Download Full Text - Molecular Cancer Research

Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Molecular
Cancer
Research
Cell Cycle, Cell Death, and Senescence
Multiple Isoforms of CDC25 Oppose ATM Activity to Maintain
Cell Proliferation during Vertebrate Development
Daniel Verduzco1,2, Jennifer Shepard Dovey4, Abhay A. Shukla1,2, Elisabeth Kodym1,2, Brian A. Skaug1,2, and
James F. Amatruda1,2,3
Abstract
The early development of vertebrate embryos is characterized by rapid cell proliferation necessary to support the
embryo's growth. During this period, the embryo must maintain a balance between ongoing cell proliferation and
mechanisms that arrest or delay the cell cycle to repair oxidative damage and other genotoxic stresses. The ataxiatelangiectasia mutated (ATM) kinase is a critical regulator of the response to DNA damage, acting through
downstream effectors, such as p53 and checkpoint kinases (CHK) to mediate cell-cycle checkpoints in the presence
of DNA damage. Mice and humans with inactivating mutations in ATM are viable but have increased susceptibility
to cancers. The possible role of ATM in limiting cell proliferation in early embryos has not been fully defined. One
target of ATM and CHKs is the Cdc25 phosphatase, which facilitates cell-cycle progression by removing inhibitory
phosphates from cyclin-dependent kinases (CDK). We have identified a zebrafish mutant, standstill, with an
inactivating mutation in cdc25a. Loss of cdc25a in the zebrafish leads to accumulation of cells in late G2 phase. We
find that the novel family member cdc25d is essential for early development in the absence of cdc25a, establishing
for the first time that cdc25d is active in vivo in zebrafish. Surprisingly, we find that cell-cycle progression in cdc25a
mutants can be rescued by chemical or genetic inhibition of ATM. Checkpoint activation in cdc25a mutants occurs
despite the absence of increased DNA damage, highlighting the role of Cdc25 proteins to balance constitutive ATM
activity during early embryonic development. Mol Cancer Res; 10(11); 1451–61. 2012 AACR.
Introduction
During the early phases of vertebrate embryo development, rapid cell proliferation is required to support the
growth of the embryo and organogenesis. Throughout this
time, the developing embryo is exposed to a variety of
genotoxic stressors. External stressors include environmental
toxins and chemicals as well as radiation, both ionizing and
ultraviolet (1). Several endogenous sources of DNA damage
have also been recognized, including oxidants, estrogens,
alkylators, and the products of lipid peroxidation and metabolic pathways (2, 3). Failure to repair the damage due to
these extrinsic and intrinsic agents can lead to mutations that
contribute to cancer, aging, and degenerative diseases (1, 4).
Authors' Affiliations: Departments of 1Pediatrics, 2Molecular Biology, and
3
Internal Medicine, University of Texas Southwestern Medical Center,
Dallas, Texas; and 4Division of Hematology-Oncology, Children's Hospital,
Boston, Massachusetts
Note: Supplementary data for this article are available at Molecular Cancer
Research Online (http://mcr.aacrjournals.org/).
Current address for J.S. Dovey: Amgen, Inc., 360 Binney St, Cambridge,
MA 02142.
Corresponding Author: James F. Amatruda, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, MC 8534, Dallas, TX
75390. E-mail: [email protected].
doi: 10.1158/1541-7786.MCR-12-0072
2012 American Association for Cancer Research.
In response to genotoxic stress, cells have evolved robust
networks to detect DNA damage and to arrest or delay cellcycle progression, allowing time for repair of the damage (5,
6). Testifying to the importance of these mechanisms,
humans or mice with germline mutations in DNA damage
response genes display a range of developmental defects,
including growth retardation, microcephaly, cerebellar ataxia, sterility, bone marrow failure, and immunodeficiency as
well as predisposition to cancer (1, 4). Among the best
characterized of these networks is the response to doublestrand DNA (dsDNA) breaks, which is coordinated by the
phosphoinositide-3-kinase–related protein kinase (PIKK)
family member, ataxia-telangiectasia mutated (ATM; ref. 7).
Upon sensing a dsDNA break or other change in chromatin
structure, ATM phosphorylates key downstream targets
including p53 and the checkpoint kinase 1 (CHK1) and
checkpoint kinase 1 (CHK2), which in turn bring about cellcycle arrest or delay to allow for repair through the homologous recombination or nonhomologous end joining pathways, or alternatively apoptosis and cell death (7–9). While
ATM has clearly been shown to be important for the response
to exogenous DNA damage, its possible roles in normal
development are less clear. Similar to humans, mice deficient
in ATM are viable but display growth retardation, neurologic
dysfunction, infertility, defective T-lymphocyte maturation,
radiation sensitivity, and increased cancer incidence (10, 11).
Exposure to teratogens, such as phenytoin or genotoxic
insults, such as gamma radiation, impairs the development
www.aacrjournals.org
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1451
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Verduzco et al.
of ATM-null embryos, and simultaneous deletion of ATM
and other DNA damage repair factors including histone
H2AX and DNA-dependent protein kinase is embryonic
lethal in mice (12, 13). However, owing to the relative
inaccessibility of mammalian embryonic development, it is
unclear what roles ATM may play during the course of
normal embryogenesis. In particular, it is not known to
what degree ATM-dependent checkpoint mechanisms may
oppose cell proliferation during early embryogenesis.
One of the key targets of the ATM-CHK1/2 network is
the CDC25 family of phosphatases, key regulators of the
cell cycle. Under conditions that favor cell-cycle progression,
CDC25 removes inhibitory phosphates from cyclin-dependent kinases (CDK), allowing cyclin/CDK complexes to
drive cell-cycle transitions (14). In response to dsDNA breaks,
CHK1 and CHK2 phosphorylate CDC25, targeting it for
destruction and impeding CDK activation (15). Mammalian
cells express 3 different CDC25 genes: CDC25A, CDC25B,
and CDC25C. CDC25A seems to act alone in controlling
entry from G1 to S and intra-S progression, whereas all 3
CDC25 genes function in G2–M progression (16).
The developmental roles of Cdc25 have been partially
defined. In mice, Cdc25A is essential for embryonic development. Cdc25A/ embryos are resorbed at around E6.5
due to widespread apoptosis (17). Although Cdc25A/
mice die early in development, mice lacking Cdc25B and
Cdc25C survive with normal cell-cycle progression and
checkpoint function (18). Therefore, Cdc25A likely compensates for the other Cdc25 genes and may be the most
functionally important mammalian Cdc25. Unlike mammals, zebrafish express a single canonical CDC25, designated cdc25a, during embryogenesis (19). In zebrafish embryos,
overexpression of cdc25a drives cells into mitosis (19) and
blocks cell-cycle lengthening and acquisition of G2 phase as
early embryonic cell cycles give rise to postmidblastula
transition, asynchronous cell cycles (20). Zebrafish also
express a divergent family member, designated cdc25d,
which is homologous to cdc25a but is not present in
mammals (19). cdc25d can rescue a fission yeast cdc25ts
mutant, but has not been shown to have detectable activity in
zebrafish (19, 20). It is not known whether the single
canonical zebrafish cdc25a is essential for development, or
whether cdc25a and cdc25d have any redundant roles in cellcycle regulation, nor is it known if zebrafish cdc25 family
members participate in DNA damage checkpoints.
