Download Research in Microbiology

Author's personal copy
Research in Microbiology 163 (2012) 272e278
www.elsevier.com/locate/resmic
Characterization of sporulation histidine kinases of Paenibacillus polymyxa
Soo-Young Park a, Seung-Hwan Park a,b, Soo-Keun Choi a,b,*
b
a
Systems and Synthetic Biology Research Center, KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea
Biosystems and Bioengineering Program, University of Science and Technology (UST), 217 Gajung-ro, Yuseong-gu, Daejeon 305-350, Republic of Korea
Received 2 September 2011; accepted 3 February 2012
Available online 23 February 2012
Abstract
Sporulation histidine kinases, which sense sporulation-specific signals and initiate phosphorelay reactions, are poorly conserved among
Bacillus species. We found several putative genes for sporulation histidine kinases in the genome sequence of Paenibacillus polymyxa E681 and
assayed the genes for complementation of sporulation mutants of Bacillus subtilis. One of these genes, Kin1377, significantly restored the
sporulation deficiency of kinA kinB double mutant of B. subtilis, but not of B. subtilis spo0B mutant. These results indicated that Kin1377
requires B. subtilis Spo0B and possibly Spo0F to transfer phosphate to B. subtilis Spo0A. Another putative kinase, Kin1038, slightly restored the
sporulation deficiencies of both kinA kinB double mutant and spo0B mutant of B. subtilis. However the sporulation deficiency of the B. subtilis
spo0B mutant was significantly restored in the presence of both Kin1038 and P. polymyxa Spo0A. These results indicate that the overexpressed
Kin1038 is able to interact directly with and activate P. polymyxa Spo0A, and that Spo0A can support spore formation in B. subtilis.
Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Keywords: Paenibacillus polymyxa; Sporulation; Histidine kinase; Phosphorelay
1. Introduction
The initiation of sporulation in Bacillus species is regulated
by the phosphorelay signal transduction pathway. Phosphorelay is initiated by autophosphorylation of multiple sensor
histidine kinases in response to sporulation-specific signals.
The kinase phosphoryl group is subsequently transferred to
Spo0F, then to Spo0B, and finally to Spo0A (Burbulys et al.,
1991). Phosphorylated Spo0A can regulate transcriptional
activation or repression of genes related to cell development
(Fawcett et al., 2000; Molle et al., 2003). The phosphorelay
components Spo0A and Spo0F are highly conserved, while
Spo0B is less well conserved and histidine kinases are poorly
conserved among Bacillus species (Stephenson and Hoch,
2002). This poor conservation of histidine kinases among
species complicates ortholog identification.
* Corresponding author. Systems and Synthetic Biology Research Center,
KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea.
Tel.: þ82 42 860 4419; fax: þ82 42 860 4488.
E-mail address: [email protected] (S.-K. Choi).
Paenibacillus polymyxa, which is the type species of the
genus Paenibacillus, is a spore-forming Gram-positive bacterium that is well known to produce polymyxin antibiotics
active against gram-negative bacteria (Choi et al., 2009; Kim
et al., 2010). The clinical value of polymyxin is currently
being reconsidered, even though it carries serious side effects
such as nephrotoxicity and neurotoxicity, because it is sometimes the only active antibiotic available to treat multidrugresistant gram-negative bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumonia
(Landman et al., 2008; Li et al., 2006). Moreover, P. polymyxa
has been shown to be a promising biocontrol agent for the
suppression of plant pathogens through the production of
antimicrobial substances such as polymyxin and fusaricidin
(Choi et al., 2008, 2009). In addition, this organism has plant
growth-promotion activity related to its ability to produce
plant growth-enhancing substances such as auxin (Phi et al.,
2008) and cytokinin (Timmuska et al., 1999). However, to
date, the various characteristics of this versatile microorganism have been poorly understood, especially the mechanism of sporulation initiation. In the present study, we
0923-2508/$ - see front matter Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.resmic.2012.02.003
Author's personal copy
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
273
identified genes responsible for initiation of sporulation in the
P. polymyxa genome and characterized the function of sporulation histidine kinases by heterologous expression in
Bacillus subtilis. The results showed that two P. polymyxa
histidine kinases complemented the histidine kinase mutant of
B. subtilis.
Simon, 2001; Zhai and Saier, 2001), and the TMHMM
program provided by CBS Prediction Severs (http://www.cbs.
dtu.dk) (Krogh et al., 2001). The 0A box sequence was
searched by DBTBS tool (http://dbtbs.hgc.jp). The domain
structures of histidine kinases were predicted using Pfam
(Bateman et al., 2000) (http://pfam.sanger.ac.uk/).
