Download Recombinant DNA Activity

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Replisome wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

RNA-Seq wikipedia , lookup

Mutation wikipedia , lookup

Gene expression profiling wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Gene desert wikipedia , lookup

Genome evolution wikipedia , lookup

Gene expression wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

List of types of proteins wikipedia , lookup

Gene regulatory network wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Non-coding DNA wikipedia , lookup

DNA supercoil wikipedia , lookup

Gene therapy wikipedia , lookup

Gene wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Point mutation wikipedia , lookup

Genomic library wikipedia , lookup

DNA vaccination wikipedia , lookup

Molecular evolution wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Molecular cloning wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Transformation (genetics) wikipedia , lookup

Plasmid wikipedia , lookup

Restriction enzyme wikipedia , lookup

Genetic engineering wikipedia , lookup

Community fingerprinting wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
Name:
Date:
Per.:
Recombinant DNA LAB - Making Paper Plasmids
Standard: 5c
Objective:
To understand how genes can be inserted into another DNA - "recombine"
To conceptualize "restriction enzymes" and recognition of specific sites
Students will model the process of using restriction enzymes and plasmids to form recombinant DNA.
The "Recombinant DNA Lab" activity can help you see how genes may be manipulated for genetic research,
namely, gene cloning/genetic engineering. This activity will help you conceptualize the mechanics involved in
cutting and ligating DNAs into a plasmid vector with "sticky ends" of complementary DNA base pairs.
Background Information
Recombinant DNA technology is one of the new techniques of biotechnology. Biotechnology uses living
organisms to carry out chemical processes or to produce substances, combining biology with chemistry and
science with industry. Biotechnology includes the field of genetic engineering, which is the science of directly
manipulating genes to produce recombinant DNA. Genetic engineering techniques are used in a variety of
industries, in agriculture, in basic research, and in medicine.
Through genetic engineering, there is great potential for the development of useful products. Researchers have
already developed sources of interferon, human growth hormone, insulin, and resistant fruits and vegetables. A
gene coding for a particular protein is transferred into a host organism. The host organism reproduces and the
population produces the desired protein in volume. For example, the gene that codes for the production of
human insulin has been inserted into the common bacterium E. coli. Then the bacteria can be grown in huge
containers and large amounts of insulin can be collected.
As an introduction to recombinant DNA technology, the exercise that follows illustrates on paper some of the
steps of recombinant DNA experiments done in laboratories.
Steps to Recombination
1. Scientists must first identify the gene that codes for the production of the protein they want to manufacture.
2. Next scientists must isolate the desired gene. Restriction enzymes
from bacterial cells are important in this step. Each restriction
enzyme recognizes and cleaves (cuts) a very specific sequence of
DNA called a restriction site. Some restriction enzymes make a
staggered cut of the DNA producing sticky ends or single strands of
unpaired nucleotide bases capable of binding with complementary
sticky ends. By using restriction enzymes that will cut the DNA on
either side of the gene, the desired gene can be clipped out of the
DNA strand.
3. Once the desired gene has been isolated scientists must then insert the gene into a plasmid. Plasmids are
small circular pieces of DNA found naturally in most bacteria. The plasmid must be removed from a
bacterium and cleaved with the same restriction enzyme used to isolate the gene. This way the sticky ends
of the plasmid will match those of the gene.
4. Finally, bioengineers mix the plasmids with host bacteria. The recombinant plasmid is taken up by a
host bacterium. Inside the bacterium, the plasmids replicate so that they exist in multiple copies. The
gene becomes active and the bacteria begin producing the protein
Summary Questions
1. What is genetic engineering?
2. List some of the products developed through the use of genetic engineering?
3. Which organism is commonly used in genetic engineering? ___________________________________
5. What is a plasmid?
6. What are restriction enzymes?
7. What is meant by a “sticky end”?
8. List the correct order for recombinant DNA. In the space provide, identify the correct sequence of
genetic engineering.
Isolate the desired gene.
Each restriction enzyme recognizes and cleaves (cuts) a very specific sequence of DNA
called a restriction site.
the bacteria begin producing the protein
Identify the gene that codes for the production of the protein they want to manufacture.
Name:
Date:
Per.:
Recombinant DNA Lab Paper Plasmid Activity
In this exercise you will use paper to simulate the cloning of a gene from one organism into a bacterial plasmid