Previously, we conducted a screen for mutations that
affect embryonic cell proliferation in zebrafish (21). Here,
we report the identification of an inactivating mutation in
zebrafish cdc25a. cdc25a is essential for zebrafish embryonic
development, and cdc25a-deficient mutants accumulate cells
in G2–M phase. The cell-cycle defects of cdc25a-deficient
mutants can be partially rescued by cdc25d, showing in vivo
activity of this divergent family member. We reasoned that
this model could help us to understand epistatic relationships of CDC25 to other checkpoint genes in a whole
organism that is not subject to extrinsic genotoxic stress.
We find that chemical or genetic inhibition of ATM rescues
the accumulation of cells in G2–M phase in cdc25a-deficient
1452
Mol Cancer Res; 10(11) November 2012
embryos. ATM is activated in the cdc25a mutants despite the
absence of widespread DNA double-strand breaks (DSB),
and we present evidence that ATM also impedes cell-cycle
progression in embryos with wild-type levels of CDC25
activity. These results emphasize the important balance
between mechanisms that favor cell proliferation and the
ATM-mediated checkpoint response during early embryonic development in vertebrates.
Materials and Methods
Fish maintenance
Zebrafish were maintained according to standard procedures (22). All work with zebrafish was carried out under
protocols approved by the Institutional Animal Care and Use
Committees at University of Texas Southwestern Medical
Center (Dallas, TX), an Association for Assessment and
Accreditation of Laboratory Animal Care (AAALAC)-accredited institution.
Zebrafish immunohistochemistry and
immunofluorescence
Twenty-four-hour–old embryos were dechorionated,
euthanized with tricaine, and fixed in 4% paraformaldehyde
(PFA) in 1 PBS overnight at 4 C. Immunohistochemistry
(IHC) was conducted using 1:1,000 anti–phosphohistone
H3 Serine 10 (pH3; Santa Cruz Biotechnology, catalog no.
sc-8656-R); 1:200 anti-mouse Cdc25A (Santa Cruz Biotechnology, catalog no. sc-97) or 1:1,000 zebrafish-specific
anti–phosphohistone H2AX (23) followed by incubation
with 1:350 horseradish peroxidase–conjugated goat antirabbit immunoglobulin G (IgG; Jackson Immunochemicals) and staining with diaminobenzidine (DAKO) for
10 minutes according to the manufacturer's protocol. For
fluorescent imaging, secondary antibody was a 1:15,000
dilution of Alexafluor-488–conjugated goat anti-rabbit IgG
(Invitrogen). Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) assay was conducted
using the Apoptag Red In Situ Apoptosis Detection Kit
(Millipore) as described in ref. (24). Acridine orange staining
was conducted as described in ref. (24). Immunoblots were
conducted with rabbit anti–phospho-CHK1 (Ser435) from
Cell Signaling Technology. The antibody recognizes a
protein of 50 kD in lysates of zebrafish embryos, in good
agreement with the predicted size of zebrafish chk1 (410
amino acids; Accession: NP_956487.1) and was previously
used to detect activated chk1 protein in lysates of zebrafish
tissue (25). Anti–phospho-Rb (Ser 795) is validated for
recognition of phosphorylated zebrafish retinoblastoma (Rb)
protein (www.cellsignal.com/products/9301.html) and was
previously shown to recognize phospho-Rb in zebrafish (26).
Comet assay
Twenty-four or 48-hour zebrafish embryos were disaggregated to a single-cell suspension as described in ref. (27).
Zebrafish cells were embedded in low-melt agarose gels,
lysed, and then electrophoresed using the Trevigen CometAssay Kit according to the manufacturer's protocol
(Trevigen).
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
CDC25 Opposes ATM Activity during Development
Drug treatment
Twelve-hour–old embryos were treated with 10 mmol/L
ATM kinase inhibitor KU55933 (Calbiochem) in E3 zebrafish embryo medium (22) and 1% dimethyl sulfoxide
(DMSO) for 12 hours at 28 C, then euthanized with
tricaine, fixed in 4% PFA/1 PBS overnight at 4 C, and
processed for IHC. To quantify anti-pH3 staining, 12
images were taken for each treatment and genotype. The
pH3-positive cells in an area extending from the end of the
yolk tube extension to the tip of the tail were independently
counted for each embryo by 2 observers who were blinded to
the identity of the samples. All counts were normalized by
the total area (measured using ImageJ software) to account
for differing size of the tail regions.
Cell culture and transfection
The human non–small-cell lung cancer cell line A549
(kindly provided by Dr. J. Minna, UT Southwestern Medical Center, Dallas, Texas) was maintained in RPMI media
supplemented with 10% FBS. For overexpression of Cdc25,
cells were transfected with pCMV-SPORT6 containing a
full-length Mus musculus Cdc25A cDNA (Accession number BC046296, Open Biosystems). Immunoblotting was
conducted using 1:1,000 pS1981-ATM (Rockland) or
1:500 anti-g-H2AX (Millipore) as described in ref. (28).
Morpholino injections
A total of 0.5 mmol/L Cdc25a 50 UTR (TAATCAGCCAGGCGCGATTAAGAAC), cdc25a splice site (ATGACAACCTCACCTCAGCCATGTT), control (CCTCTTACCTCAGTTACAATTTATA), or cdc25d 50 UTR (AATCTCCAGCGCATCACCGGCCATT) morpholinos were
injected into 1 to 2 cell zebrafish embryos from the AB strain
or from offspring of cdc25aþ/ adults. Morpholinos were
purchased from Gene-Tools. ATM, CDKN1A, and ATR
morpholinos were as described in ref. (23, 29). The genotypes of injected embryos were confirmed by PCR using
A
B
C
D
primers flanking the cdc25a mutation site (GGTGTTTGACTCCAATCTGCT and CAACAAGCACAGGCTAATGG) followed by digestion of the PCR product with
BsiEI (New England Biolabs) and gel electrophoresis.