2. Materials and methods
2.3. Heterologous expression of P. polymyxa histidine
kinases in B. subtilis
2.1. Bacterial strains and culture condition
The B. subtilis strains used in this study are listed in Table
1. Escherichia coli DH5a was used for construction of
recombinant plasmids. The spo0B mutant was selected from
colonies grown on spizizen minimal salts medium (SMM)
agar plates supplemented with tryptophan (50 mg/ml) and
without phenylalanine (Harwood and Cutting, 1990).
Schaeffer’s sporulation medium (DSM) was used for the
sporulation assay (Harwood and Cutting, 1990). Transformations of E. coli DH5a and B. subtilis were conducted as
described by Inoue et al. (Inoue et al., 1990) and using
a previously reported method (Harwood and Cutting, 1990),
respectively. When required, medium was supplemented with
chloramphenicol (5 mg/ml), erythromycin (1 mg/ml), spectinomycin (100 mg/ml), neomycin (8 mg/ml) or ampicillin
(100 mg/ml).
2.2. Bioinformatics
A basic survey of the genome structure was conducted
using the Artemis program (Rutherford et al., 2000) and
a functional domain and homology search was conducted
using the blast program available at the NCBI web site (http://
www.ncbi.nlm.nih.gov). ClustalW was used for sequence
alignment. Prediction of the transmembrane segment (TMS)
was conducted using web tools, WHAT 2.0 and HMMTOP in
TCDB (http://www.tcdb.org) (Saier et al., 2009; Tusnady and
The PCR primers used in this study are listed in Table 2.
The putative P. polymyxa histidine kinase genes kin99, kin689,
kin1038, kin1377 and kin3851 were amplified by PCR from
the chromosome of P. polymyxa E681 with the primer pairs
ppkin99F/ppkin99R, ppkin689F/ppkin689R, ppkin1038F/
ppkin1038R, ppkin1377F/ppkin1377R and ppkin3851F/
ppkin3851R, respectively. The PCR products were then
digested with BamHI and SmaI, after which they were cloned
into the corresponding sites of plasmid pHCMC05 (Nguyen
et al., 2005) obtained from the Bacillus Genetic Stock
Center (BGSC), Ohio. The resulting plasmids were introduced
into a kinA kinB double mutant of B. subtilis. The expression
of the kinases was induced by the addition of IPTG at 1 mM.
The spo0A gene of P. polymyxa was amplified from E681
DNA using the primers PP0AF and PP0AR, by PCR. The
amplified fragments were digested with HindIII/BamHI and
cloned into the same site of an integration vector pDG1731
(Guerout-Fleury et al., 1996) to construct plasmid pDG-PPOA.
The resulting plasmid was introduced into the B. subtilis
spo0B mutant (JHOB), or spo0A mutant (JHPP0A) for singlecopy integration of the P. polymyxa spo0A into the thrC locus.
2.4. Spore assays
Overnight cultures grown in DSM were diluted 100 fold
into fresh DSM and grown at 37 C with shaking at 200 rpm.
1 mM IPTG was added in culture 1 h before the onset of the
Table 1
B. subtilis strains used in this study.
Strain
Relevant genotype
Sourcea and reference
JH642
AG676
AG522
NY120
MO699
JH0B
JH0A
JHPP0A
JHKA
JHKAB
JH811
JH-IIAgus
JHKAB-IIAgus
JH0B-IIAgus
JH811-IIAgus
trpC2 phe-1
spo0B::pheA
kinA::Tn917 erm
kinB kapB::spc
spo0A::erm
spo0B::pheA
spo0A::erm
spo0A::erm, thr::spo0APP
kinA::Tn917 erm
kinA::Tn917 erm, kinB kapB::spc
spo0B::pheA, thr::spo0APP
trpC2 phe-1, amyE::PspoIIA-gusA-neo
kinA::Tn917 erm, kinB kapB::spc, amyE::PspoIIA-gusA-neo
spo0B::pheA, amyE::PspoIIA-gusA-neo
spo0B::pheA, thr::spo0APP , amyE::PspoIIA-gusA-neo
Laboratory stock
(Weir et al., 1991)
(Rudner et al., 1991)
(LeDeaux et al., 1995)
(Shin et al., 1999)
AG676 tf JH642
MO699 tf JH642
pDG-PP0A tf JH0A
AG522 tf JH642
NY120 tf JHKA
pDG-PP0A tf JH0B
pMLK-IIA tf JH641
pMLK-IIA tf JHKAB
pMLK-IIA tf JH0B
pMLK-IIA tf JH811
a
tf, the indicated chromosomal DNA or plasmid was used to transform the indicated recipient strain.
