Download Repression of E-cadherin by the Polycomb Group Protein

Supplementary Information
Repression of E-cadherin by the Polycomb Group Protein EZH2 in
Cancer
Qi Cao, Jindan Yu, Saravana M. Dhanasekaran, Jung H. Kim, Ram-Shankar Mani, Scott
A. Tomlins, Rohit Mehra, Bharathi Laxman, Xuhong Cao, Jianjun Yu, Celina G. Kleer,
Sooryanarayana Varambally and Arul M. Chinnaiyan
Supplementary Method
Bisulfite Modification and Methylation-Specific PCR of CDH1 promoter
H16N2 cells were infected with vector control or EZH2 adenovirus for 48hrs and
genomic DNA was isolated (Qiagen, Valencia, CA). The genomic DNA was modified by
sodium bisulfite treatment using the CpGenomeTM DNA Modification Kit (S7820,
Chemicon, Temecula, CA). The DNA promoter methylation status of E-cadherin gene
was investigated by PCR using primers specific to methylated and unmethylated
promoters using the CpG WIZTM E-cadherin Amplification Kit (S7804, Chemicon). The
methylated and unmethylated control DNA (provided in the S7804 kit, Chemicon) were
also subjected to bisulfite DNA modification and PCR analysis, and serves as positive
controls for methylated and unmethylated DNA respectively. H2O was used as negative
control for the PCR reaction.
Pyrosequencing
Genomic DNA was extracted from cells using DNeasy Blood and tissue kit (Qiagen) and
500ng was bisulfite modified using EZ DNA methylation gold kit according to
manufacturer’s instruction (Zymo research, Orange, CA).
1
PCR amplification was done using 200 ng of bisulfite modified DNA as template, with
forward pimer 5’- ATTTTAGTAATTTTAGGTTAGAGGGTTA -3’ and reverse primer
5’- ACCACAACCAATCAACAAC -3’ which is biotinylated. Bisulfite-modified DNA
was amplified in a 24-µL reaction with the primer set and HotStarTaq DNA Polymerase
system (Qiagen). Samples were heated to 95°C for 15 min and then amplified for 45
cycles consisting of 95°C for 20 s, 52°C for 20 s, and 72°C for 20 s, followed by a final
extension step at 72°C for 10 min. The PCR product is prepared for pyrosequencing as
per recommendations given by manufacturer (Biotage, Uppsala, Sweden). Briefly, the
biotinylated strand of the PCR product was captured on streptavidin-coated beads, and
the non-biotinylated DNA strand was removed by denaturation (0.2M NaOH), and
subsequently washed (10mM Tris Acetate pH7.6). The beads attached with singlestranded DNA were transferred to annealing buffer (20mM Tris Acetate pH7.6,
containing 2mM Magnesium acetate tetrahydrate) containing the sequencing primer 5’ATTTTAGGTTAGAGGGTTAT -3’. After primer annealing, the single stranded DNA
was sequenced with PSQ HS 96 MA system (Biotage). The percent methylation has been
represented in the following manner: a complete methylation where the C residue is
preserved the sequence read out shows 100% C/T methylation ratio.
Supplementary Figure Legends
Figure S1. Immunoblot analysis indicates that EZH2 represses E-cadherin protein
expression. (a) Semi quantitative analysis of EZH2 knockdown. Western blots were
scanned and quantified using software Scion Image (Frederick, MD). The relative ratio of
EZH2 and β-tubulin was compared. (b) Benign breast cell line H16N2 overexpressing
2
EZH2, EZH2SET mutant as well as infected with control adenovirus were treated with
different doses of the HDAC inhibitors SAHA and TSA. EZH2 and E-cadherin
expression were examined by immunoblot. Immunoblots were probed with GAPDH as a
loading control.
Figure S2. E-cadherin repression is enhanced with increased EZH2 expression.
