Download Putative GTPase Gtr1p genetically interacts with the RanGTPase

2311
Journal of Cell Science 109, 2311-2318 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
JCS3417
Putative GTPase Gtr1p genetically interacts with the RanGTPase cycle in
Saccharomyces cerevisiae
Nobutaka Nakashima, Naoyuki Hayashi, Eishi Noguchi and Takeharu Nishimoto*
Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Higashi-ku, Fukuoka 812-82, Japan
*Author for correspondence (e-mail: [email protected])
SUMMARY
In order to identify a protein interacting with RCC1, a
guanine nucleotide-exchange factor for the nuclear GTPase
Ran, we isolated a series of cold-sensitive suppressors of
mtr1-2, a temperature-sensitive mutant of the Saccharomyces cerevisiae RCC1 homologue. One of the isolated
suppressor mutants was mutated in the putative GTPase
Gtr1p, being designated as gtr1-11. It also suppressed other
alleles of mtr1-2, srm1-1 and prp20-1 in contrast to overexpression of the S. cerevisiae Ran/TC4 homologue Gsp1p,
previously reported to suppress prp20-1, but not mtr1-2 or
srm1-1. Furthermore, gtr1-11 suppressed the rna1-1, tem-
perature-sensitive mutant of the Gsp1p GTPase-activating
protein, but not the srp1-31, temperature-sensitive mutant
of the S. cerevisiae importin α homologue. mtr1-2, srm1-1
and prp20-1 were also suppressed by overexpression of the
mutated Gtr1p, Gtr1-11p. In summary, Gtr1p that was
localized in the cytoplasm by immunofluoresence staining
was suggested to function as a negative regulator for the
Ran/TC4 GTPase cycle.
INTRODUCTION
nuclear location signal (NLS) bind to NLS-receptors that
consist of importin α/karyopherin α/p60 and importin β/karyopherin β/p90, and then such complexes are transferred onto the
nuclear pore complex (Rexach and Blobel, 1996). For nuclear
translocation of proteins, the hydrolysis of GTP-Ran is
required (Melchior et al., 1995). Like other Ras family
members, Ran/TC4 GTPase activity is very low and can be
activated by a Ran/TC4 GTPase-activating protein (RanGAP)
encoded by rna1+/RNA1 (Bischoff et al., 1994, 1995; Becker
et al., 1995). In accordance with involvement of Ran/TC4 in
nuclear transport of proteins, both rcc1 and rna1 show a defect
in the nucleocytoplasmic transport of proteins and RNA
(Amberg et al., 1993; Kadowaki et al., 1993; Tachibana et al.,
1994; Corbett et al., 1995). Diverse phenotypes of S. cerevisiae
rcc1 (mtr1, srm1 and prp20), therefore, have been argued to
be a consequence of defects in nucleocytoplasmic transport
(Melchior and Gerace, 1995). In fact, there has been one report
showing that a loss of nuclear protein import induces a cell
cycle-specific defect (Loeb et al., 1995).
However, RCC1 has a DNA-binding activity and is located
on chromatin in a ratio of one molecule per 1 to 10 nucleosomes (Dasso et al., 1992). On the other hand, Ran/TC4 has a
25-fold molar excess over RCC1 in HeLa cells (Bischoff and
Ponstingl, 1991a) and is located within the nucleoplasm (Ren
et al., 1993). In contrast with other Ras-family members,
Ran/TC4 itself and its interacting proteins are not posttranslationally modified. They interact with each other in homogeneous solution rather than on the membrane surface (Klebe
et al., 1995), suggesting that Ran/TC4 is involved in multiple
pathways.
RCC1 was identified as a mutated gene in a temperaturesensitive (ts) mutant of the hamster BHK21 cell line, tsBN2,
which shows cell cycle-specific phenotypes such as G1 arrest
or premature chromatin condensation (Uchida et al., 1990;
Nishitani et al., 1991). Subsequently, ts mutants of the S. cerevisiae RCC1 homologue have been independently isolated
from diverse viewpoints of cellular function such as mating
pathway (srm1) (Clark and Sprague, 1989), mRNA splicing
(prp20) (Aebi et al., 1990) and mRNA export (mtr1)
(Kadowaki et al., 1993), while from Schizosaccharomyces
pombe, a ts mutant of the RCC1 homologue pim1-D1, has been
isolated either as a mutant defective in coupling between DNA
replication and mitosis (Matsumoto and Beach, 1991) or as a
mutant defective in chromosome decondensation following the
completion of mitosis (Sazer and Nurse, 1994).
RCC1 is a guanine nucleotide-exchanging factor (GEF)
acting on G protein Ran/TC4 (Bischoff and Ponstingl, 1991a).