Author's personal copy
274
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
Table 2
Plasmids and primers used in this study.
Short descriptiona
Source
Plasmid
pHCMC05
pDG1731
pDG-PP0A
pMC99
pMC689
pMC1038
pMC1377
pMC3851
pMLK83
pMLK-IIA
IPTG inducible expression vector
Integrative plasmid into amyE locus
pDG1731-spo0App
pHCMC05-kin99
pHCMC05-kin689
pHCMC05-kin1038
pHCMC05-kin1377
pHCMC05-kin3851
Gus reporter, amyE integrative plasmid
pMLK83-PspoIIA-gusA
(Nguyen et al., 2005)
(Guerout-Fleury et al., 1996)
This study
This study
This study
This study
This study
This study
(Karow and Piggot, 1995)
This study
Primer
pp0AF
pp0AR
ppkin99F
ppkin99R
ppkin689F
ppkin689R
ppkin1038F
ppkin1038R
ppkin1377F
ppkin1377R
ppkin3851F
ppkin3851R
BSIIAF
BSIIAR
50 -AAGCTTGCGAGTGAAGTAAAAGAAGGAC-30
50 -GGATCCGGATAAAATCTACGGGTTAGCAG-30
50 -GGATCCTGCCAGTAATCGCCAGCATAC-30
50 -CCCGGGACCTGTGTACCCTCCATTTC-30
50 -GGATCCACTAACGGCGTCAAGGAAAG-30
50 -CCCGGGGCCGTAGTAAAGGCATGGAC-30
50 -GGATCCCGTATACAAACTTGTAAATC-30
50 -CCCGGGCGCTGCATCCCAGAAACCTC-30
50 -GGATCCTACGCGTCCGAAACGGCCAG-30
50 -CCCGGGAACATAAAAGAAATAGTATG-30
50 -GGATCCTACGTAGTCATTATCACTTG-30
50 -CCCGGGCTCTTGTGAATCACACTTCG-30
50 -GCCAAGCTTCAGTAGCAAAAGTAAAGGTC-30
50 -GCCGGATCCATATGATCGGATAATGAGTG-30
a
The underlined sequences indicate the synthetic restriction sites.
stationary phase. After culturing for 36 h, serially diluted
cultures were plated on LB agar plates with or without heat
treatment (80 C, 15 min) and cultured overnight, after which
the sporulation efficiency was determined as the ratio of heatresistant spores per milliliter to viable cells per milliliter.
2.5. Enzyme assays
For the b-glucuronidase (Gus) assay, spoIIA promoter was
amplified by PCR from the chromosome of B. subtilis JH642
using the BSIIAF and BSIIAR primers (Table 2). The PCR
product was digested with HindIII and BamHI, after which it
was inserted into the corresponding site of plasmid pMLK83
(Karow and Piggot, 1995). The resulting plasmid, pMLK-IIA
was introduced into several B. subtilis mutant strains. The B.
subtilis cells were cultured in DSM medium and collected at
hourly intervals for determination of the optical density at
600 nm. A Gus assay was conducted using a method that has
been described elsewhere (Karow and Piggot, 1995).
2.6. Nucleotide sequence accession number
P. polymyxa spo0A, spo0F, spo0B and the five putative
histidine kinases were assigned the following GenBank
accession numbers: HM191685, HM191688, HM191687,
HM191689 (kin99), HM191690 (kin689), HM191691
(kin1038), HM191692 (kin1377) and HM191686 (kin3851),
respectively.