Benign breast cell line H16N2 was infected with EZH2 by 0 MOI, 0.1 MOI, 1 MOI, 10
MOI, 100MOI or 1000MOI. EZH2 and E-cadherin level were examined by immunoblot.
β-tubulin was included as a loading control.
Figure S3. E-boxes at the E-cadherin promoter are necessary for EZH2 mediated
repression. (a) Stable EZH2 knockdown DU145 cells were transfected with E-cadherin
promoter-luciferase construct and pRL-TK. E-cadherin promoter activity was
significantly increased in EZH2 stable knock-down cells as compared to control cells.
The p value was calculated between EZH2 shRNA and vector control cells. (b) Benign
breast cell line HME was transfected with wild type and mutant E-cadherin promoter
luciferase constructs and infected with either EZH2, EZH2SET or control adenovirus.
EZH2 infected cells were also incubated with 500nM SAHA. Relative luciferase activity
(RLA) was assessed.
Figure S4. PRC2 localizes at the E-cadherin promoter. (a) Endogenous EZH2 and
HDAC1 interact with PRC2 protein EED in DU145 cells. Immunoprecipitation was
carried out using monoclonal anti-EZH2 and anti-HDAC1 antibodies. Western blotting
performed with either anti-EZH2, HDAC1 or EED antibody indicates that both EZH2
and HDAC1 interact with EED. Normal mouse IgG was used as negative control. (b)
HDAC inhibitor SAHA does not alter the expression of EZH2, EED or HDAC1. DU145
3
cells were treated by 500 nM SAHA or vehicle for 48 hours. EZH2, EED and HDAC1
were examined by immunoblot. (c) Endogenous HDAC1 is recruited to the E-cadherin
promoter. ChIP was carried out using antibodies against HDAC1 and IgG control using
DU145 cell line. Addition of 500nM SAHA curtails the recruitment of HDAC1 to the Ecadherin promoter. (d) Ectopically expressed EZH2 recruits PRC2 complex proteins to
the E-cadherin promoter. ChIP was carried out using H16N2 cells infected with EZH2 or
control adenovirus. (e) The E-cadherin promoter is trimethylated at histone H3-Lys27 in
metastatic prostate cancer tissues. ChIP experiments were performed using anti3mH3K27 antibody in three independent metastatic prostate tumors. WNT1 is a positive
control and NUP214 is a negative control. ChIP products were first amplified through
ligation-mediated PCR. Equal amounts (50ng) of ChIP DNA and the input DNA were
then subjected to PCR and enrichment by ChIP was assessed relative to the input DNA.
Figure S5. EZH2 overexpression does not induce E-cadherin promoter methylation.
(a) E-cadherin promoter methylation analysis using H16N2 cells overexpressing EZH2 or
control vector. Positive control and negative controls were provided by the manufacturer.
PC, positive control and NC, negative control. Pyrosequencing analysis. (b) DNA
methylation analysis of unmethylated and universally methylated genomic DNA controls.
Sequences highlighted in grey are the PCR primer locations, the CG residue analyzed in
yellow and the sequencing primer is underlined. Percent methylation (yellow bar) or no
methylation (blue bar) in the control samples is displayed. (c) A schematic of human ECadherin promoter CpG island located on chromosome 16 as displayed by UCSC
Genome Browser v1.67. Forward, F and reverse, R primers used for PCR amplification
of the region to be pyrosequenced is indicated by red arrows. The CpG island present in
4
this region as predicted by CpG plot is represented by the green color and first exon of
the E-cadherin gene (CDH1) reference sequence is shown by blue horizontal bars. (d)
DNA sequence of the wild type and bisulfite converted version of the region examined.
The 9 CG residues are highlighted in yellow. (e) Percent methylation observed in PCR
product obtained from various treatment groups (control, 5’AZA, SAHA and
5’AZA+SAHA) of Vector, delta-SET, and EZH2-infected cell line genomic DNA. Each
bar represent a CG residue, yellow indicates methylation and blue no methylation.
5