Results
The standstill mutation causes embryonic cell-cycle
accumulation in the G2 phase of the cell cycle
Previously, we described a forward-genetic screen to
identify mutations that altered embryonic cell proliferation
in the haploid F2 progeny of ENU-mutagenized zebrafish
(21, 30). Using whole-mount IHC with an antibody specific
for the phosphorylated form of histone H3 (to evaluate cell
proliferation), 7 mutant lines were identified including
slycz61, sfdcz213, mybl2cz226, espl1cz280, llgcz3322, sdscz319, and
slhcz333 (21). The standstill mutant (sdscz319) was identified
on the basis of a markedly decreased fraction of pH3-positive
cells in the mutant embryos (Fig. 1). The standstill mutant
morphologic phenotype becomes evident at approximately
24 hours postfertilization (hpf) and includes microcephaly,
microphthalmia, abnormal body shape, and reduced pigmentation (Supplementary Fig. S1). To further understand
the cell proliferation defect, we conducted flow cytometric
DNA content analysis, which showed an accumulation of
cells in the G2–M phase of the cell cycle (Fig. 1E). Histone
H3 is phosphorylated in late G2 phase, coincident with the
onset of chromatin condensation, and remains phosphorylated until the chromosomes begin to decondense in anaphase (31, 32). Thus, the standstill mutation seems to result
in accumulation of cells in the G2 phase of the cell cycle,
before the onset of chromatin condensation (33).
Positional cloning of the standstill gene
To understand the molecular nature of the defect in
standstill embryos, we used meiotic recombinational mapping to identify the mutant locus. We conducted bulk
segregant analysis (34) followed by intermediate-resolution
E
Figure 1. The standstill mutation causes a G2–M cell-cycle accumulation. Phenotypic comparison of wild-type (wt; A and C) and standstill homozygous mutant
(B and D) embryos. A and B, Brightfield images of 28 hpf embryos. standstill mutants exhibit pericardial edema, microcephaly, loss of posterior segmentation,
and a curved body shape. C and D, anti-pH3 staining of wt (C) and standstill mutants (D) at 28 hpf. Compared with wt embryos (C), standstill embryos (D) exhibit
a reduced number of cells in mitosis. E, FACS analysis for DNA content shows accumulation of cells in G2–M in standstill mutants.
www.aacrjournals.org
Mol Cancer Res; 10(11) November 2012
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1453
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Verduzco et al.
mapping with a panel of 88 mutant embryos to assign
standstill to zebrafish chromosome 13. For high-resolution
mapping, we assembled a panel of 1,758 phenotypically
mutant embryos and localized the mutation to an approximately 5 cM interval between microsatellite markers
Z6259 and ZJA5 (Fig. 2). The map position was further
refined with a combination of known markers and novel
microsatellites derived from genomic sequence. The critical interval contains a single gene, the zebrafish ortholog
of Cdc25A (19). We sequenced the cdc25a gene from
wild-type and standstill mutant embryos and found that
the mutants contain a C to T mutation at codon 206 of
the coding sequence, which is predicted to result in a
premature stop codon and a truncated protein lacking
the catalytic domain (Fig. 2B and C). standstill mutant
embryos did not stain with an anti-mouse Cdc25A antibody (Fig. 2E), and whole-mount in situ hybridization
revealed reduced cdc25a mRNA in standstill mutants,
consistent with nonsense-mediated decay (Supplementary
Fig. S2).
To confirm that cdc25a deficiency was responsible for the
standstill phenotype, we designed a morpholino oligonucleotide (MO) targeting the splice junction between exon 1 and
intron 1 of the cdc25a pre-mRNA. cdc25a MO-injected
embryos displayed a phenotype identical to the standstill
mutant, including microcephaly, microphthalmia, and bent
tail. Immunohistochemical staining for pH3 showed that
the MO-injected embryos had reduced cell proliferation,
phenocopying the standstill mutation (Fig. 2G). We
obtained identical results with a translation-blocking MO
directed against the cdc25a initiating ATG (Supplementary
Fig. S3). Thus, standstill is encoded by zebrafish cdc25a.
cdc25d cooperates with cdc25a during embryonic
development
During the cell cycle, Cdc25 removes inhibitory phosphates from CDKs to allow cell-cycle progression. Despite
lacking a key cell-cycle regulator, cdc25a/ embryos undergo gastrulation and relatively normal organogenesis. The
ability of embryos to complete early stages of development
Figure 2. standstill encodes a
zebrafish Cdc25 ortholog.
Positional cloning of standstill (A).
Bulk segregant analysis assigned
standstill to zebrafish chromosome
13. Further analysis of 3,456
meioses using microsatellite
markers narrowed the critical
interval to a 0.1 cM region
containing cdc25a. Microsatellite
markers are prefixed with the letter
"z." CT573293 and BX571943 are 2
adjoining genomic contigs in
zebrafish genome assembly Zv9.
Arrows indicate the orientation of
predicted genes. B and C,
electropherograms of fragment of
cdc25a exon 7 from wild-type (wt;
B) and standstill mutant (C)
embryos, showing the codon 206
C-T mutation generating a
nonsense allele in the mutant. D
and E, whole-mount IHC of wt (D)
/
(E)
and standstill/cdc25a
embryos stained with anti–mouse
Cdc25a antibody. The mutant
embryos have diminished antiCdc25a reactivity. F and G,
knockdown of cdc25a
phenocopies the standstill
phenotype. F, injection of wt
embryos with a control MO did not
affect cell proliferation. G, injection
of a splice site MO targeting the
cdc25a pre-mRNA exon 1/intron 1
boundary caused a marked
reduction in the number of pH3positive cells.
1454
Mol Cancer Res; 10(11) November 2012
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
CDC25 Opposes ATM Activity during Development
could be due in part to residual maternally supplied wildtype cdc25a. However, early development also occurs in
embryos injected with translation-blocking MO (Supplementary Fig. S3), which is predicted to inhibit translation of
both maternal and zygotic mRNAs. We investigated whether cdc25a deficiency is partially compensated by activity of
cdc25d, the only other identified zebrafish cdc25. cdc25d has
been characterized as a highly divergent isoform of cdc25.
Zebrafish cdc25d functionally complements Schizosaccharomyces pombe cdc25 activity (19); however, its function in
zebrafish has not been established. MO knockdown of
cdc25d alone led to a mild growth defect (Fig. 3C) but
knockdown of cdc25d in cdc25a/ embryos led to a much
more significant growth defect (Fig. 3D), as did double
knockdown of cdc25a and cdc25d in wild-type embryos (Fig.
3E). These results indicated that cdc25d activity contributes
to the early development of cdc25a/ embryos. On the
basis of these results, we asked whether overexpression of
cdc25d might at least partially rescue the cell proliferation
defect of cdc25a/ embryos. To test this possibility, we
injected cdc25a/ embryos with cdc25d mRNA and stained
for pH3 (Fig. 3F and G). Embryos injected with cdc25d
mRNA had a slightly increased number of pH3 foci as
compared with control cdc25a/ embryos (the number of
pH3-positive cells in a defined area of the tail was 19.3 11.3 for cdc25a/ embryos and 35.1 13.1 for cdc25a/
embryos injected with cdc25d mRNA; P ¼ 0.059 by 2-tailed
Student t test). cdc25d mRNA did not increase the number
of pH3-positive cells in wild-type embryos (118.5 22.3
pH3-positive cells in control vs. 131 19.6 in cdc25d
mRNA injected; P ¼ 0.39). cdc25d mRNA injection did not
rescue morphology or survival in cdc25a/ embryos. Some
caution is warranted in interpreting the cdc25d gain of
function experiments, because they relied on overexpression
and because the rescue was incomplete. However, taken
together with the loss of function data, these results strongly
suggest that cdc25 activity is necessary for early embryonic
development in zebrafish, and that cdc25a and cdc25d are at
least partially redundant.