The TC4 cDNA was originally cloned as one of the Ras-like
G proteins using a mixed-oligonucleotide probe (Drivas et al.,
1990) and Ran was identified as a protein tightly bound to
RCC1 (Bischoff and Ponstingl, 1991b). The yeast Ran/TC4
homologues, S. cerevisiae GSP1 and S. pombe spi1/fyt1 were
identified as a multicopy suppressor of prp20-1 and pim1-46,
respectively (Matsumoto and Beach, 1991; Belhumeur et al.,
1993; Sazer and Nurse, 1994). On the other hand, using a permeabilized HeLa cell system, Ran/TC4 was also identified as
a protein essential for nuclear import of proteins (Moore and
Blobel, 1993; Melchior et al., 1993). Proteins that carry a
Key words: GTR1, RCC1, Ran, RNA1
2312 N. Nakashima and others
Table 1. Yeast strains used in this study
Strain
T18
T18-5c
T18∆GTR1/3
T14
NBW5
NBW5∆GTR
NN22-4c
NN22-4a
NN23-7a
NN23-7d
YAT248
NN39-7a
NN39-7b
NN39-7c
NN39-7d
NOY612
NN61-9a
NN61-9b
NN61-9c
NN61-9d
prp20/2c
NN22
NN23
NN39
NN61
Genotype
Source
MATa mtr1-2 ade2-101 ura3-52 his3-∆200 leu2-∆1 lys2-801
MATa mtr1-2 gtr1-11 ade2-101 ura3-52 his3-∆200 leu2-∆1 lys2-801
MATa mtr1-2 gtr1-3∆ ade2-101 ura3-52 his3-∆200 leu2-∆1 lys2-801
MATα mtr1-2 ade2-101 ura3-52 his3-∆200 trp1-∆1 lys2-801
MATα ade2 ura3-1,2 his3-532 leu2-3,112 trp1-289 can1
MATα gtr1-1∆ ade2 ura3-1,2 his3-532 leu2-3,112 trp1-289 can1
MATα srm1-1 gtr1-11 ade2 ura3 his3 leu2 trp1
MATa srm1-1 ade2 leu2 trp1
MATα prp20-1 gtr1-11 ade2 ura3 his3 lys2
MATα prp20-1 ade2 ura3 his3 leu2
MATα rna1-1 ade2 ura1 his1 lys1
rna1-1 gtr1-11 ade2 ura3 leu2 trp1
MATα gtr1-11 ade2 ura3 his3 leu2 trp1
rna1-1 ade2 ura3 leu2 trp1
ade2 ura3 his3 leu2 trp1
MATa srp1-31 ade2-1 ura3-1 his3-11 trp1-1 leu2-3,112 can1-100
MATa ade2 ura3 leu2 trp1
MATα srp1-31 gtr1-11 ade2 ura3 his3 leu2 trp1
MATa gtr1-11 ade2 ura3 leu2 trp1
MATα srp1-31 ade2 ura3 his3 leu2 trp1
MATa prp20-1 ade2-101 ura3-52 his3-∆200 lys2-801
MATa srm1-1 gtr1-11 ade2 + + leu2 trp1
MATα +
+
ade2 ura3 his3 leu2 trp1
MATa prp20-1 +
ade2 ura3 his3 + lys2
MATα prp20-1 gtr1-11 ade2 ura3 his3 leu2 +
MATa rna1-1 gtr1-11 ade2 ura3 + leu2 trp1
MATα +
+ ade2 ura3 his3 leu2 trp1
MATa srp1-31 gtr1-11 ade2 ura3 + leu2 trp1
MATα +
+
ade2 ura3 his3 leu2 trp1
By analogy to Ras (Boguski and McCormick, 1993), Ran
may function as a molecular switch for cellular functions that
takes upstream signals and transfers them to downstream
events. In this context, it is an intriguing idea that RCC1 may
check the progression of DNA replication on the chromatin, as
an upstream sensor of the Ran/TC4 pathway. Since an RCC1
mutant deleted of the DNA-binding domain can complement
a tsBN2 mutation and binds to the chromatin in ts+ transformants of tsBN2 cells (Seino et al., 1992), RCC1 is assumed to
be tethered to chromosomal DNA by other proteins. Consistently, the BJ1 Drosophila RCC1 homologue makes a saltlabile protein complex on the chromatin (Frasch, 1991) and S.
cerevisiae Prp20p comprises a large complex of more than 150
kDa (Lee et al., 1993). In order to identify proteins that functionally interact with RCC1, we have been isolating a series of
extragenic suppressors of mtr1-2. In this report, a coldsensitive mutation of the putative GTPase Gtr1p (Bun-ya et al.,
1992) was found to suppress mtr1-2, srm1-1 and prp20-1. Suppressors of S. cerevisiae rcc1 found thus far rescue either srm11 and mtr1-2 or prp20-1, but not all three rcc1 mutants
(Kadowaki et al., 1993; Lee et al., 1994; Hayashi et al., 1996).
Furthermore, the suppressor, gtr1-11, also suppress rna1-1, but
not the srp1-31 ts mutant of the S. cerevisiae homologue of
Importin α/karyopherin α/p60 (Yano et al., 1994). Recently,
the mammalian homologue of GTR1 has been cloned
(Schürmann et al., 1995), indicating that GTR1 is conserved
throughout evolution.
MATERIALS AND METHODS
Strains, plasmids and media
S. cerevisiae strains and plasmids constructed by standard genetic
T. Kadowaki
This study
This study
T. Kadowaki
Ogawa and Oshima (1990)
This study
This study
This study
This study
This study
A. Toh-e
This study
This study
This study
This study
Yano et al. (1994)
This study
This study
This study
This study
Aebi et al. (1990)
This study
This study
This study
This study
manipulations (Sherman et al., 1982) for this study are described in
Table 1 and 2, respectively. S. cerevisiae and Escherichia coli strains
were cultured and transformed as described previously (Nishiwaki et
al., 1987; Hayashi et al., 1995; Ito et al., 1983). In order to isolate
mutants, cells were irradiated with 5 mJ/cm2 of ultraviolet using UV
linker FS1500 (Funakoshi).
S. cerevisiae genomic library
A yeast genomic DNA library constructed by partial digestion of S.
cerevisiae genomic DNA with Sau3AI and ligation into the BamHI
site of YCp50 vector (Parent et al., 1985) was a gift from K.
Matsumoto (Nagoya University).