3. Results and discussion
3.1. P. polymyxa Spo0A, Spo0B and Spo0F
Signal transduction for sporulation is mediated by the
phosphorelay system, which is highly conserved in sporeforming Bacillus species (Stephenson and Hoch, 2002). In
the system, histidine kinase phosphorylates Spo0F, and the
phosphate group from the Spo0F is transferred to Spo0A by
Spo0B. Spo0F and Spo0A are very highly conserved in the
amino acid sequence, while Spo0B is less well conserved and
histidine kinases are poorly conserved among Bacillus species.
The amino acid sequences of P. polymyxa Spo0A (Spo0APP)
and Spo0F (Spo0FPP) were found to share 68 and 73%
homology with those of B. subtilis, respectively, while the P.
polymyxa Spo0B (Spo0BPP) shared only 14% identity with
that of B. subtilis (Fig. 1B). Due to the highly conserved amino
acid sequence of Spo0BPP around the phosphorylatable histidine residue (HXRHDWXN, amino acids 74-81) and the
downstream location of the obg gene in the operon structure,
which are conserved in the Spo0B family, it was annotated
spo0B. Interestingly, Spo0BPP has extended N-terminal
sequences (49 amino acids) when compared to that of B.
subtilis, and the extended region has two transmembrane (TM)
domains (Fig. 1D). Similarly, the putative Spo0Bs of Paenibacillus sp. JDR-2 (accession number YP_003013117),
Paenibacillus sp. Oral taxon 786 str. D14 (ZP_04853041),
P. larvae subsp. larvae B-3650 (ZP_08056471), P.
Author's personal copy
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
275
Fig. 1. Amino acid sequence alignment of Spo0A (A), Spo0B (B) and Spo0F (C)_from Bacillus subtilis and Paenibacillus polymyxa E681. (D) Analysis of
Spo0BPP by What 2.0 program. Blue and red lines denote hydropathy and amphipathicity, respectively. Orange bars mark transmembrane segments as predicted by
HMMTOP. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
curdlanolyticus YK9 (ZP_07389175) and P. polymyxa SC2
(YP_003948327) have extended N-terminal sequences with
the TM domains. Most Bacillus Spo0Bs do not contain an
extended N-terminal sequence and are not membrane-bound
forms. Therefore, it seems that the extended N-terminal
sequence of the Spo0B may be a distinctive feature of Paenibacillus species.
To examine whether the Spo0APP can function in B. subtilis, the spo0APP gene was introduced in B. subtilis spo0A
mutant (JH0A) to construct JHPP0A strain. Spore assay
showed that the Spo0APP partially recovered the sporulation
defect of the B. subtilis spo0A mutant (Table 4). Alignment of
amino acid sequences of Spo0ABS and Spo0APP revealed that
C-terminal DNA binding domains were highly conserved
while N-terminal response regulator domains were relatively
less conserved (Fig. 1A). As mentioned above, Spo0Bs of two
species were poorly conserved (Fig. 1B). Many studies have
reported that Spo0A-P can regulate target gene expression by
binding to specific DNA sequences, called 0A boxes
(TGTCGAA) in B. subtilis (Liu et al., 2003). The 0A box
sequences were successfully detected in promoter regions of
spo0APP and abrBPP by DBTBS search tool (Fig. 2). The
Table 3
Alignment of histidine sensor kinase (HisKA) domains between B. subtilis and P. polymyxa.
Author's personal copy
276
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
Table 4
Complementation of sporulation in B. subtilis histidine kinase mutant by P.
polymyxa histidine kinases.
Strain
Relevant genotype
Sporulationa (%)
JH642
JHPP0A
JHKAB (pHCMC05)
JHKAB (pMC99)
JHKAB (pMC689)
JHKAB (pMC1038)
JHKAB (pMC1377)
JHKAB (pMC3851)
Wild type
spo0A::erm, thr::spo0App
kinA kinB pHCMC05
kinA kinB pMC99
kinA kinB pMC689
kinA kinB pMC1038
kinA kinB pMC1377
kinA kinB pMC3851
61.00 (1.62)
0.78 (0.13)
0
0
0
1.27 (0.23)
39.05 (5.03)
0
a
Spore assays were conducted in triplicate and the results were averaged.
Standard deviations are presented in parenthesis. A value of 0% indicates that
the efficiency was less than 1 107.
result suggests that DNA binding mode of Spo0APP may be
similar to the case of Spo0ABS. Thus, the partial complementation of the B. subtilis spo0A mutant with Spo0APP might
be due to poor transferring phosphate from Spo0BBS to
Spo0APP.
