Download Supplementary Materials and Methods

Morozov et al.
Regulation of c-met expression by Daxx
Supplementary Materials and Methods
DNA Constructs
Mouse c-met promoter sequence and series of deletion variants were generated by
PCR. PCR products were cloned into the pGL3-basic vector (Promega, Madison, WI)
upstream of the firefly luciferase reporter gene. The c-met promoter was amplified from
MPEF DNA using GC-Rich PCR System (Roche Diagnostics, Indianapolis, IN) and
cloned into pBluescript (Stratagene, La Jolla, CA) using following primers:
TGAGGAGTGGTGAGGTAAACCG
(-1307),
TTCAGACCATCCCAGAAACACC
(+538). PCR cycling condition were as follow: 95˚C, 2 min; 95˚C, 30 sec; 57˚C, 30 sec;
72˚C, 2.5 min for 35 cycles, final extension 72˚C, 5 min. Series of deletions from the 5’end
of
c-met
promoter
were
generated
by
PCR
using
primers:
TAACCAGAAGCCTCCCCTGG (-810), GGAGGAAGAGAAAGCGCATAGC (-474),
CCAGGAGGGACCGTTGGG
CAGGGCGCGTGTGGGAAG
(-278),
(-142),
TCTCTTCGCCTCCAGCCC
(-206),
ACCCTGTGCGGAGCCAGATG
(-32),
TTCAGACCATCCCAGAAACACC (+538). The number after the primer sequence
corresponds to nucleotide position of 5-end of the primer relative to the transcription start
site. PCR products were cloned into the pGL3-basic vector (Promega, Madison, WI)
upstream of the firefly luciferase reporter gene.
Luciferase reporter assay
Two Daxx+/+ and two Daxx-/- MPEF cell lines were co-transfected with pGL3
bearing c-met promoter deletion series and pRL plasmide (Promega, Madison, WI) that
1
Morozov et al.
Regulation of c-met expression by Daxx
expresses Renilla luciferase driven by SV-40 promoter (internal control) using
Lipofectamine 2000 reagent (Invitrogen Corporation, Carlsbad, CA). Cells were
incubated for 24h, and processed for dual luciferase assay according to the manufactures
instructions (Promega, Madison, WI). All experiments were set up in triplicates and
repeated three times to assure reproducibility. c-met promoter activity was normalized by
the level of Renilla luciferase activity. De-repression was calculated as a quotient of
relative luciferase activity between Daxx-/- and Daxx+/+ cells.
CpG methylation analysis
Bisulfite based cytosine methylation analysis was done according to (Olek et al.,
1996). Briefly, genomic DNA was digested with EcoRI, and denaturated in 0.3 M NaOH
for 15 min at 50˚C. The DNA solution was mixed 1:2 v/v with 2% low melting agarose.
To form agarose beads, 10 mkl aliquots of DNA/agarose (50-200 ng DNA) mixture were
pipetted into cold mineral oil. 100 mkl of modifying solution (5M sodium bisulfite, 100
mM hydroquinone) were added to each reaction tube containing a single DNA/agarose
bead under mineral oil. The reaction mixtures were then incubated for 4 h at 50˚C in the
dark. The DNA/agarose beads were washed 6 times for 15 min with 1 ml of T The
reaction was stopped by addition of 100 mkl of 1 M HCl; the beads were washed once
with TE, two times with water and used directly in PCR. E pH 8.0.
Primers for bisulfite sequencing PCR were designed using MethPrimer software
(Li & Dahiya, 2002), http://www.urogene.org/methprimer/). The following primers were
used:
for
CpG1
CpG1f
TGTAAAATGAAATTATTGGGATAATT,
TCCAATTCTAAAATCTAAAACCAAC;
for
TTTTAAGGGTGGTGTTAGTTTTT, CpG2r
2
CpG2
CpG1r
CpG2f
TAACCAATTCCCTTAATAAAACA.
Morozov et al.
Regulation of c-met expression by Daxx
PCR cycling condition were as follow: 94˚C, 2 min; 94˚C, 30 sec; 50˚C, 30 sec; 72˚C, 50
sec for 38 cycles, and final extension for 5 min, 72˚C. PCR products were cloned into
pGEM-T vector (Promega, Madison, WI) and sequences of 8 clones from each cell lines
were analyzed.