Cloning of the gtr1-11 allele
The 2.3 kb EcoRI/HindIII genomic DNA fragment of pL3 (Table 2)
was inserted into the EcoRI/HindIII site of the YIp5 vector (Parent et
al., 1985). The resulting plasmid, pL50 (Table 2) was digested with
BglII and introduced into a haploid strain T18-5c (Table 1). Ura+
colonies were selected on a synthetic ura− medium plate. Genomic
DNA of these colonies was prepared, digested with BamHI enzyme
and then transformed into E. coli XLI-blue after self-ligation of
digested fragments, in order to recover the YIp plasmid possessing a
full-length mutated GTR1, gtr1-11.
Construction of HA fused Gtr1p
The HA sequence of pBluescript HA (a gift from B. Futcher, Cold
Spring Harbor Laboratory) (Tyers et al., 1992) was amplified by PCR
using as primers, 5′GCGGCCATATGTTTTACCCATAC3′ and
5′GAATCCCATGGTTCTAGAGC3′, together with pfu DNA polymerase (Stratagene, USA), and it was then integrated into the HincII
site of pBluescriptIITKS(+) (Ichihara and Kurosawa, 1993), resulting
in a plasmid pTKS-HA1. The 1.5 kb NcoI/BamHI fragment of GTR1
carried on pUC29 (Benes et al. 1993) was inserted into the NcoI/BglII
site of pTKS-HA1, resulting in a plasmid pL46. The 1.5 kb XhoI/SpeI
fragment of GTR1HA was cut out from pL46 and inserted into the
XhoI/SpeI site of the pNV7 vector (Ninomiya-Tsuji et al., 1991),
Gtr1p and RanGTPase 2313
Table 2. Yeast plasmids used in this study
Plasmid
Markers
pL3
pL3∆Xb
pL3∆C
pL63
pL50
pL64
CEN4 URA3 GTR1 PHO84
CEN4 URA3 GTR1
CEN4 URA3 GTR1
2µ URA3 GTR1
URA3
2µ URA3 gtr1-11
pL78
pMB130
pAC609
URA3 GAL1-10:GTR1HA
HIS3 gtr1-1∆PHO84
URA3 gtr1-3∆ PHO84
Comments
Cloned from YCp50*-based S. cerevisiae genomic library
Digested pL3 by XbaI and self-ligated
Digested pL3 by ClaI and self-ligated
KpnI/BamHI fragment from pL3 (Kp/B1) cloned into YEplac195†
EcoRI/HindIII fragment from pL3 (E2/Hd1) cloned into YIp5
YEplac195 containing gtr1-11 allele (as KpnI/BamHI fragment; Kp/B1), that was
cloned from the genome of the T18-5c strain (see Materials and Methods)
YIp5* containing GAL1-10 promoter and GTR1HA
pUC119 containing gtr1-1∆ allele and PHO84 (for gene disruption)
pUC118 containing gtr1-3∆ allele and PHO84 (for gene disruption)
Source
This study
This study
This study
This study
This study
This study
This study
Bun-ya et al. (1992)
Bun-ya et al. (1992)
*YCp50 and YIp5 (Parent et al., 1985).
†YEplac195 (Gietz et al., 1988).
resulting in plasmid pL48 containing GTR1HA at the downstream site
of the GAL1-10 promoter. Finally, the 2.0 kb SalI/SpeI fragment
covering GAL1-10: GTR1HA was cut out from pL48 and inserted into
the SalI/NheI site of the YIp5 vector, resulting in plasmid pL78 (Table
2).
The obtained plasmid pL78 was introduced into a strain
NBW5∆GTR (Table 1).
Immunofluorescence microscopy
S. cerevisiae strains were processed and fixed with the method
described by Hagan and Hyams (1988). Cellular DNA was stained
with Hoechst 33342, and HA-fused proteins were stained by the
12CA5 mouse monoclonal antibody to the influenza hemagglutinin
peptide HA1 (a gift from H. Shiomi) and then FITC-conjugated goat
anti-mouse antibody.
RESULTS
Isolation of a suppressor of mtr1-2
A series of suppressors was isolated as cold sensitive mutants,
from the T18 strain of S. cerevisiae mtr1-2, which has been
isolated as a ts mutant defective in mRNA export (Kadowaki
et al., 1993). Cultures of the T18 strain grown at 26°C, were
plated out on YEPD plates at 1×107 cells/100 mm diameter
dish, and irradiated with UV as described in Materials and
Methods. UV-irradiated cultures were incubated at 26°C for
one day and then incubated for 3 days at 30°C, the restrictive
temperature for mtr1-2. Colonies which appeared were
screened for cold-sensitivity (cs−) by replica-plating and incubation at 14°C for 7 days. From 30 revertants, only one clone
designated as T18-5c, did not grow at 14°C.
The T18-5c strain was crossed with the T14 strain of mtr12 (Hayashi et al., 1995) and the resulting diploids grew at 14°C,
but not at 30°C. These were then sporulated and dissected. Two
viable and two nonviable segregants in 10 tetrads were
observed at 14°C, and all the segregants which did not grow
at 14°C grew at 30°C, and vice versa. Thus, the ability to
rescue mtr1-2 and a cold-sensitive phenotype were genetically
linked, demonstrating that these two phenotypes are caused by
mutation in a single gene, and that the suppressor mutation is
recessive with regard to both phenotypes.
When the T18-5c strain was crossed with the wild-type
strain, tetrads resulted in a 2+:2− segregation at 14°C on
YEPD, whereas they showed 4+:0−, 3+:1− and 2+:2− segregation patterns at 30°C. Thus, the suppressor mutation was
confirmed to be recessive and was not linked to mtr1-2.
