Download Rapid communication: Nucleotide sequence of the river buffalo beta

Rapid communication: Nucleotide sequence of the river buff
beta-casein cDNA
P. Das1, G. Tiwari, S. Jain, and L. C. Garg2
Gene Regulation Laboratory, National Institute of Immunology, Aruna Asaf Ali M
New Delhi-110067, India
Name of the Sequence. River buffalo beta-casein cDNA.
Genus and Species. Bubalus arnee bubalis.
Origin of the Clone. First-strand synthesis was per-
formed in 10 ␮g of total RNA isolated from lactating
mammary tissue of a Murrah buffalo using oligo d(T)17
primer and superscript II reverse transcriptase (GIBCOBRL, Grand Island, NY). PCR was performed using the
above oligo d(T)17 as reverse primer and a forward primer
(5′ GGAAAAAAGGAATTGAGAGCC 3′) designed on the
basis of conserved regions, through a multiple alignment
of bovine, ovine, caprine, and porcine cDNA sequences.
A single and specific PCR product was obtained that was
cloned into pMOSblue T-vector (Amersham, U.K.) after
purification. Two individual positive clones were sequenced on both the strands by an automated sequencer
(ABI 377, Applied Biosystems, Foster-City, CA) using
universal as well as specific primers.
Comparison with Related Sequences. The coding region
of river buffalo beta-casein cDNA is 675 bp long encoding
a protein of 224 amino acid residues. At the nucleotide
level, it is 96, 95, and 80% identical to bovine (Jemenez
et al., 1987), ovine (Provot et al., 1989), and porcine (Alexander and Beattie, 1992) sequences, respectively. The
deduced amino acid is 95% identical to cow, 93% identical
to sheep, and 61% identical to pig. Our sequence differs
only in one nucleotide at position 350 from another sequence (GenBank Acc. No. BBAJ5165) of identical origin
deposited during our investigation. This difference results in one amino acid substitution (Met–Thr) and may
be a variant of kappa-casein in river buffalo.
Sequence Data. The nucleotide sequence of river buffalo
beta-casein cDNA is shown in Figure 1. The sequence is
1,037 bp long containing the coding region of cDNA in
a single open reading frame encoding the complete expressed product of beta-casein. The first 15 amino acid
residues constitute the putative signal peptide. The mature peptide contains one site for alpha/beta signature
Figure 1. Nucleotide sequence of ri
casein cDNA. The putative signal pepti
The stop codon (TAA) is shown in bold
A signal is bold and underlined, and t
bold and italicized.
EMBL/GenBank Accession Number.
Comments. Beta-casein, like alpha-S
belongs to the family of calcium-sens
milk. Though a diverging family of pr
beta signature as well as phosphorylate
are highly conserved among related sp
Literature Cited
Alexander, L. J., and C. W. Beattie. 1992. The
beta-casein cDNA. Anim. Genet. 23:369–3