3.2. Identification of putative sporulation histidine
kinases in the P. polymyxa E681 genome
Bacteria contain many histidine kinases. For example, E.
coli and B. subtilis contain 28 and 36 histidine kinases,
respectively (Fabret et al., 1999; Kanehisa et al., 2006). Most
of these kinases are a component of the two-component signal
transduction system. The kinases sense environmental signals
and autophosphorylate, after which they transfer the phosphate
to the cognate response regulators. The genes encoding histidine kinase and its cognate response regulator are usually
located within the same operon, enabling their coordinated
expression. However, sporulation kinase genes are usually
present on the chromosome without linked response regulator
genes. In this study, we screened the orphan kinases of the P.
polymyxa E681 genome by BLAST analysis using the histidine kinase A phospho-acceptor (HisKA) domains of KinA
A
tggccgtggccttaagatttttttgtcgaaaagcaggggaataactcataattgcaagataaataattaattataatagaaa
ctctaaaaaaaataaataaaaataattttcgacagaaggaattcataattcgatgtcgaaatcatatactccgacaagaaat
atttatatactgtaaacagatatcacaatggaatatcactcaatgaggaggaagtacattg
and KinB in B. subtilis, and five putative sporulation histidine
kinases were selected. These were denoted as PPE00099,
PPE00689, PPE01038, PPE01377 and PPE03851 (hereafter
referred to as Kin99, Kin689, Kin1038, Kin1377 and Kin3851,
respectively) (Table 3). Among these kinases, only Kin1377
does not contain a transmembrane segment in its N-terminal
(Fig. 3). Similarly, the sporulation histidine kinase KinA,
a major histidine kinase involved in sporulation of B. subtilis,
is found in the cytoplasm of the cell (Stephens, 1998).
3.3. Characterization of P. polymyxa sporulation
histidine kinases by complementation of sporulation in
B. subtilis
To analyze the function of the putative histidine kinases in
P. polymyxa, we tried to construct knockout mutants of the
kinase genes, but we failed to obtain any mutant strains. The
failure might be due to poor transformation efficiency of P.
polymyxa E681. Thus, the functional analysis of the kinases
was conducted by complementation of sporulation in B. subtilis. The putative P. polymyxa sporulation histidine kinase
genes were cloned into the plasmid pHCMC05 under the
control of IPTG-inducible promoter, after which the resulting
plasmids were introduced into kinA kinB double mutant strains
of B. subtilis JH642. The spore assay results are shown in
Table 4. Kin99, Kin689 and Kin3851 showed no change in
sporulation efficiency, and Kin1038 had slightly recovered
spore formation. However, Kin1377 could efficiently restore
the sporulation defect of the kinA kinB double mutant, suggesting that the Kin1377 is able to interact and transfer
phosphate to B. subtilis Spo0F (Spo0FBS).
3.4. Complementation of sporulation in B. subtilis
spo0B mutant by Kin1038
It has been reported that B. subtilis KinC likely phosphorylates Spo0A directly in vivo, and both KinC and KinD were
weakly active on Spo0A in vitro even though they are more
active when Spo0F is used as a substrate (Jiang et al., 2000).
To determine whether P. polymyxa histidine kinases can activate Spo0A directly, plasmids pMC1038 and pMC1377 containing kinase genes kin1038 and kin1377, respectively, were
spo0A
B
gatatcagctcctttaatattcggaataatggattaaaatacaataaaatcctaaatgatttccctcattcgacattctttgtcg
taatatgtcgaattatagtttttcgacatttccaaatcgacaaactgaataaatcgtcaatatgataaggcaatacacatgag
taaagctctctaatctaaatacttttgcataatcagactgttactacatttttaaggttgactgttttgggaatcgttggtatagt
aaatatcagaaaagagaaaattttgtcgaatcatgacacttatattattttaaacggcgagaggagcctgatttattatg
abrB
Fig. 2. Prediction of putative 0A boxes by DBTBS search tool from promoter
regions of Paenibacillus polymyxa spo0A (A) and abrB (B). The underlines
and filled diamond symbols indicate putative 0A boxes. Translational start
codons are in bold.