The cold-sensitive suppressor of mtr1-2 has a
defect in GTR1
The YCp50 genomic library of S. cerevisiae was introduced
into the cs− strain T18-5c, and transformants were screened for
growth ability at 14°C. Three clones out of 3,000 transformants
grew at 14°C and turned out to contain the same plasmid DNA
designated as pL3. Restriction enzyme sites of the cloned DNA
are shown in Fig. 1A. In order to determine the position of
cloned DNA in S. cerevisiae genomic DNA, a fragment of 5.2
kb from the SalI site (outside the second BamHI site, B2) to
the second XbaI site (Xb2) was subcloned into the XbaI/SalI
sites of pUC29 and the nucleotide sequence was partly determined from the XbaI site of cloned DNA. In comparison with
the S. cerevisiae genomic sequence, pL3 turned out to contain
a part of TUB3, PHO84 and GTR1 of the S. cerevisiae genomic
DNA previously reported (Bun-ya et al., 1992). In order to
assign the region essential for conferring the cs+ phenotype on
the T18-5c strain, the inserted DNA was digested into smaller
DNA fragments as shown in Fig. 1A. All those plasmids which
contained the whole region of GTR1 conferred the cs+
phenotype, but not the ts+ phenotype, on the T18-5c strain (Fig.
1B), proving that a recessive mutation (designated gtr1-11) in
the GTR1 gene is responsible for suppressing the mtr1-2
mutation and for conferring the cs− phenotype.
gtr1 suppressed both srm1 and prp20
So far, either overexpression of Gsp1p (Belhumeur et al., 1993)
or ded1-21 (Hayashi et al., 1996) have been found to suppress
S. cerevisiae rcc1. Curiously, overexpression of Gsp1p suppresses the rcc1 mutants mapped in the C terminus of the RCC1
repeat, such as prp20-1, but not the rcc1 mutants mapped in the
N terminus of the RCC1 repeat, such as srm1-1 and mtr1-2
(Kadowaki et al., 1993; Lee et al., 1994). On the contrary, ded121 suppresses srm1-1 and mtr1-2, but not prp20-1 (Hayashi et
al., 1996). In order to determine whether gtr1-11 can suppress
other alleles of mtr1-2 such as prp20-1 and srm1-1, haploid
strains containing double mutations srm1-1 gtr1-11 (NN22-4c)
and prp20-1 gtr1-11 (NN23-7a) were constructed, and then
incubated on YEPD plates at 14°C, the restrictive temperature
for gtr1-11, and at a high temperature, either at 32°C the restrictive temperature for the srm1-1 or at 33°C the restrictive temperature for the prp20-1. Surprisingly, gtr1-11 suppressed both
srm1-1 and prp20-1 (Fig. 2).
gtr1 suppressed rna1, but not srp1
The finding that the same mutation suppressed not only mtr1-
2314 N. Nakashima and others
Fig. 1. A cold-sensitive mutation of GTR1 suppressed mtr1-2.
(A) S. cerevisiae genomic DNA complementing the coldsensitive suppressor. The thick bar indicates the cloned DNA
fragment designated as pL3, which complemented the coldsensitivity of the T18-5c strain and which was isolated from the
genomic DNA library. Determined restriction enzyme sites are
shown. E, EcoRI; Xb, XbaI; C, ClaI; Bg, BglII; Hd, HindIII; Kp,
KpnI; B, BamHI. pL3∆Xb and pL3∆C were self-ligated products
of pL3 digested with XbaI and ClaI, respectively. pL63 was
YEplac195 vector possessing the 3.4 kb KpnI/BamHI fragment
of pL3 at KpnI/BamHI sites. (B) Suppression of mtr1-2 by gtr111. Strains T18 (mtr1-2), T18-5c (mtr1-2, gtr1-11) and their
derivatives, which harbor the plasmid PL3∆C containing the
GTR1 gene, were plated on a YEPD plate and incubated either at
14°C or at 30°C as indicated.
2 and srm1-1, but also prp20-1 raised the question of whether
the gtr1-11 mutation is a general suppressor of defects in the
Ran pathway. In order to address this issue, we chose the ts
mutant, rna1-1 which is defective in Gsp1 GTPase activating
protein. Four segregants obtained from the NN39 diploid strain
harboring gtr1-11 and rna1-1 (Table 1) were plated out and
incubated on YEPD plates either at 14°C, the restrictive temperature for gtr1-11, or 33°C, the restrictive temperature for
rna1-1. As shown in Fig. 3A, the gtr1-11 conferred ts+
phenotype to rna1-1 as well.
Since the Ran pathway is involved in the nucleocytoplasmic
transport of proteins and RNA, we then asked whether gtr1-11
also suppressed mutations defective in this process. In order to
address this issue, we chose a ts mutation of Srp1p that
interacts with various nuclear proteins and controls nuclear
pore transport functions (Yano et al., 1994). The diploid strain
NN61 harboring both srp1-31 and gtr1-11 was sporulated.
Four spores segregated in Tetra type were obtained, plated out
and incubated on YEPD plates at either 14°C or 35°C the
restrictive temperature for srp1-31 (Yano et al., 1994). As
shown in Fig. 3B, gtr1-11 did not suppress srp1-31.
Suppression of mtr1-2 by a partial deletion of GTR1
The GTR1 gene has been shown not to be essential for growth,
while its deletion makes yeast cold-sensitive (Bun-ya et al.,
1992). In order to examine whether the suppression of both
mtr1-2 and rna1-1 by gtr1-11 is allele specific or not, the GTR1
gene from the T18 strain (mtr1-2) was deleted either partly or
completely using the previously reported plasmids, pMB130
and pAC609 (Bun-ya et al., 1992), respectively. Upon deletion
of the whole of GTR1, we could not see any clear suppression
of mtr1-2. However, a weak but significant suppression of
mtr1-2 was observed by partial deletion of GTR1 (Fig. 4) in
which one third of the gene was deleted in the C terminus
(Bun-ya et al., 1992). Thus, suppression of mtr1-2 is not
specific to the allele of gtr1-11, while the ability of a deletion
mutant to suppress mtr1-2 is weaker than that of gtr1-11.