Migration assay
Migration of Daxx+/+ and Daxx-/- cells was assayed using 24-well tissue culture
plate inserts with 8-mkm-pore filter (BD Biosciences, Bedford, MA). 105 cells were
added to the insert. To induce cell migration, 30 ng/ml of HGF was added to the lower
chamber. To study the effects of c-met inhibition on cell migration, K252a was added at
50 nM of final concentration.
Matrigel Invasion Assay
BioCoat Matrigel (BD Biosciences, Bedford, MA) that reconstitutes the basal
membrane was used to determine cell invasion. 24-well tissue culture plate inserts
coated with Matrigel were re-hydrated for 2 h in 37˚C DMEM. 105 cells were plated on
the insert in 0.5 ml of media and 30 ng/ml HGF was added into the lower chamber. After
incubation for 24 h, non-invading cells were removed from the upper side of the
membrane by scrubbing. Cells at the lower side of membrane were fixed and stained.
Number of invaded cells was counted in 4 randomly selected fields across membrane.
3
Morozov et al.
Regulation of c-met expression by Daxx
Immunohistochemistry
Cancer specimens were obtained from the Molecular Tissue Bank at the UF
Shands Cancer Center. Slides were de-paraffinized with xylene and re-hydrated through
decreasing concentrations of ethanol to water, including an intermediary step to quench
endogenous peroxidase activity (3% hydrogen peroxide in methanol).
Slides were
transferred to 1X TBS (Tris-buffered saline). For heat-induced antigen retrieval, sections
were heated in a water bath at 95°C while submerged in Trilogy buffer (Cell Marque,
Hot Springs, AR) for 25 minutes. Slides were subsequently rinsed in 1XTBS and
incubated with an universal protein blocker Sniper (Biocare Medical, Walnut Creek,
CA), for 15 minutes at room temperature.
Slides were rinsed in 1XTBS and co-
incubated in primary antibodies: monoclonal mouse anti-Daxx 5.14 and polyclonal
rabbit anti-c-met (C-28, Santa Cruz Biotechnology Inc., Santa Cruz, CA) for 1 hour at
RT. Slides were rinsed in 1XTBS followed by application of conjugated secondary
antibody: Mach 2 goat anti-mouse-horse radish peroxidase-conjugated (Biocare
Medical, Walnut Creek, CA) and Mach 2 goat anti-rabbit- alkaline phosphataseconjugated (Biocare Medical, Walnut Creek, CA) for 30 minutes at room temperature.
Detection of Daxx was achieved by incubating slides in 3’3’ diaminobenzidine (Biocare
Medical, Walnut Creek, CA) for 15 minutes at RT. For C-met detection, slides were
rinsed for 5 minutes in water followed by an alkaline phosphatase chromagenic reaction
using Vulcan fast red (VFR) (Biocare Medical, Walnut Creek, CA) for 10 minutes at
room temperature and a re-application of VFR for an additional 10 minutes to enhance
staining.
Slides were counterstained with hematoxylin (Vector Laboratories Inc.,
Burlingame, CA) for 10 seconds and mounted with Cytoseal XYL (Richard-Allen
4
Morozov et al.
Regulation of c-met expression by Daxx
Scientific, Kalamazoo, MI). Positive and negative mouse/rabbit isotype-matching
control antibodies were included with each run. Slides were analyzed using Leica
DM2000 microscope and pictures were taken using Leica DFC480 CCD camera with
Leica FireCam 1.7.1 software. For each specimen, at least one thousand cells were
examined for Daxx and c-met expression, and the number of cells with an evident signal
were recorded and categorized by the intensity of staining (0 for undetectable, 5 for
highest) of Daxx and C-met.
Supplementary references
Li LC and Dahiya R. (2002). MethPrimer: designing primers for methylation PCRs.
Bioinformatics 18: 1427-1431.
Olek A, Oswald J and Walter J. (1996). A modified and improved method for bisulphite
based cytosine methylation analysis. Nucleic Acids Res 24: 5064-5066.
5