* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Extensions for LIC
Nucleic acid analogue wikipedia , lookup
Metagenomics wikipedia , lookup
Gene nomenclature wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA vaccination wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Gene regulatory network wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
SNP genotyping wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genome editing wikipedia , lookup
Molecular cloning wikipedia , lookup
History of genetic engineering wikipedia , lookup
Gene prediction wikipedia , lookup
Designer baby wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
MHH modified 5/09 LIGATION INDEPENDENT CLONING FOR GENE TAGGING (See Stols et al., 2002 Protein Expression and Purification 25;8-15) Extensions for LIC primers Coding strand Primer: 5’-TACTTCCAATCCAATTTAGC[add gene specific sequence here] - Alternative to adding the GC at the end, the homology region of the gene-of-interest can be chosen to begin with a GC. NOTE: It is essential to amplify a genomic gene fragment that includes a unique restriction site in order to linearize the construct prior to transfection. A 1kb fragment is sufficient for targeting, but it may be necessary to amplify a longer fragment so that it contains a unique site. The site should be at least 350 bp from either end of the fragment. Non-coding strand primer: 5’-TCCTCCACTTCCAATTTTAGC[add gene specific sequence here] - the gene is amplified up to the second last codon (i.e., does not include the terminator codon) to allow read-through to the reporter gene (e.g,. YFP, mCherry, etc). * See schematic below for an example. T4 Processing Protocols Vector 1. PacI digest LIC vector a. Use 5units/ug DNA, incubate 2-3 hours or O/N at 37oC. Phenol:chloroform extract and ethanol precipitate. Run small amount on gel to check for complete linearization. If linearization is incomplete then you will get substantial background. 2. T4 Reaction a. Use roughly 1.6-2.0 ug linear DNA b. 60 ul reaction i. 12ul 5X buffer ii. 3ul 100mM DTT iii. 2.4ul 100mM dGTP iv. 1.5ul T4 DNA polymerase (Novagen LIC qualified…Invitrogen is fine) v. 35.1ul dH20 vi. 6ul Template (200-300 ng/ul) 3. Mix reaction on ice – add T4 pol last, mix gently in PCR machine a. Incubate 30 minutes at 22oC b. Shift to 75oC for 20 minutes c. Reduce temp. to 4oC 4. Store in freezer until needed Inserts 1. Create fragment by PCR. Clean with Qiagen gel-extraction kit. Check DNA Concentration. 2. T4 Reaction a. Use roughly 0.2 pmol insert b. 20 ul reaction i. 4ul 5X buffer MHH modified 5/09 ii. 1ul 100mM DTT iii. 0.8ul 100mM dCTP iv. 0.5ul T4 DNA polymerase (Novagen LIC qualified) v. 8.7 ul dH20 vi. 5ul Template 3. Mix reaction on ice – add T4 pol last, mix gently in PCR machine a. Incubate 30 minutes at 22oC b. Shift to 75oC for 20 minutes c. Reduce temp. to 4oC 4. Store in freezer until needed Annealing 1. Mix on ice a. 1ul of treated vector b. 2ul treated insert 2. Incubate 10 minutes at RT 3. Add 1 ul 25 mM EDTA, incubate 5 minutes at RT. 4. Reduce temp. to 4oC 5. Hold on ice until use. Use 1ul to transform cells. Note: It is best to transform cells immediately after this reaction. However, the annealing reactions can be frozen and used again later. If you freeze them, thaw on ice and transform. Do not let them warm to room temperature. The same treated vector was frozen and used for several months without problems. Transfection into Ku80KO parasites: - Linearize 15ug construct, check on gel, phenol:chloroform extract, and ethanol precipitate. standard transfection protocol, 1x107 parasites/transfection, inoculate T25. Add drug the next day and keep under selection. Parasites lyse in 2 days, but the following passage generally crashes and takes 5-6 days to come back up. If using e.g., YFP-DHFR tagging vector, you should expect to see YFP positive parasite emerging after pass 3 or 4. In some cases the population may become homogeneously positive over time, but in other cases a mixed population may result necessitating screening of several clones. We have seen some evidence of this vector integrating at the DHFR locus, which may be responsible for some or all of the YFP negative parasites in the pyrimethamine resistant population. MHH modified 5/09 YFP. LIC.DHFR vector: gatcggtaccCTGTACTTCCAATCCaatTTAATTAAAattGGAAGTGGAGGACGGgaattcATGGTGAGCAAGGGCGAGGA PacI digest and T4 DNA Polymerase + dGTP treatment: GATCGGTACCCTG CTAGCCATGGGACATGAAGGTTAGGTTAAAT Example : ACP gene 5’ end with LIC sequences ACP gene 3’ end with LIC sequences T AAA ATT GGA AGT GGA GGA CGG gaattc (YFP)ATGGTGAGCAAGGGCGAGGA GCC cttaag TACCACTCGTTCCCGCTCCT TACTTCCAATCCAATTTAGCagacgatttatcctt….. CGtctgctaaataggaa ….. …….. GCT ACA GCG gc …….. CGA TGT CGC cgA TTT TAA CCT TCA CCT CCT * “Ligation” of insert with vector using complementary sequences on both: GGTACCCTGTACTTCCAATCCAATTTAGCagacgatttatcctt………… GCT ACA GCC gcT AAA ATT GGA AGT GGA GGA CGG gaattc (YFP)ATGGTGA CCATGGGACATGAAGGTTAGGTTAAATCGtctgctaaataggaa………. CGA TGT CGG cgA TTT TAA CCT TCA CCT CCT GCC cttaag TACCACTCGT