Fig. 3. Domain organization of Paenibacillus polymyxa histidine sensor
kinases (HisKA). Transmembrane segments of sensor kinases (white boxes)
were predicted by HMMTOP. The domain organization and the presence of
putative PAS, HAMP, HisKA and HATPase domains were predicted using
Pfam.
Author's personal copy
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
introduced into B. subtilis spo0B (spo0BBS) mutant. The
sporulation assay results showed that Kin1377 could not
restore the sporulation defect of the spo0BBS mutant, indicating that the phosphorelay from Kin1377 to Spo0ABS
requires Spo0BBS and possibly Spo0FBS (Table 5). In Bacillus
species, Spo0F accepts a phosphoryl group from histidine
kinase and transfers it to Spo0B, and finally to Spo0A.
Therefore, Kin1377 may also transfer the phosphate to
Spo0APP in a Spo0BPP- and possibly Spo0FPP-dependent
manner in P. polymyxa. The Kin1377 did not restore sporulation of the spo0BBS mutant in the presence of the Spo0APP,
indicating that Kin1377 is not able to directly phosphorylate
Spo0APP (Table 5).
The Kin1038 partially recovered sporulation of the B.
subtilis spo0B mutant, suggesting that Kin1038 might activate
Spo0ABS directly (Table 5). We predicted that Kin1038 would
interact more efficiently with its own partner, Spo0APP, than
with Spo0ABS. To test this prediction, the spo0APP with its
own promoter was integrated into the thrC locus on the
chromosome of the B. subtilis spo0B mutant. Sporulation
assay showed that Kin1038 highly restored sporulation of the
mutant containing Spo0APP (Table 5). In addition, the
expression of B. subtilis spoIIA, which is controlled by
phosphorylated Spo0ABS, in spo0B mutant was highly upregulated in the presence of both Kin1038 and Spo0APP (Fig. 4).
The results suggested that Kin1038 can interact with and
directly phosphorylate Spo0APP, and the phosphorylated
Spo0APP can regulate Spo0ABS regulon genes to support spore
formation in B. subtilis. To support the direct interaction
between Kin1038 and Spo0APP by in vitro biochemical
experiment, we tried to purify the Kin1038 and Spo0APP in E.
coli. However, we failed to obtain a Kin1038-overexpressing
E. coli clone.
B. subtilis KinC and KinD may be able to interact directly
with wild-type Spo0A and produce sufficient levels of phosphorylated Spo0A (Jiang et al., 2000). However, direct phosphorylation of Spo0A by KinC or KinD may not be sufficient
to initiate sporulation because sporulation efficiency decreased
to almost zero in spo0F or spo0B mutants, even though KinC
was highly expressed by IPTG-inducible spac promoter
(LeDeaux and Grossman, 1995; Quisel et al., 2001). These
Table 5
Complementation of sporulation in B. subtilis spo0B mutant by P. polymyxa
histidine kinases.
Strain
Relevant genotype
Sporulationa (%)
JHOB
JHOB (pHCMC05)
JHOB (pMC1038)
JHOB (pMC1377)
JH811
JH811 (pMC1377)
spo0B::pheA
spo0B::pheA,
spo0B::pheA,
spo0B::pheA,
spo0B::pheA,
spo0B::pheA,
pMC1377
spo0B::pheA,
pMC1038
pHCMC05
pMC1038
pMC1377
thrC::spo0APP
thrC::spo0APP,
0
0
0.33 (0.08)
0
0
0
thrC::spo0APP,
40.80 (4.45)
JH811 (pMC1038)
a
Spore assays were conducted in triplicate and the results were averaged.
Standard deviation values are shown in parenthesis. A value of 0% indicates
that the efficiency was below 1 107.