Suppression of S. cerevisiae rcc1 by
overexpression of Gtr1-11p
The finding that a partial, but not total, deletion of the GTR1
gene suppressed mtr1-2 may indicate that the presence of
mutated or deleted Gtr1p is important for suppressing mtr1-2.
If this is true, overexpression of the mutated Gtr1p, Gtr1-11p,
may suppress mtr1-2 even though gtr1-11 was recessive, as
shown in Fig. 1B. In order to address this issue, gtr1-11 was
cloned by the eviction method (Winston et al., 1983) as
described in Materials and Methods, and introduced into the
YEplac195 plasmid (Gietz and Sugino, 1988). The resulting
plasmid, pL64, containing 2µURA3 gtr1-11 and the controls
pL63, containing 2µURA3, GTR1 and the vector alone, were
introduced into mtr1-2, srm1-1 and prp20-1, and the resulting
Gtr1p and RanGTPase 2315
Fig. 2. gtr1-11 suppressed both srm1-1 and prp20-1. Upper panel:
indicated segregants NN22-4c (mtr1-2 gtr1-11) and NN22-4a (srm11) of diploid NN22 were plated and incubated either at 14°C or at
32°C on YEPD plates as indicated. Lower panel: indicated
segregants NN23-7a (prp20-1 gtr1-11) and NN23-7d (prp20-1) of
diploid NN23 were plated and incubated either at 14°C or at 33°C on
YEPD plates as indicated.
transformants were plated and incubated on YEPD medium at
the critical temperature to restrict the growth of each allele. In
all rcc1 examined, a weak, but significant recovery of growth
was observed. A representative result for prp20-1 is shown in
Fig. 5. Thus, the gtr1-11 on the multicopy vector has a negative
dominant effect on rcc1.
Cellular location of Gtr1p
Next, we investigated the cellular localization of Gtr1p in S.
cerevisiae. To do that, the open-reading frame of GTR1 fused
with the HA antigen was engineered as described in Materials
and Methods and integrated into the downstream site of the
galactose inducible promoter in pL78 (Table 2). Transformants
of the strain NBW5∆GTR harboring pL78 could not grow at
14°C in glucose medium but normally grow in galactose
medium, proving that the recombinant Gtr1p fused with HA is
functional (data not shown). After growing in glucose medium
at 30°C, half of the cultures were incubated in galactose
medium. Cells grown in either glucose or galactose medium
for 12 hours were stained with the monoclonal antibody to HA,
as described in Materials and Methods. After galactose
induction, the anti-HA antibody stained the cytoplasm clearly
and the nucleus faintly. In contrast, there was no significant
staining of cells cultured in glucose medium (Fig. 6).
Fig. 3. gtr1-11 suppressed rna1-1, but not srp1-31. (A) Four
segregants from the identical ascus of diploid NN39 conjugated
between gtr1-11 and rna1-1 were incubated either at 14°C or at
33°C. (B) Four segregants from the identical ascus of diploid NN61
conjugated between gtr1-11 and srp1-31 were incubated either at
14°C or at 35°C on YEPD plates.
DISCUSSION
Homologues of RCC1 have a common repeated motif which
is responsible for in vivo RCC1 function (Dasso, 1993). The
mutations of S. cerevisiae RCC1 homologue that have been
mapped so far are located in the second and the last two repeats
Fig. 4. A partial deletion of the GTR1 gene suppressed mtr1-2.
Haploid strains T18∆GTR1/3 (mtr1-2 gtr1-3∆), T18-5c (mtr1-2 gtr111) and T18 (mtr1-2) were incubated on YEPD plates either at 14°C
or at 30°C as indicated. gtr1-3∆ encodes a deleted Gtr1p (Bun-ya et
al., 1992).
2316 N. Nakashima and others
Fig. 5. Overexpression of gtr1-11 suppressed prp20-1. Haploid strain
prp20/2c (prp20-1) harboring pL64: 2µURA3 gtr1-11 or pL63:
2µURA3 GTR1 or vector alone were incubated either at 26°C or at
30°C on synthetic ura− medium as indicated.
of this motif (Kadowaki et al., 1993; Lee et al., 1994). The Cterminal, but not the N-terminal rcc1 can be suppressed by
overexpression of Gsp1p. On the other hand, the recently
isolated suppressor mutation of srm1-1, that is, ded1-21, which
is a cold-sensitive mutation of the DED1 encoding a putative
ATP-dependent RNA helicase (Schmid and Linder, 1992) suppresses the N-terminal, but not the C-terminal rcc1 (Hayashi
et al., 1996). In this paper we have identified the third suppressor of S. cerevisiae rcc1, gtr1-11, which suppresses both
N-terminal and C-terminal rcc1, in addition to rna1, but not
srp1.
The allele-specific suppression of S. cerevisiae rcc1 suggests
that RCC1 has two functional domains within the repeated
region. In agreement with this assumption, the steady-state
kinetics analysis of alanine-replaced RCC1 mutants indicates
that the two ends of the RCC1 repeated domain are functionally different (Azuma et al., 1996). The finding that the gtr111 mutation that suppresses rcc1 maps in either the N terminus
or the C terminus of the repeat therefore indicates that gtr1-11
is a general suppressor of the Ran pathway. In accordance with
this notion, the ts mutant of the RanGAP homologue, rna1-1,
was also suppressed by gtr1-11, although it remains to be
examined whether the suppression of rna1-1 by gtr1-11 is
specific to this allele of rna1.
