* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download PCR APPLICATIONS - University of Cape Town
DNA replication wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA profiling wikipedia , lookup
DNA sequencing wikipedia , lookup
Some applications: • • • • • • • • Specific sequence targeting Fishing for unknown sequences (uncloned) Assembling artificial sequences Site-directed mutagenesis Adding enzyme sites, start and stop codons Detecting clones – colony PCR Detecting mRNA – Reverse transcriptase PCR Assaying copy number – real-time pcr ASSEMBLING ARTIFICIAL SEQUENCE DNA template assembly: 30 - 50 cycles PCR 1 5' 3' 2 3 40-base oligomers 3' 5' add outside primers; gene amplification: 25 cycles PCR clone into sequencing vector 40-base oligomers 40 1 60 20 20 20 80 2 add outside primers; gene amplification SITE-DIRECTED MUTAGENESIS A .… ACTTGCAAATTGGTCGATCG…3’ T …..TGAACGTTTAACCAGCTAGG…5’ A 5’ – ACTTGCAAATTATCGATCG- 3’ SIGNAL OR RESTRICTION SITE ADDITION Hind III start 5’ - NNAAGCTTNNATGACTTGCAAATTGG – 3’ …..… ACTTGCAAATTGGTCGATCG… COLONY PCR No need to extract DNA from bacteria Reverse Transcription-PCR Amplified copies of specific mRNA (RT-PCR) 1. Extract total RNA 2. Reverse Transcription 3. PCR dNTPs primer Reverse Transcriptase Double stranded “Copy DNA” (PCR template) ASSAYING COPY NUMBER: REAL-TIME PCR Agarose Gel Traditional PCR detection Area for Real-time PCR detection 10 copies 50 copies Problems with traditional end-point detection: Low sensitivity Low resolution Poor precision SYBR Green Dye Assay Binds to any double-stranded DNA - Specific product - Non-specific product - Primer dimers FRET = Fluorescent Resonance Energy Transfer