using a restriction enzyme digest. The plasmid (puc18 plasmid) can then be used to transform bacteria so that it
now expresses a new gene and produces a new protein.
Part A. Building a Plasmid Using Yellow Construction Paper
1. Cut a piece of yellow construction paper lengthwise into four equal strips. Tape the strips of paper together
to form one long strip of paper.
2. Beginning on the top left edge, as shown in Figure 1, copy the
following partial sequence for the pUC19 plasmid onto the strip of
yellow paper. Do not leave spaces between the letters. The letters
represent nucleotides in DNA. Plasmids usually contain between
5,000 and 10,000 nucleotides. The dots represent the nucleotides that are not shown.
pUC19 plasmid sequence
GAATCCGAAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCTACCGTGTACCTG
3. On the same strip of yellow paper, write the sequence for the complementary DNA strand directly under
the sequence for the first strand.
GAATCCGAAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCTACCGTGTACCTG
CTTAGGCT......
4. Trim any extra paper from the end of the yellow strip, leaving a 1-cm overhang. Tape the two ends together
to make a complete circle that represents the pUC19 plasmid, as shown in Figure 2.
NOTE: Make sure that the DNA sequence of the plasmid is visible around the top of the circle facing
outward. Label the yellow circle plasmid.
Part B. Building the Gene Glo on a Orange Paper
1. Using a half-sheet of orange construction paper, cut two strips of paper that are as wide as the yellow
strips. Tape the two strips of orange paper together to make one long strip.
2. Copy the sequence for the Glo gene on the orange strip of paper. The actual lux gene makes a chemical that
causes an organism to glow in the dark. On the same strip of orange paper, write the sequence for the
complementary DNA strand directly under the sequence for the first strand. Leave it as a straight strip.
(This is a gene from a vertebrate not a bacterium, so it is not circular.)
GTGCGCG AAGCTTCCTTACTCCAGAGCGAATTCTCTGGTCAT TTCTAGGCT ATATACTT CTAAAGCTTTT CTG
CACGCGCTTCGAAGGAATGAGGTCTCGCTTAAGAGACCAGTAAAGATCCGATATATGAAGATTTCGAAAAGAC
GFP- gene Glo Sequence
3. After you write the lux gene sequence, trim any excess paper from the ends so that the gene sequence fills
the top edge of the paper. Label the orange strip of paper gene. The start and stop sequences for
transcribing the Jellyfish GFP or Glo gene are highlighted. These are needed to transcribe the gene properly
when it is read.
4. Identify the recognition sites for the following restriction enzymes on the pUC19 plasmid DNA.
HindIII Restriction enzyme Recognition site
AGCT↑T
5’—
AA A
G C T T —3’
T↑TCGA A
3’— T T C G A A —5’
The solid lines indicate where the restriction-enzyme has made a cut within the recognition sequence. These
enzymes act as “molecular scissors” to cut the DNA at these sequences in the DNA
Draw lines on the yellow strip of paper labeled plasmid to show where the plasmid should be cut by the
restriction enzymes HindIII. Label each side of the cut site with the name of the restriction enzyme that was
used.
5. Use the scissors to cut the yellow strip of paper that represents the plasmid and the orange strip of paper that
represents the gene according to your cut site markings. Be careful to leave the overhang, or sticky ends,
intact.
6. Now you will incorporate the orange Jellyfish Glo gene into the plasmid. Attach the stickyends of the Jellyfish Glo
gene to the sticky ends of the puc18 plasmid and seal with “molecular glue”, the enzyme ligase (scotch tape will be
used in our lab).
7. You have successfully cloned a gene! You now have a single plasmid with a new gene and can use that to transform a
single bacterium. The bacterium will now make green Jellyfish glow protein and will glow under black light.
ANALYSES AND CONCLUSIONS\
1. Why did we cut both segments of DNA with the same restriction enzyme?
2. Why did we make sure to include the start and stop DNA sequence for the Jellyfish Glo gene in our cut
segment?
3. Explain what a restriction enzyme does.
4. What does the yellow and orange circle of paper represent?
5. Describe the process you used to insert the gene into the plasmid.
6. The Jellyfish Glo gene enables some organisms to make a chemical that glows in the dark. How could this
gene be used to identify the bacterial colonies on a culture plate that have actually picked up the plasmid?
7. What would be the advantages of inserting into a plasmid a gene with a highly visible phenotype?
8. From this model, how is plasmid DNA similar to the DNA found in chromosomes?
9. How is plasmid DNA different from the DNA found in chromosomes?
10. What would have happened if we had cut both the Jellyfish Glo gene and puc 18 plasmid with another
restriction enzyme EcoR1? Be sure to look on the paper DNA sequence to find the EcoR1 restriction
enzyme cut sites.
11. Why was it important to find an enzyme that would cut the plasmid at only one site? What could happen if
the plasmid were cut at more than one site?
12. If we want to now produce a lot of this Jellyfish Glo protein, what do we have to do after this first
successful cloning to reach out goal?