Inhibition of ATM allows G2–M transition in cdc25a
mutants
While overexpression of cdc25d increased the number of
mitotic cells in cdc25a/ mutants, endogenous levels of
cdc25d activity were unable to rescue cdc25a deficiency,
despite the fact that cdc25d is expressed during early development (19). It is possible that cdc25d activity is simply too
weak to complement cdc25a deficiency. However, we also
Figure 3. Knockdown of cdc25d
leads to synergistic growth defects in
the absence of cdc25a. A, control
MO-injected wild-type (wt) embryo
showing normal morphology. B,
/
control MO-injected cdc25a
embryo. Knockdown of cdc25d in wt
embryos (C) causes mild
morphologic defects, whereas
knockdown of cdc25d severely
impairs the growth of cdc25a/
mutants (D). Similar severe growth
defects result from simultaneous
cdc25a and cdc25d knockdown in wt
embryos (E). F, anti-pH3 staining of
cdc25a/ mutant. G, anti-pH3
staining of cdc25a/ mutant
injected with 25 ng/mL cdc25d
mRNA.
www.aacrjournals.org
Mol Cancer Res; 10(11) November 2012
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1455
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Verduzco et al.
considered the possibility that another factor inhibits cell
proliferation in cdc25a mutants. We noted that the phenotype of cdc25a/ mutant embryos (accumulation in G2
phase before the onset of chromatin condensation as signaled
by pH3 positivity) is also compatible with cell-cycle arrest due
to activation of the G2–M checkpoint. The G2–M checkpoint is dependent on the action of the PIKK family member
ATM; it is present in zebrafish embryos and is robustly
activated by DNA-damaging agents, such as gamma radiation (Supplementary Fig. S4).
To test whether the G2–M checkpoint is activated in
cdc25a/ embryos, we treated the embryos with the ATM
inhibitor KU55933. To show that KU55933 inhibits zebrafish ATM, we pretreated wild-type embryos with 10 mmol/L
KU55933 for 4 hours, then exposed pretreated embryos to
12 Gy ionizing radiation. At 48 hpf, irradiated KU55933treated embryos displayed severe morphologic defects, similar to those present in irradiated embryos after MO knockdown of ATM (29; Supplementary Fig. S5).
Having established that KU55933 is active in fish, we
next tested whether the G2–M accumulation in cdc25a/
mutants was the result of activation of the G2–M checkpoint. We crossed heterozygous cdc25aþ/ fish and treated
the resulting embryos with KU55933 from 12 to 24 hpf,
then fixed the embryos and stained for pH3 (Fig. 4). pH3
levels were quantified by counting the number of pH3 foci in
a defined area of the embryo (Fig. 4G). Control DMSOtreated clutches displayed the expected 25% of embryos
with a very low number of pH3-positive cells as compared
with wild-type embryos (Fig. 4A, C, and G). In contrast,
cdc25a/ embryos treated with KU55933 exhibited a
marked increase in the number of pH3-positive cells (Fig.
4D and G; P < 0.0001). We obtained identical results by
inhibiting ATM with caffeine (Supplementary Fig. S6). We
confirmed that the embryos with increased cell proliferation
after KU5593 treatment were genotypically cdc25a/ using
a restriction fragment length polymorphism specific for the
standstill cdc25a mutant allele (not shown).
To rule out an off-target effect of KU55933 and provide
an independent means of inhibiting ATM, we injected 0.2
mmol/L control or ATM-specific MOs (29) into offspring of
heterozygous cdc25aþ/ fish, and again assessed cell proliferation using pH3. Compared with control MO-injected
embryos, ATM MO-injected embryos had increased cell
proliferation (Fig. 4E and F). Further confirming these
results, we found that cdc25a/ embryos contain elevated
levels of phospho-Y15-Cdc2, and that inhibition of ATM
results in reduction of this inhibitory phosphorylation (Fig.
4H). We also considered the possibility that the phenotype
of cdc25a/ mutants is due at least in part to activation of a
replication checkpoint due to replication stress. To test this
possibility, we knocked down expression of ataxia-telangiectasia and rad9-related (atr), another PI3K family member
that delays or arrests the cell cycle in response to stalled
replication forks or other forms of replication stress (25).
Knockdown of atr did not rescue the proliferation defect of
cdc25a morphants (Fig. 4G). Furthermore, cdc25a morphants did not exhibit elevated levels of the phosphorylated
1456
Mol Cancer Res; 10(11) November 2012
form of CHK1 protein, as would be expected if the replication checkpoint were activated (Supplementary Fig. S7E).
To test whether the increased proliferation in KU55933treated cdc25a/ embryos was due to a true increase in cellcycle progression or merely indicative of a release of the
G2–M checkpoint into mitosis, we conducted fluorescenceactivated cell sorting (FACS) analysis on cdc25a/ embryos
and phenotypically wild-type clutchmates treated either
with the KU55933 or 1% DMSO (samples 1 and 2, Fig.
4J). While cdc25a/ embryos treated with DMSO accumulated in G2 (sample 3), cdc25a/ embryos treated with
the ATM inhibitor (sample 4) exhibited a large G1 peak,
indicating they had resumed the cell cycle. Quantification of
the FACS plots revealed the following distributions:
cdc25a/ in DMSO: 30.6% G1, 17.8% S, 64.6% G2;
cdc25a/ in KU55933: 61.5% G1, 31.2% S, and 12.8%
G2. For comparison, the values for wild-type in DMSO are:
49.7% G1, 32.2% S, and 17.6% G2; and wild-type in
KU55933: 49.7% G1, 36.1% S, and 15.8% G2. The large
fraction of cells in G1 in KU55933-treated cdc25a/
embryos likely reflects the release of a large number of G2
cells into mitosis and a subsequent G1.
These results indicated that G2–M accumulation in
cdc25a/ embryos was largely due to activation of the
ATM-dependent G2–M checkpoint, and that cell proliferation in the mutant embryos could resume once ATM
activity was inhibited. Having shown that cdc25a and
cdc25d activities are at least partially redundant (Fig. 3),
we hypothesized that in KU55933-treated, cdc25a-deficient
embryos, cdc25d activity drives the G2–M transition. To test
this model, we knocked down cdc25d in cdc25a/ embryos
and tested whether the cell cycle resumed after ATM
inhibition. We found that, in the absence of expression of
either cdc25a or cdc25d, KU55933 treatment failed to rescue
the cell proliferation defect (Fig. 4G, J, and K). Thus, in the
absence of cdc25a activity, ATM seems to exert its regulatory
effect on cdc25d.
cdc25 activity is also regulated at the G1–S checkpoint,
principally by p53 and its downstream target p21 (8). To
determine whether activation of the G1–S checkpoint contributed to the cell-cycle phenotype of cdc25a-deficient
embryos, we knocked down cdc25a in p53M214K mutants,
which are deficient in p53-mediated responses (35). We also
simultaneously knocked down cdc25a and cdkn1a, which
encodes p21. Neither p53 deficiency nor p21 deficiency
increases the number of proliferating cells in cdc25a-deficient embryos (Supplementary Fig. S7A and S7B). Finally,
we stained wild-type and cdc25a/ embryos for the phosphorylated form of Rb protein, an indicator of G1–S cyclinCdk activity. Rb protein was phosphorylated in both wildtype cdc25a-deficient embryos, indicating that the G1–S
transition was occurring in the mutants (Supplementary Fig.