Srp1p is located at the periphery of the nucleus and is
involved in multiple cellular functions such as microtubulerelated functions, nucleolar structure maintenance, nuclear
pore function and RNA polymerase I function (Yano et al.,
1994). Genetically SRP1 has been reported to interact with a
wide variety of other nuclear genes (Yano et al., 1994;
Belanger et al., 1994). Such diverse interactions of SRP1 are
assumed to reflect the presence of multiple systems that utilize
Srp1p and control the organization of nuclear structures and
functions, or nuclear pore transport function. Based on these
previous reports, we chose a ts mutant of SRP1, in order to
examine the possibility that gtr1-11 is a general suppressor of
defects in the nuclear pore transport function in which the Ran
pathway is involved. While we could not exclude the possibility of an allele-specific result, the inability of gtr1-11 to
Fig. 6. Localization of Gtr1p in S. cerevisiae. NBW5∆GTR strains
(gtr1-1∆ ade2 ura3-1,2 his3-532, leu2-3,112 trp1-289 can1)/pL78
(URA3 GAL1-GTR1HA) were grown at 30°C either in the presence of
either glucose (A,C) or galactose (B,D) for 12 hours. In A and B,
cells were stained by the monoclonal antibody 12CA5 and FITC. In
C and D, cells were stained by Hoechst 33342.
suppress srp1-31 indicates that the GTR1-pathway has no
functional relationship to Srp1p function.
RCC1 and Rna1p function on Ran as GEF and RanGAP,
respectively. Both proteins, therefore, control the Ran pathway
in an opposite manner. Since GEF and GAP are the main regulators of the Ras family (Boguski and McCormick, 1993), the
fact that defects in both proteins are suppressed by the coldsensitive mutation of GTR1, gtr1-11, indicates that Gtr1p
controls the Ran pathway, probably as a negative regulator,
since gtr1-11 is recessive and a partial deletion of GTR1 suppresses rcc1. Loss of GTR1-function may enhance the nuclear
pore transport that was retarded by mutations in the Ran
pathway. However, this idea cannot apply to the case of srm11, which did not cause any defect in export of poly(A)+ RNA
(Kadowaki et al., 1993). Moreover, there was no suppression
of srp1-31 by gtr1-11.
Gtr1p possesses the characteristic tripartite consensus
elements for binding GTP that are conserved in GTP-binding
proteins in the N-terminal region, together with a long C
terminus. It is notable that Gtr1p does not contain lipid modification motifs at the C terminus, similar to Ran. In this context,
both Ran and Gtr1p may function in a similar manner, that is,
they interact with their related proteins in homogeneous
solution. E. coli-produced Gtr1p bound to GTP in a one to one
molar ratio, although it did not bind to GDP (N. Nakashima,
unpublished), indicating that Gtr1p does not function like a real
G protein. Since the complete deletion of Gtr1p did not
suppress mtr1-2, a simple inactivation of the Gtr1p pathway
does not suppress rcc1. On the other hand, overexpression of
Gtr1-11p suppressed the rcc1 weakly but significantly. Considering these findings together, the presence of mutated or
partly deleted Gtr1p proteins is important for rescuing defects
in the Ran pathway. Probably, overproduced Gtr1-11p titrated
out some factors which function against the Ran/TC4 GTPase
cycle.
Recently, mammalian RagA and RagB genes encoding a
protein homologous to Gtr1p have been cloned (Schürmann et
al., 1995). Rat RagA/B is 52% identical to Gtr1p. Rat RagA/B
and Gtr1p are very similar in the N-terminal half which
Gtr1p and RanGTPase 2317
comprises the domains responsible for GTP-binding, suggesting that both proteins function as a G protein in a similar way.
Thus, the Gtr1p pathway is well conserved through evolution,
indicating that Gtr1p plays some important role for cells, with
regard to the Ran pathway.
We thank Drs T. Kadowaki and A. M. Tartakoff (Case Western
Reserve University) for T14 and T18 strains; M. Nomura (University
of California) for S. cerevisiae strains (srp1-31); Y. Oshima and S.
Harashima (Osaka University) for GTR1 plasmids; A. Toh-e (Tokyo
University) for the rna1-1 strain; K. Matsumoto (Nagoya University)
for the genomic library of S. cerevisiae; B. Futcher (Cold Spring
Harbor Laboratory) for pBluescript HA; H. Shiomi (University of
Pennsylvania) for the anti-HA antibody; and the Human Genomic
Center for supplying the sequence data. This work was supported by
Grants-in-Aid for Scientific Research and for Cancer Research from
the Ministry of Education, Science and Culture of Japan, and by the
HFSP. The English used in this manuscript was revised by Miss K.
Miller (Royal English Language Centre, Fukuoka, Japan).
REFERENCES
Aebi, M., Clark, M. W., Vijayraghavan, U. and Abelson, J. (1990). A yeast
mutant, PRP20, altered in mRNA metabolism and maintenance of the
nuclear structure, is defective in a gene homologous to the human gene RCC1
which is involved in the control of chromosome condensation. Mol. Gen.
Genet. 224, 72-80
Amberg, D. C., Fleischmann, M., Stagljar, I., Cole, C. N. and Aebi, M.
(1993). Nuclear PRP20 protein is required for mRNA export. EMBO J. 12,
233-241.
Azuma, Y., Seino, H., Seki, T., Uzawa, S., Klebe, C., Ohba, T.,
Wittinghofer, A., Hayashi, N. and Nishimoto, T. (1996). Conserved
histidine residues of RCC1 are essential for nucleotide exchange on Ran. J.
Biochem. 120, 82-91.
