* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download tacttgaaagttcaccggagg
Ancestral sequence reconstruction wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Community fingerprinting wikipedia , lookup
Polyadenylation wikipedia , lookup
Molecular cloning wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Peptide synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Bottromycin wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Protein adsorption wikipedia , lookup
Non-coding RNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Proteolysis wikipedia , lookup
List of types of proteins wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Molecular evolution wikipedia , lookup
Protein structure prediction wikipedia , lookup
Gene expression wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transfer RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Epitranscriptome wikipedia , lookup
39 DNA and Translation Biology B Pages 235-241 Name: ________________________ Date: __________ Period: ________ As we mentioned before, the ultimate goal of a gene on a chromosome is gene expression. Gene expression is ultimately the production of a protein product. That is for us to see what a gene does – it MUST produce a protein molecule! We have discovered that to create a protein product a small portion of the DNA must be transcribed (or copied). The copy of the DNA is called a messenger RNA and is abbreviated, mRNA. Transcription takes place in the nucleus. The mRNA that is produced in the nucleus moves to the cytoplasm. (See picture below:) At this point, the process is now called translation. That is, we are now translating the message (the mRNA is the message from the DNA) into a protein molecule. In the cytoplasm, the mRNA must bind to a ribosome. If you remember, ribosomes are cell Cytoplasm organelles that help protein production. Another kind of RNA then comes into play. Transfer RNA (or tRNA see * in picture to right) has a * specific amino acid attached to it (represented by a small black dot). When the mRNA binds to the ribosome, special tRNA’s move to the mRNA/ribosomematch their “anticodon” to the codon of the mRNA and begin forming protein molecules (see pages 240-241) and/or above picture. To help explain how the sequences of the DNA help direct this process, we have to explain some basics. The nucleotide sequences in DNA code for specific amino acids. Page 2 (Cont. #39 Bio. B) The code is broken down into three nucleotide sequences in a row and are called codons. Specific codons (that is specific three nucleotide sequences) code for a certain amino acid. Of the following DNA sequence, the codons are labeled. Double stranded DNA T Single stranded DNA template T A C T T G G C A T A G Double stranded DNA A-T G-C C-G T-A T-A A U G A A C C G U A U C C A codon codon codon codon G G-C G-C T-A A-T C-G A T G A A C C G T A T C Page 3 (Cont. #39 Bio. B) Why are there three nucleotides to a codon? Well, one possible answer is simple math. There are twenty different amino acids that the body uses to make proteins. If we needed a unique way to determine which amino acid we wanted in a protein, we would use one, two, three, or more nucleotides in a row to “code” for a specific amino acid. 1.) If we only used one nucleotide to code for a specific amino acid, we could only code for a maximum of FOUR unique amino acids. 2.) If we used two nucleotides to code for a specific amino acid, we could only code for 16 different amino acids. (Not enough combinations to code for 20 different amino acids.) 3.) If we used three nucleotides in a row to code for a specific amino acid, we could code for 64 different amino acids! This would satisfy the need to have a specific code for 20 different amino acids AND code for “STOP” sequences. What scientists discovered was that three nucleotides in a row was the precise number needed to “code” for a specific amino acid. Scientists also discovered that the three nucleotide “code” is universal. What this means is that the 3 nucleotide sequence in human cells that codes for a particular amino acid called Glycine, is the SAME nucleotide sequence in bacteria cells that codes for Glycine. Each tRNA holds only one amino acid. The amino acid that tRNA carries depends on the anti-codon found on one part of the tRNA molecule. (see picture on page 240 and to the right:) As you can see to the right, the tRNA has an amino acid (a.a.) attached to it and the anticodon matches up with the codon on the mRNA and this continues until the mRNA has a STOP codon. This sequence stops protein synthesis. SO- the mRNA sequence controls which amino acids are going to be put together and in what order. Remember, the mRNA sequence was originally determined by the original sequence in the DNA. Answer the following questions here and on your scan-tron. _____ 1.) (T,F) All living cells make proteins. Page 4 (Cont. Handout #39 Bio. B) _____ 2.) Where does transcription take place? a.) in the nucleus b.) in the cytoplasm c.) outside the cell _____ 3.) When the DNA is “transcribed” during protein synthesis, what is really happening is… a.) DNA is making a copy of itself in preparation for mitosis b.) DNA is making a copy of itself by making an mRNA molecule c.) DNA is being broken down d.) DNA is making sugar molecules directly _____ 4.) When the mRNA leaves the nucleus, the proteins synthesis process is now called? a.) transcription b.) transceiver c.) translation d.) transportation _____ 5.) In the cytoplasm, the mRNA binds to: a.) the newly formed protein only b.) the ribosome c.) the mitochondria d.) the Golgi body _____ 6.) Where are the proteins assembled in the cytoplasm (see picturepg. 1 of handout) a.) in the nucleus b.) in the mitochondria c.) on the ribosome _____ 7.) What is a codon? a.) a two nucleotide sequence that codes for a specific amino acid b.) a three nucleotide sequence that codes for a specific amino acid c.) a four nucleotide sequence that codes for a specific amino acid d.) none of the above are correct _____ 8.) What molecule moves (transfers) the amino acid to the ribosome? a.) mRNA b.) DNA c.) tRNA d.) ribosome (rRNA) _____ 9.) What part of the tRNA binds to the mRNA? a.) anti-codon b.) codon c.) amino acid d.) DNA _____ 10.) How does the mRNA and tRNA know when to stop making protein? a.) when cell runs out of amino acids b.) when the tRNA hits a stop codon c.) when cell runs out of DNA d.) when cell runs out of protein Page 5 (Cont. Handout #39 Bio. B) Answer to the following question on this handout ONLY! The first codon (the first three nucleotides) is done for you… 11.) Given the following DNA sequence, show what the mRNA sequence SHOULD look like: Circle EACH codon on the mRNA! T-A-C-T-T-G-A-A-A-G-T-T-C-A-C-C-G-G-A-G-G A-U-G- Date: ____________________ Lesson Plan for Handout #39 Biology B Objective: TLWD ability to explain what happens to the mRNA once it leaves the nucleus and what the process is now called. Moreover the student will be able to explain what is located on the tRNA and how and where proteins are formed when given handout #39. Content: Translation, protein production NJCCCS: 5.3.12.E.1. Method: Power point, white board, discussion Homework: Handout #39 Comments: Try explaining transcription as the same as asking them to look something up on the Internet and copying a portion to help you create a portfolio? (Something like that- see if you can get the point across.)