoorte R (1999) Phlorisovalerophenone synthase, a novel polyketide synthase from hop (Humulus lupulus
L.) cones. Eur J Biochem 262:612±616
PenttilaÈ A, Sundman J (1970) The chemistry of dryopteris acylphloroglucinols. J Pharm Pharmcol 22:393±404
Preisig-MuÈller R, Gnau P, Kindl H (1995) The inducible 9,10-dihydrophenanthrene pathway: characterization and expression
of bibenzyl synthase and S-adenosylhomocysteine hydrolase.
Arch Biochem Biophys 317:201±207
Raiber S, SchroÈder G, SchroÈder J (1995) Molecular and enzymatic
characterization of two stilbene synthases from eastern white
pine (Pinus strobus). FEBS Lett 361:299±302
Schanz S, SchroÈder G, SchroÈder J (1992) Stilbene synthase from
Scots pine (Pinus sylvestris). FEBS Lett 313:71±74
SchoÈppner A, Kindl H (1984) Puri®cation and properties of a
stilbene synthase from induced cell suspension cultures of
peanut. J Biol Chem 259:6806±6811
SchroÈder J (1999) The chalcone/stilbene synthase-type family of
condensing enzymes. In: Sankawa U (ed) Comprehensive natural products chemistry vol. 1. Elsevier, Amsterdam, pp 749±
771
SchuÈz R, Heller W, Hahlbrock K (1983) Substrate speci®city of
chalcone synthase from Petroselinum hortense. J Biol Chem
258:6730±6734
StoÈckigt J, Zenk MH (1975) Chemical syntheses and properties of
hydroxycinnamoyl-Coenzyme A derivatives. Z Naturforsch
Teil C 30:352±358
Suh D-Y, Fukuma K, Kagami J, Yamazaki Y, Shibuya M, Ebizuka Y, Sankawa U (2000) Identi®cation of amino acid residues important in the cyclization reactions of chalcone and
stilbene synthases. Biochem J 350:229±235
Thompson JD, Higgins DG, Gibson TJ (1994) Improving the
sensitivity of progressive multiple sequence alignment through
sequence weighting, position-speci®c gap penalties and weight
matrix choice. Nucleic Acids Res 22:4673±4680
Tropf S, Lanz T, Rensing SA, SchroÈder J, SchroÈder G (1994) Evidence that stilbene synthases have developed from chalcone
synthases several times in the course of evolution. J Mol Evol
38:610±618
Wallage JW, Markham KH (1978) Apigenin and amento¯avone
glycosides in the Psilotaceae and their phylogenetic signi®cance.
Phytochemistry 17:1313±1317
Yamaguchi T, Kurosaki F, Suh D-Y, Sankawa U, Nishioka M,
Akiyama T, Shibuya M, Ebizuka Y (1999) Cross-reaction of
chalcone synthase and stilbene synthase overexpressed in
Escherichia coli. FEBS Lett 460:457±461
Zuurbier KWM, Leser J, Berger T, Hofte AJP, SchroÈder G,
Verpoorte R, SchroÈder J (1998) 4-Hydroxy-2-pyrone formation
by chalcone and stilbene synthase with nonphysiological substrates. Phytochemistry 49:1945±1951