277
Fig. 4. Expression of spoIIA-gus in wild-type B. subtilis and mutants. IPTG
was added at the time indicated by the arrow. All experiments were conducted
in triplicate, and the results shown are the averages. Error bars represent the
standard deviation. Symbols: A, wild type; :, JH811 (pMC1038); -, JH0B
(pMC1038); C, JH811; , JH0B.
findings indicate that the alternative phosphate-transferring
system for sporulation to bypass Spo0F and Spo0B does not
work in B. subtilis. The phosphorelay system of the genus
Clostridium was somewhat different from that of Bacillus
group. There were no Spo0F and Spo0B homologues in the
genome of Clostridium species. The phosphorelay system of
Clostridium is dependent on two-component system which
involves direct transferring phosphate from several histidine
kinases to Spo0A (Worner et al., 2006). Here we demonstrated
that introduction of P. polymyxa Kin1038 and Spo0APP into B.
subtilis could bypass the requirement for Spo0B. The results
indicated that Kin1038 can directly interact and activate
Spo0APP in B. subtilis. However, it remains to be elucidated
whether multiple phosphorelay systems such as Kin-Spo0FSpo0B-Spo0A and Kin-Spo0A pathways, exist or not for
sporulation in P. polymyxa.
Acknowledgements
This study was supported by the 21C Frontier Microbial
Genomics and Applications Center Program of the Ministry of
Education, Science and Technology, and the Technology
Development Program for Agriculture and Forestry, Ministry
for Agriculture, Forestry and Fisheries, and the KRIBB
Research Initiative Program, Republic of Korea.
References
Bateman, A., Birney, E., Durbin, R., Eddy, S.R., Howe, K.L.,
Sonnhammer, E.L., 2000. The Pfam protein families database. Nucleic
Acids Res. 28, 263e266.
Burbulys, D., Trach, K.A., Hoch, J.A., 1991. Initiation of sporulation in B.
subtilis is controlled by a multicomponent phosphorelay. Cell 64,
545e552.
Choi, S.K., Park, S.Y., Kim, R., Lee, C.H., Kim, J.F., Park, S.H., 2008.
Identification and functional analysis of the fusaricidin biosynthetic gene
Author's personal copy
278
S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278
of Paenibacillus polymyxa E681. Biochem. Biophys. Res. Commun. 365,
89e95.
Choi, S.K., Park, S.Y., Kim, R., Kim, S.B., Lee, C.H., Kim, J.F., Park, S.H.,
2009. Identification of a polymyxin synthetase gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus subtilis. J. Bacteriol. 191, 3350e3358.
Fabret, C., Feher, V.A., Hoch, J.A., 1999. Two-component signal transduction
in Bacillus subtilis: how one organism sees its world. J. Bacteriol. 181,
1975e1983.
Fawcett, P., Eichenberger, P., Losick, R., Youngman, P., 2000. The transcriptional profile of early to middle sporulation in Bacillus subtilis. Proc. Natl.
Acad. Sci. USA 97, 8063e8068.
Guerout-Fleury, A.M., Frandsen, N., Stragier, P., 1996. Plasmids for ectopic
integration in Bacillus subtilis. Gene 180, 57e61.
Harwood, C.R., Cutting, S.M. (Eds.), 1990. Molecular Biological Methods for
Bacillus. John Wiley & Sons, Inc, New York.
Inoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of
Escherichia coli with plasmids. Gene 96, 23e28.
Jiang, M., Shao, W., Perego, M., Hoch, J.A., 2000. Multiple histidine kinases
regulate entry into stationary phase and sporulation in Bacillus subtilis.
Mol. Microbiol. 38, 535e542.
Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K.F., Itoh, M.,
Kawashima, S., Katayama, T., Araki, M., Hirakawa, M., 2006. From
genomics to chemical genomics: new developments in KEGG. Nucleic
Acids Res. 34, D354eD357.
Karow, M.L., Piggot, P.J., 1995. Construction of gusA transcriptional fusion
vectors for Bacillus subtilis and their utilization for studies of spore
formation. Gene 163, 69e74.
Kim, J.F., Jeong, H., Park, S.Y., Kim, S.B., Park, Y.K., Choi, S.K., Ryu, C.M.,
Hur, C.G., Ghim, S.Y., Oh, T.K., Kim, J.J., Park, C.S., Park, S.H., 2010.
Genome sequence of the polymyxin-producing plant-probiotic rhizobacterium Paenibacillus polymyxa E681. J. Bacteriol. 192, 6103e6104.
Krogh, A., Larsson, B., von Heijne, G., Sonnhammer, E.L., 2001. Predicting
transmembrane protein topology with a hidden Markov model: application
to complete genomes. J. Mol. Biol. 305, 567e580.
Landman, D., Georgescu, C., Martin, D.A., Quale, J., 2008. Polymyxins
revisited. Clin. Microbiol. Rev. 21, 449e465.