S7C and S7D).
ATM is activated during normal embryonic
developmental cell cycles
Having established that an ATM-dependent G2–M
checkpoint is present in cdc25a/ embryos, we investigated
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
CDC25 Opposes ATM Activity during Development
/
embryos. Twenty-four hour wild-type (wt; A and B) and cdc25a/ (C and D)
Figure 4. Inhibition of ATM attenuates the cell proliferation defect in cdc25a
embryos treated from 12 to 24 hpf with 1% DMSO (A and C) or 10 mmol/L KU55933 ATM kinase inhibitor (B and D) and stained for pH3. E and F, genetic
knockdown of ATM in cdc25a/ embryos. Injection of cdc25a/ embryos with control MO (E) has little effect, whereas injection of an ATM MO (F) leads to
increased cell proliferation. G, quantification of the number of pH3 foci present in the tails of embryos under different conditions. ( , P < 0.01; , P < 0.001; ns:
not significant). Inhibition of ATM significantly increases the number of proliferating cells in wt and cdc25a-deficient embryos. Knockdown of atr slightly
increases pH3 number in wt but not cdc25a-deficient embryos. H, immunoblot analysis of total Cdc2 and phospho-tyrosine 15 Cdc2 in wt and cdc25a/
embryos treated with DMSO and KU55933. Inhibition of ATM increases cdc25 phosphatase activity and reduces pCdc2 in cdc25a/ embryos. I, DNA content
FACS profiles of wt embryos treated with DMSO (sample 1) or KU55933 (sample 2) and cdc25a/ embryos treated with DMSO (sample 3) or the ATM inhibitor
(sample 4). Inhibition of ATM in cdc25a/ embryos rescues progression of the cell cycle, indicated by a larger G1 peak, as compared with cdc25a/ treated
with DMSO. J and K, inhibition of ATM activity in zebrafish does not restore cell proliferation in embryos lacking both cdc25a and cdc25d. Embryos injected
with MOs targeting both cdc25a and cdc25d transcripts treated with DMSO (J) or 10 mmol/L KU55933 (K) exhibit no change in mitotic cells (quantified in G).
the mechanism of checkpoint activation. We first considered
the possibility that Cdc25a deficiency results in increased
DNA DSBs in developing embryos. We used the comet
assay to measure the amount of DNA damage on a single-cell
basis (36). We have recently adapted this method to measure
DNA damage in zebrafish cells (24). Conducting the comet
assay on 24 hpf cdc25a/ embryos, wild-type embryos, or
wild-type embryos treated with 12 Gy of ionizing radiation
www.aacrjournals.org
as a positive control, we observed a slight decrease in
spontaneous DNA damage in the cdc25a/ mutants (Fig.
5A–D). While it is possible that the comet assay fails to detect
minor amounts of DNA damage, these data indicate that loss
of cdc25a itself does not induce severe DNA damage. The
observed decrease in comet tail size in cdc25a/ mutants
may be due to decreased spontaneous replication-related
DNA damage due to G2–M cell-cycle arrest.
Mol Cancer Res; 10(11) November 2012
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1457
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Verduzco et al.
Figure 5. cdc25a deficiency does not increase the level of DNA damage in
embryos. A to D, comet assays reveal no detectable DNA damage in cells
/
mutant embryos. Cells from wild-type (wt; A), cdc25a/
from cdc25a
(B), or wt treated with 12 Gy (C) embryos were isolated and subjected to a
comet assay. D, quantitation of tail moments from 200 cells from A to C;
( , P < 0.040; , P < 3 1011). E, immunoblot analysis of phosphohistone
H2AX (pH2AX) present in cells of unirradiated wt embryos, cdc25a/
mutant embryos, or 12 Gy irradiated (IR) wt embryos pretreated with
DMSO (lanes 1–3) or KU55933 (4–6). g-H2AX is induced in wt by IR, and
this effect is blocked by KU55933. However, cdc25a/ embryos do not
exhibit increased levels of g-H2AX.
As an alternative approach to detect DNA damage foci in
zebrafish, we developed an anti–phospho-histone H2AX
rabbit polyclonal antibody specific for phosphorylated zebrafish histone H2AX (23). Phosphorylated histone H2AX,
designated g-H2AX, is present at histone cores flanking
DSBs (37). We conducted immunoblot analysis on wildtype and cdc25a/ embryos to measure g-H2AX levels (Fig.
5E). Compared with wild-type controls, cdc25a/ embryos
have similar to decreased g-H2AX levels. As expected,
irradiated wild-type embryos exhibit increased g-H2AX,
which can be reduced by pretreatment of the embryos with
KU55933. Therefore, the ATM–g-H2AX axis is present
and normally functioning in zebrafish, but cdc25a/
embryos do not exhibit increased DNA damage, as measured
1458
Mol Cancer Res; 10(11) November 2012
by histone H2AX phosphorylation. The low level of
g-H2AX in cdc25a/ embryos made it unlikely that widespread DNA damage could account for the observed profound cell-cycle arrest. As a further evidence of this point, we
tested whether H2AX phosphorylation precedes the onset of
the cell-cycle phenotype in cdc25a/, by staining agematched embryos for g-H2AX and pH3 (Supplementary
Fig. S8). pH3 levels are detectably lower at 90% epiboly
stage (about 8 hpf) and continue to progressively decrease. In
contrast, H2AX phosphorylation does not become detectable until the 14 somite stage. These data indicate that cellcycle arrest precedes the increase in apoptotic g-H2AX.
The above results indicate that cdc25a deficiency triggers
an ATM-dependent G2–M accumulation in developing
embryos, but the accumulation is not attributable to
increased DNA DSBs. To account for ATM activity in
cdc25a/ embryos in the absence of detectable DNA
damage, we next considered the possibility that Cdc25A
directly regulates ATM via Cdc25's phosphatase activity. To
test the possibility that Cdc25A directly dephosphorylates
and regulates ATM, we overexpressed mouse Cdc25A in
A549 cells for 48 hours, irradiated the cells, and assessed the
phosphorylation status of ATM and its target, CHK2, by
immunoblotting (Supplementary Fig. S9). Both ATM and
CHK2 showed increased phosphorylation status after irradiation, and overexpression of Cdc25A did not decrease the
phosphorylation, indicating that Cdc25A does not directly
regulate ATM. We also noted increased phospho-ATM in
nonirradiated Cdc25A-overexpressing cells consistent with
previous findings that overexpression of Cdc25A leads to
increased DNA damage (38).