Becker, J., Melchior, F., Gerke, V., Bischoff, F. R., Ponstingl, H. and
Wittinghofer, A. (1995). RNA1 encodes a GTPase-activating protein
specific for Gsp1, the Ran/TC4 homologue of Saccharomyces cerevisiae. J.
Biol. Chem. 270, 11860-11865.
Belanger, K. D., Kenna, M. A., Wei, S. and Davis, L. (1994). Genetic and
physical interactions between Srp1p and nuclear pore complex proteins
Nup1p and Nup2p. J. Cell Biol. 126, 619-630.
Belhumeur, P., Lee, A., Tam, R., D’Paolo, T., Fortin, N. and Clark, M. W.
(1993). GSP1 and GSP2, genetic supressors of prp20-1 mutant in
Saccharomyces cerevisiae: GTP-binding proteins involved in the
maintenance of nuclear organization. Mol. Cell. Biol. 13, 2152-2161.
Benes, V., Hostomsky, Z., Arnold, L. and Paces, V. (1993). M13 and pUC
vectors with new unique restriction sites for cloning. Gene 130, 151-152.
Bischoff, F. R. and Ponstingl, H. (1991a). Catalysis of guanine nucleotide
exchange on Ran by the mitotic regulator RCC1. Nature 354, 80-82.
Bischoff, F. R. and Ponstingl, H. (1991b). Mitotic regulator protein RCC1 is
complexed with a nuclear ras-related polypeptide. Proc. Nat. Acad. Sci. USA
88, 10830-10834.
Bischoff, F. R., Klebe, C., Kretschmer, J., Wittinghofer, A. and Ponstingl,
H. (1994). RanGAP1 induces GTPase activity of nuclear Ras-related Ran.
Proc. Nat. Acad. Sci. USA 91, 2587-2591.
Bischoff, F. R., Krebber, H., Kempf, T., Hermes, I. and Ponstingl, H.
(1995). Human RanGTPase-activating protein RanGAP1 is a homologue of
yeast Rna1p involved in mRNA processing and transport. Proc. Nat. Acad.
Sci. USA 92, 1749-1753.
Bun-ya, M., Harashima, S. and Oshima, Y. (1992). Putative GTP-binding
protein, Gtr1, associated with the function of the Pho84 inorganic phosphate
transporter in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 2958-2966.
Boguski, M. and McCormick, F. (1993). Proteins regulating Ras and its
relatives. Nature 366, 643-653.
Clark, K. L. and Sprague, G. F. Jr (1989). Yeast pheromone response
pathway: Characterization of a suppressor that restores mating to receptor
less mutants. Mol. Cell. Biol. 9, 2682-2694.
Corbett, A. H., Koepp, D. M., Schlenstedt, G., Lee, M. S., Hopper, A. K.
and Silver, P. A. (1995). Rna1p, a Ran/TC4 GTPase activating protein, is
required for nuclear import. J. Cell Biol. 130, 1017-1026.
Dasso, M., Nishitani, H., Kornbluth, S., Nishimoto, T. and Newport, J.
(1992). RCC1, a regulator of mitosis, is essential for DNA replication. Mol.
Cell. Biol. 12, 3337-3345.
Dasso, M. (1993). RCC1 in the cell cycle: The regulator of chromosome
condensation takes on new roles. Trends Biochem. Sci. 16, 96-101.
Drivas, G. T., Shih, A., Coutavas, E., Rush, M. G. and D’Eustachio, P.
(1990). Characterization of four novel RAS-related genes expressed in a
human teratocarcinoma cell line. Mol. Cell. Biol. 10, 1793-1798.
Frasch, M. (1991). The maternally expressed Drosophila gene encoding the
chromatin-binding protein BJ1 is a homologue of the vertebrate gene
regulator of chromosome condensation, RCC1. EMBO J. 10, 1225-1236.
Gietz, R. D. and Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors
constructed with in vitro mutagenized yeast genes lacking six-base pair
restriction sites. Gene 74, 527-534.
Hagan, I. M. and Hyams, J. S. (1988). The use of cell division cycle mutants
to investigate the control of microtubule distribution in fission yeast
Schizosaccharomyces pombe. J. Cell Sci. 89, 343-357.
Hayashi, N., Yokoyama, N., Seki, T., Azuma, Y., Ohba, T. and Nishimoto,
T. (1995). RanBP1, a Ras-like nuclear G-protein binding to Ran/TC4,
inhibits RCC1 via Ran/TC4. Mol. Gen. Genet. 247, 661-669.
Hayashi, N., Seino, H., Irie, K., Watanabe, M., Clark, K. L., Matsumoto, K.
and Nishimoto, T. (1996). Genetical interaction of DED1 encoding a
putative ATP-dependent RNA helicase with SRM1 encoding a mammalian
RCC1 homologue in Saccharomyces cerevisiae. Mol. Gen. Genet. (in press).
Ichihara, Y. and Kurosawa, Y. (1993). Construction of new T vectors for
direct cloning of PCR products. Gene 130, 153-154.
Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983). Transformation of
intact S. cerevisiae cells treated with alkali cations. J. Bacteriol. 153, 163168.
Kadowaki, T., Goldfarb, D., Spitz, L. M., Tartakoff, A. M. and Ohno, M.
(1993). Regulation of RNA processing and transport by a nuclear guanine
nucleotide release protein and members of the Ras superfamily. EMBO J. 12,
2929-2937.
Klebe, C., Prinz, H., Wittinghofer, A. and Goody, R. S. (1995). The kinetics
mechanism of Ran-nucleotide exchange catalyzed by RCC1. Biochemistry
34, 12543-12552.
Lee, A., Tam, R., Belhumeur, P., Dipaolo, T. and Clark, M. W. (1993).