LeDeaux, J.R., Grossman, A.D., 1995. Isolation and characterization of kinC,
a gene that encodes a sensor kinase homologous to the sporulation sensor
kinases KinA and KinB in Bacillus subtilis. J. Bacteriol. 177, 166e175.
LeDeaux, J.R., Yu, N., Grossman, A.D., 1995. Different roles for KinA, KinB,
and KinC in the initiation of sporulation in Bacillus subtilis. J. Bacteriol.
177, 861e863.
Li, J., Nation, R.L., Turnidge, J.D., Milne, R.W., Coulthard, K., Rayner, C.R.,
Paterson, D.L., 2006. Colistin: the re-emerging antibiotic for multidrugresistant Gram-negative bacterial infections. Lancet Infect. Dis. 6,
589e601.
Liu, J., Tan, K., Stormo, G.D., 2003. Computational identification of the
Spo0A-phosphate regulon that is essential for the cellular differentiation
and development in Gram-positive spore-forming bacteria. Nucleic Acids
Res. 31, 6891e6903.
Molle, V., Fujita, M., Jensen, S.T., Eichenberger, P., Gonzalez-Pastor, J.E.,
Liu, J.S., Losick, R., 2003. The Spo0A regulon of Bacillus subtilis. Mol.
Microbiol. 50, 1683e1701.
Nguyen, H.D., Nguyen, Q.A., Ferreira, R.C., Ferreira, L.C., Tran, L.T.,
Schumann, W., 2005. Construction of plasmid-based expression vectors for
Bacillus subtilis exhibiting full structural stability. Plasmid 54, 241e248.
Phi, Q.T., Oh, S.H., Park, Y.M., Park, S.H., Ryu, C.M., Ghim, S.Y., 2008.
Isolation and characterization of transposon-insertional mutants from
Paenibacillus polymyxa E681 altering the biosynthesis of indole-3-acetic
acid. Curr. Microbiol. 56, 524e530.
Quisel, J.D., Burkholder, W.F., Grossman, A.D., 2001. In vivo effects of
sporulation kinases on mutant Spo0A proteins in Bacillus subtilis. J.
Bacteriol. 183, 6573e6578.
Rudner, D.Z., LeDeaux, J.R., Ireton, K., Grossman, A.D., 1991. The spo0K
locus of Bacillus subtilis is homologous to the oligopeptide permease locus
and is required for sporulation and competence. J. Bacteriol. 173,
1388e1398.
Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P.,
Rajandream, M.A., Barrell, B., 2000. Artemis: sequence visualization and
annotation. Bioinformatics 16, 944e945.
Saier, M.H., Yen, M.R., Nato, K., Tamang, D.G., Elkan, C., 2009. The
trnasporter classification database: recent advances. Nucleic Acids Res. 37,
D274eD278.
Shin, B.-S., Choi, S.-K., Park, S.-H., 1999. Regulation of the Bacillus subtilis
phosphotransacetylase gene. J. Biochem. 126, 333e339.
Stephens, C., 1998. Bacterial sporulation: a question of commitment? Curr.
Biol. 8, R45eR48.
Stephenson, K., Hoch, J.A., 2002. Evolution of signalling in the sporulation
phosphorelay. Mol. Microbiol. 46, 297e304.
Timmuska, S., Nicandera, B., Granhallb, U., Tillberga, E., 1999. Cytokinin
production by P. polymyxa. Soil Biol. Biochem. 31, 1847e1852.
Tusnady, G.E., Simon, I., 2001. The HMMTOP transmembrane topology
prediction server. Bioinformatics 17, 849e850.
Weir, J., Predich, M., Dubnau, E., Nair, G., Smith, I., 1991. Regulation of
spo0H, a gene coding for the Bacillus subtilis sigma H factor. J. Bacteriol.
173, 521e529.
Worner, K., Szurmant, H., Chiang, C., Hoch, J.A., 2006. Phosphorylation and
functional analysis of the sporulation initiation factor Spo0A from Clostridium botulinum. Mol. Microbiol. 59, 1000e1012.
Zhai, Y., Saier Jr., M.H., 2001. A web-based program (WHAT) for the
simultaneous prediction of hydropathy, amphipathicity, secondary structure and transmembrane topology for a single protein sequence. J. Mol.
Microbiol. Biotechnol. 3, 501e502.