Finally, we investigated whether ATM is generally active
during early developmental cell cycles, and if its effects on the
cell cycle were being unmasked by cdc25a deficiency in the
mutant embryos. Indeed, wild-type embryos treated with
KU55933 and quantified for the number of mitotic cells
using pH3 as a marker exhibited an increased number of
mitotic cells as compared with controls (Fig. 4A, B, and G);
however, this effect did not reach statistical significance (P ¼
0.09). These results suggest that, during normal development, ATM is active and may attenuate the percentage of
cells progressing from G2 to M phase. On the basis of the
above results, we conclude that ATM is constitutively active
during development but does not completely deplete Cdc25
activity. Thus, in wild-type animals, a balance between cellcycle arrest/delay and cell-cycle progression is maintained.
cdc25a deficiency unmasks ATM activity, leading to G2
accumulation and impaired embryonic development.
In conducting this analysis, we noted that embryos treated
with 10 mmol/L KU55933 showed some developmental
toxicity in the absence of irradiation, suggesting ATM
function is necessary for healthy development of zebrafish.
To explore this possibility further, we knocked down ATM
expression with a morpholino and monitored developmental
toxicity and survival in the injected embryos (Supplementary
Fig. S10). Compared with control MO-injected embryos,
ATM morphants displayed increased developmental defects
and significantly lower survival. This result is consistent with
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
CDC25 Opposes ATM Activity during Development
an earlier report of lower survival in ATM morphants (29)
and suggests ATM may play an important role in normal
development, even in the absence of exogenous genotoxic
stress.
Discussion
ATM was first identified as the protein mutated in the
clinical syndrome ataxia-telangiectasia, which is characterized by immune dysfunction, abnormal sensitivity to ionizing radiation, cerebellar ataxia, and telangiectases. Subsequent work revealed that ATM, and the related PIKKs ATR
and DNA-PK, are central regulators of the DNA damage
response (39, 40). In response to genotoxic stresses causing
DNA DSBs, one action of ATM is to mediate G2–M cellcycle arrest by acting through the checkpoint kinases CHK1/
CHK2 to target Cdc25 for destruction (41–43). In keeping
with this role of ATM in maintaining genomic integrity,
people with mutations in the ATM gene are at increased risk
of developing cancer (44, 45).
More recently, it has become clear that the PIKKs and
their downstream partners have important roles in maintaining normal cell homeostasis, even in the absence of
exogenous sources of DNA damage. ATM and ATR control
the timing of replication origin firing, in the absence of DNA
damage (46). CHK1 localized to the centrosome has been
shown to regulate Cdc25B activity to control the entry into
mitosis (47). Constitutive histone H2AX phosphorylation
and constitutive ATM activation (CAA) in normal cycling
cells has been postulated to occur and has been attributed in
interphase cells to DNA damage due to endogenous oxidative stress (48–50). In mitotic cells, CAA and H2AX
phosphorylation have been associated with chromatin condensation, and postulated to play a role in maintaining
mitotic spindle integrity (51, 52).
Here, we show that a G2–M accumulation is present in
developing cdc25a mutant embryos, as evidenced by loss of
pH3 positive nuclei and by DNA content profiling. This
accumulation is due to activation of ATM and can be
partially overcome by inhibiting ATM, so long as cdc25d
activity is present. The G2–M accumulation is not due to
increased DNA damage, but seems to be constitutive, as
inhibiting ATM in wild-type embryos also increases the
number cells making the G2–M transition. In the cdc25a/
mutants, we do not believe that ATM activation results from
premature chromatin condensation or other mitotic abnormalities, because cells in developing mutant embryos arrest before the onset of chromatin condensation as evidenced
by markedly reduced levels of histone H3 serine 10 phosphorylation.
We hypothesize that a basal level of ATM activity occurs
in normal cell cycles. In cdc25a/ cells, early embryonic
development proceeds fairly normally due to compensatory
phosphatase activity of cdc25d. In cells with normal levels of
cdc25 activity, the basal level of ATM activity subtly attenuates cell-cycle progression; however, in cdc25a/ embryos,
the phosphatase activity of cdc25d is overwhelmed by basal
ATM activity, leading to cell-cycle accumulation in the
absence of marked DNA damage (Fig. 6). Only when ATM
Figure 6. Model of hierarchical Cdc25 function during normal cell cycles and response to stress. In the model, the size of the font indicates the relative
abundance of a protein or isoform. A, during a normal cell cycle, ATM is constitutively active but at a low level. The degree of inhibition of Cdc25a and Cdc25d
by ATM/CHK1 is insufficient to prevent Cdc25 phosphatase activity. Therefore, inactive cdc2-P is converted to active cdc2 , fostering the G2–M transition. B,
in the presence of DNA DSBs, ATM is strongly activated, leading to downregulation of cdc25 activity. Cdc2 remains in the inactive, phosphorylated
state, and G2–M progression is inhibited. C, when cdc25a is deficient, cdc25d is present but may be inhibited by ATM. Residual cdc25d activity is too
low to fully convert inactive cdc2-P to active cdc2 , resulting in delay of the cell cycle and accumulation in G2. D, inhibition of ATM in cdc25a-deficient cells
unmasks the activity of cdc25d. Under these conditions, sufficient cdc2-P is converted to active cdc2 , and G2–M progression is maintained.
www.aacrjournals.org
Mol Cancer Res; 10(11) November 2012
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1459
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Verduzco et al.
activity is genetically or pharmacologically abrogated can
cell-cycle activity resume. Thus, we propose that a hierarchy
of Cdc25 activity is present, such that enough combined
cdc25 phosphatase activity must be present to overcome the
basal ATM activity to progress the cell from G2 to M phase.
Our data do not indicate the mechanism(s) regulating
cdc25d. The sequence of cdc25d is poorly conserved relative
to other Cdc25 family members (19), and we did not
identify conserved consensus phosphorylation sites.
Because of our observation that G2–M accumulation is
likely due to basal ATM activity, we sought the mechanism
by which Cdc2 is being dephosphorylated in ATM-inhibited embryos. We discovered that zebrafish cdc25d is
expressed and is able to mediate cell-cycle progression to
a modest degree. Knockdown of cdc25d had profound
consequences for development in cdc25a/ or cdc25a
knockdown embryos, the first demonstration that cdc25d
is active in vivo in zebrafish. Ectopic expression of cdc25d led
to modest increases in the number of proliferating cells that
was detectable in cdc25a/ embryos. Previous reports
indicated that cdc25d could rescue a yeast cdc25 mutant
but failed to show activity in zebrafish (19, 20). Consistent
with these results, we did not detect a significant effect in
wild-type embryos, suggesting that cdc25a is responsible for
the majority of Cdc25 activity during development. Expression of cdc25d did not, however, rescue the morphologic
phenotype of cdc25a/ embryos. This finding may be due
to limited ability of cdc25d to oppose ATM activity in
cdc25a/ mutants, or may point to essential roles of cdc25a
in processes other than G2–M progression.