Prp20, the Saccharomyces cerevisiae homolog of the regulator of
chromosome condensation, RCC1, interacts with double-stranded DNA
through a multi-component complex containing GTP-binding protein. J. Cell
Sci. 106, 287-298.
Lee, A., Clark, K. L., Fleischmann, M., Aebi, M. and Clark, M. W. (1994).
Site-directed mutagenesis of the yeast PRP20/SRM1 gene reveals distinct
activity domains in the protein product. Mol. Gen. Genet. 245, 32-44.
Loeb, J. D. J., Schlenstedt, G., Pellman, D., Kornitzer, D., Silver, P. A. and
Fink, G. R. (1995). The yeast nuclear import receptor is required for mitosis.
Proc. Nat. Acad. Sci. USA 92, 7647-7651.
Matsumoto, T. and Beach, D. (1991). Premature initiation of mitosis in yeast
lacking RCC1 or an interacting GTPase. Cell 66, 347-360.
Melchior, F., Paschal, B., Evans, J. and Gerace, L. (1993). Inhibition of
nuclear protein import by nonhydrolyzable analogues of GTP and
identification of the small GTPase Ran/TC4 as an essential transport factor.
J. Cell Biol. 123, 1649-1659.
Melchior, F. and Gerace, L. (1995). Mechanisms of nuclear protein import.
Curr. Opin. Cell Biol. 7, 310-318.
Melchior, F., Guan, T., Yokoyama, N., Nishimoto, T. and Gerace, L.
(1995). Hydrolysis of GTP by Ran is an early step of nuclear protein import
that occurs at the cytoplasmic periphery of the nuclear pore complex. J. Cell
Biol. 131, 571-581.
Moore, M. S. and Blobel, G. (1993). The GTP-binding protein Ran/TC4 is
required for protein import into the nucleus. Nature 365, 661-663.
Nishitani, H., Ohtsubo, M., Yamashita, K., Iida, H., Pines, J., Yasuda, H.,
Shibata, Y., Hunter, T. and Nishimoto, T. (1991). Loss of RCC1, a
nuclear DNA-binding protein, uncouples the completion of DNA
replication from the activation of cdc2 protein kinase and mitosis. EMBO J.
10, 1555-1564.
Nishiwaki, H., Hayashi, N., Irie, S., Chung, D.-H., Harashima, S. and
Oshima, Y. (1987). Structure of the yeast HIS5 gene responsive to general
control of amino acid biosynthesis. Mol. Gen. Genet. 208, 159-167.
Ninomiya-Tsuji, Nomoto, S., Yasuda, H., Reed, S. I. and Matsumoto, K.
(1991). Cloning of a human cDNA encoding a CDC2-related kinase by
complementation of a budding yeast cdc28 mutation. Proc. Nat. Acad. Sci.
USA 80, 4949-4953.
Parent, S. A., Fenimore, C. M., Bostian, K. (1985). Vector systems for the
2318 N. Nakashima and others
expression, analysis and cloning of DNA sequences in S. cerevisiae. Yeast 1,
83-138.
Ren, M., Drivas, G., D’Eustachio, P. and Rush, M. G. (1993). Ran/TC4: a
small nuclear GTP-binding protein that regulates DNA synthesis. J. Cell
Biol. 120, 313-323.
Rexach, M. and Blobel, G. (1996). Protein import into nuclei: association and
dissociation reactions involving transport substrate, transport factors, and
nucleoporins. Cell 83, 683-692.
Sazer, S. and Nurse, P. (1994). A fission yeast RCC1-related protein is
required for the mitosis to interphase transition. EMBO J. 13, 606-615.
Seino, H., Hisamoto, N., Uzawa, S., Sekiguchi, T. and Nishimoto, T. (1992).
DNA-binding domain of RCC1 protein is not essential for coupling mitosis
with DNA replication. J. Cell Sci. 102, 393-400.
Schmid, S. R. and Linder, P. (1992). D-E-A-D protein family of putative
RNA helicases. Mol. Microbiol. 6, 283-292.
Sherman, F., Fink, G. R. and Hicks, J. B. (1982). Methods in S. cerevisiae
Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Schürmann, A., Brauers, A., Maßmann, S., Becker, W. and Joost, H.-G.
(1995). Cloning of a novel family of mammalian GTP-binding proteins
(RagA, RagBs, RagB1) with remote similarity to the Ras-related GTPase. J.
Biol. Chem. 270, 28982-28988.
Tachibana, T., Imamoto, N., Seino, H., Nishimoto, T. and Yoneda, Y.
(1994). Loss of RCC1 leads to suppression of nuclear protein import in living
cells. J. Biol. Chem. 269, 24542-24545.
Tyers, M., Tokiwa, G., Nash, R. and Futcher, B. (1992). The Cln3-Cdc28
kinase complex of S. cerevisiae is regulated by proteolysis and
phosphorylation. EMBO J. 11, 1773-1784.
Uchida, S., Sekiguchi, T., Nishitani, H., Miyauchi, K., Ohtsubo, M. and
Nishimoto, T. (1990). Premature chromosome condensation is induced by a
point mutation in the hamster RCC1 gene. Mol. Cell. Biol. 10, 577-584.
Winston, F., Chumley, F. and Fink, G. R. (1983). Eviction and
transplacement of mutant genes in yeast. Meth. Enzymol. 101, 211-228.
Yano, R., Oakes, M. L., Tabb, M. M. and Nomura, M. (1994). Yeast Srp1p
has homology to armadillo/plakoglobin/β-catenin and participates in
apparently multiple nuclear functions including the maintenance of the
nucleolar structure. Proc. Nat. Acad. Sci. USA 91, 6880-6884.
(Received 10 April 1996 – Accepted 26 June 1996)