Download DNA Replication - SCF Faculty Site Homepage

DNA
Early Experiments
• Griffith (1928)
– Used Streptococcus pneumoniae
• S-strain (pathogenic)
• R-strain (not pathogenic)
Griffith’s Experiments
• Transformation:
• Some factor was transferred from the
dead S-strain bacteria to the live R-strain
bacteria.
• The newly “transformed” R-strain was
virulent in further generations.
• What was the “factor”?...lots of work to find
out.
The Hereditary “Factor”
•
•
•
•
Molecule of Inheritance.
Early on – both Proteins & Nucleic Acids
were candidates for encoding the genetic
material.
Proteins were both specific and variable.
Not much was known about Nucleic
Acids…until…
Hershey & Chase’s Experiments
• Used a Bacteriophage (“phage”)
– A bacteria-infecting virus.
– Viruses = Protein & Nucleic Acid.
• Used Escherichia coli (E. coli)
• Used radioactive isotopes to label Protein
& DNA.
– Sulfur for Protein
– Phosphorous for DNA
Hershey & Chase’s Experiments
Hershey & Chase’s Experiments
• DNA from the Virus was the “factor” that
infected the bacteria.
• DNA was the “information” molecule – the
Hereditary Molecule.
Additional Data
• Chargaff’s Data
[Adenine] = [Thymine]
[Guanine] = [Cytosine]
• Wilkins & Franklins’ Data
– X-ray diffraction
Deoxyribonucleic Acid
• Watson & Crick’s model:
• Double Helix connected by N-bases.
DNA Replication
• Copying the genetic material –
Duplication.
– Providing blueprints for future generations of
cells!
• Suggested by its very structure!
DNA Replication
• Separation of the double
helix – Helicase.
• Unzipping of the ENTIRE
DNA Molecule.
DNA Replication
• Semiconservative Replication.
• Each parent strand provides a
template for the addition of
complimentary bases.
• DNA Polymerase.
DNA Replication
• …Resulting in two molecules, each
identical to the parent, and to each other.
How does it begin?
• Initiation – DNA replication is initiated at specific
sites – specific nucleotide base sequences along the
parent DNA strand.
• Numerous points of initiation are established along a
DNA strand.
• Helicase (the “unzipper”).
• Topoisomerase (the “reliever of pressure”).
• Single-strand binding proteins (SSBs) (“stabilizers”).
How does it proceed?
• Elongation – new nucleotides are added by
DNA polymerases.
• Actually, addition of nucleoside triphosphates
occurs.
Antiparallel Elongation
• DNA polymerase works from the 3’ to 5’
end of the parental strand of DNA.
• DNA polymerase adds new nucleotides to
the free-floating 3’ end of the newlyforming DNA strand only.
Antiparallel Elongation
• The LEADING STRAND is the fork that
elongates continually from 5’ to 3’.
• The LAGGING STRAND is the fork that
must also elongate from 5’ to 3’ – but in
the opposite direction!
Antiparallel Elongation
• The LAGGING STRAND must, therefore,
elongate AWAY from the replication fork.
• This results in the formation of small
segments of double-stranded DNA –
Okazaki fragments.
Antiparallel Elongation
• DNA Ligase – responsible for connecting
(ligating) the Okazaki Fragments.
OK, An even closer look at:
Initiation
• PROBLEM:
– DNA Polymerase can only add new nucleotides
by attaching them to the 3’ end of another
nucleotide.
G
G
(T)
(T)
OK, An even closer look at:
Initiation
• SOLUTION:
– A Primer is needed (segment of complimentary
RNA) is attached “out of the blue”.
– Primase is the enzyme responsible.
– Once enough bases are in place, DNA
Polymerase takes over.
(by adding bases to the
3’ end NOW there)
OK, An even closer look at:
Initiation
• In Leading Strand…
– This all happens once.
• In Lagging Strand…
– A different DNA Polymerase
replaces each Primer (RNA).
– Later, Ligase connects the 5’
and 3’ ends of the two
Okazaki fragments.
Summary of DNA Replication
Proofreading
• Mistakes do occur.
• Proofreading of the newly-formed DNA is
accomplished by other DNA polymerases.
• Can occur AFTER replication has finished.
• In this case – a Nuclease enzyme cuts out
a segment containing the damaged DNA,
which is then replaced by DNA
Polymerase and Ligase.
Animation
• http://www.stolaf.edu/people/giannini/flash
animat/molgenetics/dna-rna2.swf
DNA Replication shortens DNA
• DNA Polymerase
can only add to the
3’ end.
• Once a primer is
removed, nothing
can be attached to
the exposed 5’ end.
Telomeres
• Caps of non-coding DNA at the ends of
Eukaryotic DNA (chromosomes).
• Repeating segments:
TTAGGGTTAGGGTTAGGGTTAGGG
Telomeres
• Postpone the Protein-encoding parts of
the chromosome from being eroded after
successive replications.
• Eventually, they get shorter and
shorter…which may contribute to cell
senescence (no more dividing).
• Many proteins are responsible for keeping
the cell from activating self-destruct
modes.
What about “Germ” Cells?
• Stem cells & sex cells give rise to more
and more cells (blood cells, gametes, etc.)
• Erosion of genetic material on these cells
would be bad.
• TELOMERASE – enzyme responsible for
maintaining Telomere length.
Assignment for Tuesday:
• 1 paragraph….
– What is a “Thymine Dimer”?
Thymine Dimer
VERY INTERESTING Assignment:
• Read about Telomeres – p. 306.
• Segments of Eukaryotic DNA that do not
contain genes.