The early development of vertebrate embryos requires
rapid and highly regulated cell divisions. Cdc25 phosphatases are important mediators of this rapid cell-cycle flux.
Balancing this rapid growth is the need to respond to
genotoxic insults from exogenous or endogenous agents to
ensure the health and genomic stability of the developing
embryo. The results presented here emphasize the delicate
balance between cell proliferation and cell-cycle arrest/delay,
and highlight the competing roles of ATM and Cdc25 family
members in this process. The cdc25a/ mutant also provides a sensitive model of physiologic ATM activity that
could be used to further dissect the genetics of the DNA
damage response and to screen for novel checkpoint
inhibitors.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: D. Verduzco, J.F. Amatruda
Development of methodology: D. Verduzco, J.F. Amatruda
Acquisition of data (provided animals, acquired and managed patients, provided
facilities, etc.): D. Verduzco, J.S. Dovey, B.A. Skaug, J.F. Amatruda
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): D. Verduzco, E. Kodym, J.F. Amatruda
Writing, review, and/or revision of the manuscript: D. Verduzco, J.F. Amatruda
Administrative, technical, or material support (i.e., reporting or organizing data,
constructing databases): D. Verduzco
Study supervision: E. Kodym
Other: Conducted Western blot analysis, A.A. Shukla
Acknowledgments
The authors thank Reinhard Kodym for helpful discussions and advice, Nuno
Gomez for assistance with the comet assay, Elizabeth Patton for comments on the
manuscript, and Leonard Zon for generously supporting the early phase of this work.
Grant Support
This study was supported by grants from the Amon G. Carter Foundation and by
grant 1R01CA135731 from the National Cancer Institute to J.F. Amatruda. D.
Verduzco was supported by NIH training grant 5 T32 GM08203.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
Received February 3, 2012; revised August 21, 2012; accepted August 31, 2012;
published OnlineFirst September 17, 2012.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
1460
Friedberg EC, McDaniel LD, Schultz RA. The role of endogenous and
exogenous DNA damage and mutagenesis. Curr Opin Genet Dev
2004;14:5–10.
Burcham PC. Internal hazards: baseline DNA damage by endogenous
products of normal metabolism. Mutat Res 1999;443:11–36.
Xiao W, Samson L. In vivo evidence for endogenous DNA alkylation
damage as a source of spontaneous mutation in eukaryotic cells. Proc
Natl Acad Sci U S A 1993;90:2117–21.
Ames BN. Endogenous DNA damage as related to cancer and aging.
Mutat Res 1989;214:41–6.
Giglia-Mari G, Zotter A, Vermeulen W. DNA damage response. Cold
Spring Harb Perspect Biol 2011;3:a000745.
Kastan MB, Bartek J. Cell-cycle checkpoints and cancer. Nature
2004;432:316–23.
Smith J, Tho LM, Xu N, Gillespie DA. The ATM-Chk2 and ATR-Chk1
pathways in DNA damage signaling and cancer. Adv Cancer Res
2010;108:73–112.
Siliciano JD, Canman CE, Taya Y, Sakaguchi K, Appella E, Kastan MB.
DNA damage induces phosphorylation of the amino terminus of p53.
Genes Dev 1997;11:3471–81.
Matsuoka S, Huang M, Elledge SJ. Linkage of ATM to cell cycle
regulation by the Chk2 protein kinase. Science 1998;282:
1893–7.
Mol Cancer Res; 10(11) November 2012
10. Barlow C, Hirotsune S, Paylor R, Liyanage M, Eckhaus M, Collins F,
et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell
1996;86:159–71.
11. Xu Y, Ashley T, Brainerd EE, Bronson RT, Meyn MS, Baltimore D.
Targeted disruption of ATM leads to growth retardation, chromosomal
fragmentation during meiosis, immune defects, and thymic lymphoma.
Genes Dev 1996;10:2411–22.
12. Zha S, Sekiguchi J, Brush JW, Bassing CH, Alt FW. Complementary functions of ATM and H2AX in development and suppression
of genomic instability. Proc Natl Acad Sci U S A 2008;105:
9302–6.
13. Gurley KE, Kemp CJ. Synthetic lethality between mutation in Atm and
DNA-PK(cs) during murine embryogenesis. Curr Biol 2001;11:191–4.
14. Aressy B, Ducommun B. Cell cycle control by the CDC25 phosphatases. Anticancer Agents Med Chem 2008;8:818–24.
15. Mailand N, Podtelejnikov AV, Groth A, Mann M, Bartek J, Lukas J.
Regulation of G(2)/M events by Cdc25A through phosphorylationdependent modulation of its stability. EMBO J 2002;21:5911–20.
16. Busino L, Chiesa M, Draetta GF, Donzelli M. Cdc25A phosphatase:
combinatorial phosphorylation, ubiquitylation and proteolysis. Oncogene 2004;23:2050–6.
17. Lee G, White LS, Hurov KE, Stappenbeck TS, Piwnica-Worms H.
Response of small intestinal epithelial cells to acute disruption of cell
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
CDC25 Opposes ATM Activity during Development
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
division through CDC25 deletion. Proc Natl Acad Sci U S A
2009;106:4701–6.
Ferguson AM, White LS, Donovan PJ, Piwnica-Worms H. Normal cell
cycle and checkpoint responses in mice and cells lacking Cdc25B and
Cdc25C protein phosphatases. Mol Cell Biol 2005;25:2853–60.
Nogare DE, Arguello A, Sazer S, Lane ME. Zebrafish cdc25a is
expressed during early development and limiting for post-blastoderm
cell cycle progression. Dev Dyn 2007;236:3427–35.
Dalle Nogare DE, Pauerstein PT, Lane ME. G2 acquisition by transcription-independent mechanism at the zebrafish midblastula transition. Dev Biol 2009;326:131–42.
Shepard JL, Amatruda JF, Stern HM, Subramanian A, Finkelstein D,
Ziai J, et al. A zebrafish bmyb mutation causes genome instability and
increased cancer susceptibility. Proc Natl Acad Sci U S A
2005;102:13194–9.
Westerfield M. The zebrafish book. A guide for the laboratory use of
zebrafish (Danio rerio). 4th ed. Eugene, OR: University of Oregon Press;
2000.
Sidi S, Sanda T, Kennedy RD, Hagen AT, Jette CA, Hoffmans R, et al.
Chk1 suppresses a caspase-2 apoptotic response to DNA damage
that bypasses p53, Bcl-2, and caspase-3. Cell 2008;133:864–77.
Verduzco D, Amatruda JF. Analysis of cell proliferation, senescence,
and cell death in Zebrafish embryos. In: Westerfield M, Zon L, Detrich
HW III, editors. Essential Zebrafish Methods. London, UK: Elsevier;
2009.
