* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Word file
Survey
Document related concepts
Signal transduction wikipedia , lookup
Magnesium transporter wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Hedgehog signaling pathway wikipedia , lookup
Protein moonlighting wikipedia , lookup
List of types of proteins wikipedia , lookup
Transcript
Supplementary Materials Supplementary Methods RT-PCR. Reverse transcription and PCR amplification were performed with 1g total RNA isolated from the indicated prostate tissues and cell lines. Human EZH2 forward (5'-GCCAGACTGGGAAGAAATCTG-3’), reverse (5’TGTGCTGGAAAATCCAAGTCA-3’) and GAPDH sense (5’CGGAGTCAACGGATTTGGTCGTAT-3’), antisense 5'AGCCTTCTCCATGGTGGTGAAGAC–3’) primers were used. EZH2 Constructs. Myc-tagged EZH2-pCMV was a kind gift of T. Jenuwein. The Myc-EZH2 fragment was sub-cloned into the expression vector pCDNA3 (Invitrogen). An EZH2-ER in-frame fusion expression construct was generated by replacing the FADD fragment of a FADD-ER construct (derived from Myc-ER23, kind gift of G. Evan) with the PCR amplified human EZH2. The EZH2ΔSET mutant DNA was amplified using the primers 5 ‘GGGGTACCATGGGCGGCCGCGAACAAAAGTTGATT 3’ and 5’ GGGGAATTCTCATGCCAGCAATAGATGCTTTTT3’ and subsequently sub-cloned into pCDNA3. Supplementary Figures Supplementary Table 1. SAM analysis of prostate cancer gene expression. SAM analysis was performed by comparing 7 metastatic prostate cancer samples against 10 clinically localized prostate cancer sample 1. Data was normalized per array by multiplication by a factor to adjust the aggregate ratio of medians to one, then log base 2 transformed and median centered. This normalized data was divided into 2 groups for comparison using a two-class, unpaired t-test. Critical values for the analysis include: Iterations = 500, Random Number Seed 1234567, a fold change cutoff of 1.5 and a delta cutoff of 0.985, resulting in a final largest median False Discovery Rate of 0.898 % for the 535 genes selected as significant (55 relatively up and 480 relatively down regulated between MET and PCA). These 535 genes were analyzed using Cluster2 implementing average linkage hierarchical clustering of genes. The output was visualized in Treeview2. The data can be obtained by opening the file labeled: NATdataSet_METvsPCA.htm Supplementary Table 2. SAM analysis of EZH2 differentially regulated genes. EZH2ΔSET mutant expressing samples were compared to EZH2 expressing samples using the SAM analysis package3. Data was pre-processed by multiplication by a normalization factor to adjust the aggregate ratio of medians to one, log base 2 transformed and median centered each array, individually. This pre-processed data was divided into 2 groups for comparison using a two-class, unpaired t-test. Critical values for the analysis include: iterations = 5000, (720 at convergence) random Number Seed 1234567, a fold change of 1.5 and a delta cutoff of 0.45205, resulting in a final largest median False Discovery Rate of 0.45% for the 161 genes selected as significant. The data for figure 4c and figure 4d can be obtained by opening the file labeled EZH_deltaSET_derepressed.htm Supplementary Figure 1. EZH2 and Ki-67 Association Study. Scatter plot of EZH2 versus Ki-67: A significant but weak correlation between Ki-67 proliferation (Ki-67 labeling index) and EZH-2 protein expression for clinically localized prostate cancer is evident. Thirty-five paired cases were used for this analysis (each cases had 5-6 TMA spots analyzed). Table shows the statistical analysis of the EZH2 and Ki-67 labeling. Supplementary Figure 2. EZH2 protein levels are elevated in metastatic prostate cancer independent of metastatic site. a, Tissue microarray analysis of EZH2 expression considered per patient. The mean EZH2 protein expression for the indicated prostate tissues is summarized using error bars with 95% confidence intervals. Number of clinical specimens and associated number of patients are indicated. b. Tissue microarray analysis of EZH2 expression considered based on site of metastsis. The mean EZH2 protein expression for the indicated prostate tissues is summarized using error bars with 95% confidence intervals. Number of clinical specimens and associated number of patients are indicated. Supplementary Figure 3. A model for potential functional interactions of EZH2 as elucidated by transcriptome analysis and placed in the context of previously reported interactions. +, induction. -, repression. The PcG group protein EPC, which is the human homolog of the Drosophila protein Enhancer of Polycomb (E(Pc)) was consistently repressed by EZH2 (Fig. 4c). Of the Drosophila PcG proteins, E(Pc) and E(z) are related in that they both act as suppressors of variegation (Su(var))4,5 and are the only PcG proteins to have yeast homologs, emphasizing the evolutionary conservation of this PcG pair. In addition to EPC, a host of other transcriptional regulators/activators were transcriptionally silenced by EZH2 including MDNA, RNF5, RNF15, ZNF42, ZNF262, ZNFN1A1, RBM5, SPIB, and FOXF2, among others (Fig. 4c). MDNA, also known as myeloid cell nuclear differentiation antigen, is especially interesting as it mediates transcriptional repression by interacting with the transcription factor YY1, which is a PcG homolog of Drosophila Pho and shown to be part of the EZH2/EED complex of proteins 6. In addition to transcriptional repression in prostate cells, our results also support a role for EZH2 in regulating cell growth (Fig. 3). Thus, it is intriguing that we observed transcriptional repression of cdc27 (two independent Unigene clones). Cdc27 is part of the anaphase-promoting complex (APC) which mediates ubiquitination of cyclin B1, resulting in cyclinB/cdk complex degradation7. Another family of proteins that deserve further investigation as EZH2 targets are the solute carriers since at least 5 distinct members were shown to be repressed (i.e., SSLC34A2, SLC25A16, SLC25A6, SLC16A2, and SLC4A3). References 1. 2. 3. 4. 5. 6. 7. Dhanasekaran, S. M. et al. Delineation of prognostic biomarkers in prostate cancer. Nature 412, 822-6. (2001). Eisen, M. B., Spellman, P. T., Brown, P. O. & Botstein, D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 148638 (1998). Tusher, V. G., Tibshirani, R. & Chu, G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-21. (2001). Sinclair, D. A. et al. Enhancer of Polycomb is a suppressor of position-effect variegation in Drosophila melanogaster. Genetics 148, 211-20. (1998). Laible, G. et al. Mammalian homologues of the Polycomb-group gene Enhancer of zeste mediate gene silencing in Drosophila heterochromatin and at S. cerevisiae telomeres. Embo J 16, 3219-32. (1997). Satijn, D. P., Hamer, K. M., den Blaauwen, J. & Otte, A. P. The polycomb group protein EED interacts with YY1, and both proteins induce neural tissue in Xenopus embryos. Mol Cell Biol 21, 1360-9. (2001). Jorgensen, P. M., Brundell, E., Starborg, M. & Hoog, C. A subunit of the anaphase-promoting complex is a centromere-associated protein in mammalian cells. Mol Cell Biol 18, 468-76. (1998).