Davuluri G, Gong W, Yusuff S, Lorent K, Muthumani M, Dolan AC, et al.
Mutation of the zebrafish nucleoporin elys sensitizes tissue progenitors to replication stress. PLoS Genet 2008;4:e1000240.
Link BA, Kainz PM, Ryou T, Dowling JE. The perplexed and confused
mutations affect distinct stages during the transition from proliferating
to post-mitotic cells within the zebrafish retina. Dev Biol 2001;236:
436–53.
Shepard JL, Stern HM, Pfaff KL, Amatruda JF. Analysis of the cell cycle
in zebrafish embryos. Methods Cell Biol 2004;76:109–25.
Kodym E, Kodym R, Choy H, Saha D. Sustained metaphase arrest in
response to ionizing radiation in a non–small cell lung cancer cell line.
Radiat Res 2008;169:46–58.
Imamura S, Kishi S. Molecular cloning and functional characterization
of zebrafish ATM. Int J Biochem Cell Biol 2005;37:1105–16.
Shepard JL, Amatruda JF, Finkelstein D, Ziai J, Finley KR, Stern HM,
et al. A mutation in separase causes genome instability and increased
susceptibility to epithelial cancer. Genes Dev 2007;21:55–9.
Sauve DM, Anderson HJ, Ray JM, James WM, Roberge M. Phosphorylation-induced rearrangement of the histone H3 NH2-terminal domain
during mitotic chromosome condensation. J Cell Biol 1999;145:
225–35.
Xu D, Bai J, Duan Q, Costa M, Dai W. Covalent modifications of
histones during mitosis and meiosis. Cell Cycle 2009;8:3688–94.
Kurki P, Vanderlaan M, Dolbeare F, Gray J, Tan EM. Expression of
proliferating cell nuclear antigen (PCNA)/cyclin during the cell cycle.
Exp Cell Res 1986;166:209–19.
Bahary N, Davidson A, Ransom D, Shepard J, Stern H, Trede N, et al.
The Zon laboratory guide to positional cloning in zebrafish. Methods
Cell Biol 2004;77:305–29.
www.aacrjournals.org
35. Berghmans S, Murphey RD, Wienholds E, Neuberg D, Kutok JL,
Fletcher CD, et al. tp53 mutant zebrafish develop malignant peripheral
nerve sheath tumors. Proc Natl Acad Sci U S A 2005;102:407–12.
36. Olive PL, Banath JP. The comet assay: a method to measure DNA
damage in individual cells. Nat Protoc 2006;1:23–9.
37. Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM. DNA doublestranded breaks induce histone H2AX phosphorylation on serine 139.
J Biol Chem 1998;273:5858–68.
38. Cangi MG, Piccinin S, Pecciarini L, Talarico A, Dal Cin E, Grassi S,
et al. Constitutive overexpression of CDC25A in primary human
mammary epithelial cells results in both defective DNA damage
response and chromosomal breaks at fragile sites. Int J Cancer 2008;
123:1466–71.
39. Durocher D, Jackson SP. DNA-PK, ATM and ATR as sensors of
DNA damage: variations on a theme? Curr Opin Cell Biol 2001;13:
225–31.
40. Yang J, Yu Y, Hamrick HE, Duerksen-Hughes PJ. ATM, ATR and DNAPK: initiators of the cellular genotoxic stress responses. Carcinogenesis 2003;24:1571–80.
41. Lavin MF, Kozlov S. ATM activation and DNA damage response. Cell
Cycle 2007;6:931–42.
42. Chen Y, Poon RY. The multiple checkpoint functions of CHK1 and
CHK2 in maintenance of genome stability. Front Biosci 2008;13:
5016–29.
43. Reinhardt HC, Yaffe MB. Kinases that control the cell cycle in response
to DNA damage: Chk1, Chk2, and MK2. Curr Opin Cell Biol 2009;
21:245–55.
44. Lavin MF. Ataxia–telangiectasia: from a rare disorder to a paradigm for
cell signalling and cancer. Nat Rev Mol Cell Biol 2008;9:759–69.
45. Ahmed M, Rahman N. ATM and breast cancer susceptibility. Oncogene 2006;25:5906–11.
46. Shechter D, Costanzo V, Gautier J. ATR and ATM regulate the timing of
DNA replication origin firing. Nat Cell Biol 2004;6:648–55.
47. Kramer A, Mailand N, Lukas C, Syljuasen RG, Wilkinson CJ, Nigg EA,
et al. Centrosome-associated Chk1 prevents premature activation of
cyclin-B-Cdk1 kinase. Nat Cell Biol 2004;6:884–91.
48. MacPhail SH, Banath JP, Yu Y, Chu E, Olive PL. Cell cycle-dependent
expression of phosphorylated histone H2AX: reduced expression in
unirradiated but not X-irradiated G1-phase cells. Radiat Res 2003;
159:759–67.
49. Huang X, Halicka HD, Traganos F, Tanaka T, Kurose A, Darzynkiewicz
Z. Cytometric assessment of DNA damage in relation to cell cycle
phase and apoptosis. Cell Prolif 2005;38:223–43.
50. Tanaka T, Halicka HD, Huang X, Traganos F, Darzynkiewicz Z. Constitutive histone H2AX phosphorylation and ATM activation, the reporters of DNA damage by endogenous oxidants. Cell Cycle 2006;5:
1940–5.
51. McManus KJ, Hendzel MJ. ATM-dependent DNA damage-independent mitotic phosphorylation of H2AX in normally growing mammalian
cells. Mol Biol Cell 2005;16:5013–25.
52. Ichijima Y, Sakasai R, Okita N, Asahina K, Mizutani S, Teraoka H.
Phosphorylation of histone H2AX at M phase in human cells without
DNA damage response. Biochem Biophys Res Commun 2005;336:
807–12.
Mol Cancer Res; 10(11) November 2012
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.
1461
Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072
Multiple Isoforms of CDC25 Oppose ATM Activity to Maintain Cell
Proliferation during Vertebrate Development
Daniel Verduzco, Jennifer Shepard Dovey, Abhay A. Shukla, et al.
Mol Cancer Res 2012;10:1451-1461. Published OnlineFirst September 17, 2012.
Updated version
Supplementary
Material
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
doi:10.1158/1541-7786.MCR-12-0072
Access the most recent supplemental material at:
http://mcr.aacrjournals.org/content/suppl/2012/09/14/1541-7786.MCR-12-0072.DC1
This article cites 50 articles, 16 of which you can access for free at:
http://mcr.aacrjournals.org/content/10/11/1451.full.html#ref-list-1
This article has been cited by 1 HighWire-hosted articles. Access the articles at:
/content/10/11/1451.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at
[email protected].
To request permission to re-use all or part of this article, contact the AACR Publications Department at
[email protected].
Downloaded from mcr.aacrjournals.org on June 16, 2017. © 2012 American Association for Cancer Research.