Download No Slide Title

Section 13-1
Interest Grabber
• We have discussed some of the ways in which the structure of DNA
can be changed in individuals through mutation and how DNA
changes from generation to generation through recombination and
independent assortment during meiosis and sexual reproduction.
• For thousands of years humans have used selective breeding in
agriculture, horticulture and what was once quaintly called "animal
husbandry" to obtain and maintain desired inheritable traits with
many species of plants and animals. In this sense, we have been
manipulating genes for far longer than we have even known what
"genes" are. We have taken advantage of the capabilities of many
organisms to manufacture foods and beverages we like – yogurt
making, beer and wine manufacturing and cheese are all examples of
natural "biotechnology" which produces things we humans find
useful. Drugs, such as penicillin are products of fungi, used for
human benefit. The streptomycin drugs are bacterial derivatives.
Penicillium mold was one of the first organisms deliberately
"mutated" to produce better strains of the penicillin drug.
Section Outline
Section 13-1
13–1 Changing the Living World
A.Selective Breeding
1. Hybridization
2. Inbreeding
B.Increasing Variation
1. Producing New Kinds of Bacteria
2. Producing New Kinds of Plants
Go to
Section:
• Selective Breeding – allows only those organisms that
have desired traits to produce offspring. This has led
to our current breeds of plants and animals.
• Fact: Pigeon breeding is very big business. Some
pigeons are so inbreed that they no longer fly or eat
normally with their beaks.
Two ways:
1. Hybridization – cross two different types of a
species to produce traits of each. They can produce
“hardier” organisms.
2. Inbreeding – crossing like breeds of the same
species to produce offspring which retain the traits of
the parents. Excessive inbreeding can lead to defects
in some organisms.
Concept Map
Section 13-1
Selective
Breeding
consists of
Inbreeding
Hybridization
which crosses
which crosses
Similar
organisms
Dissimilar
organisms
Organism
breed A
Go to
Section:
for
example
for
example
Organism
breed B
Organism
breed A
which
which
Retains desired
characteristics
Combines desired
characteristics
Genetic and Biotechnology
German shepherd
Service dog
Saint Bernard
Rescue dog
Husky
Sled dog
Labrador and poodle
Polyploids – new species of plants produced due to lack of
chromosome separation during meiosis. They have multiple
copies of the chromosomes and may be stronger than the
normal species from which they were derived.
(Ex: strawberry)
How do scientists induce mutations? Why?
Chemicals and radiation can produce new strains of
organisms.
Many chemicals are now produced using strains of
bacteria or fungi, genetically selected for their ability to
produce quantities of the desired chemical, similar to
the way the Penicillium mold (Flemming) was cultured
to obtain a strain that produced good quantities of
penicillin. It's much easier today, however, to find
strains that produce the desired chemicals than it was
in the 1940's.
Interest Grabber
Section 13-2
The Smallest Scissors in the World
Have you ever used your word processor’s Search
function? You can specify a sequence of letters,
whether it is a sentence, a word, or nonsense, and
the program scrolls rapidly through your document,
finding every occurrence of that sequence. How
might such a function be helpful to a molecular
biologist who needs to “search” DNA for the right
place to divide it into pieces?
Go to
Section:
Section
13-2
Interest Grabber continued
1. Copy the following series of DNA nucleotides onto a
sheet of paper.
GTACTAGGTTAACTGTACTATCGTTAACGTAAGCT
ACGTTAACCTA
2. Look carefully at the series, and find this sequence
of letters: GTTAAC. It may appear more than once.
3. When you find it, divide the sequence in half with a
mark of your pencil. You will divide it between the T
and the A. This produces short segments of DNA.
How many occurrences of the sequence GTTAAC
can you find?
Go to
Section:
Section
13-2
Section Outline
13–2 Manipulating DNA
A. The Tools of Molecular Biology
1. DNA Extraction
2. Cutting DNA
3. Separating DNA
B. Using the DNA Sequence
1. Reading the Sequence
2. Cutting and Pasting
3. Making Copies
Manipulation of DNA
• Genetic engineering (direct manipulation of genes)
effects changes in the DNA molecule and/or in the
organism in very precise and directed ways, for research
and for industrial or commercial applications.
• How do you extract DNA?
DNA must be removed from cells (living or not).
Soap and salt are used along with crushing of cells. It must
be pure if analyzes will occur.
Restrictive enzymes- cut DNA molecules at a specific site.
The section of DNA can be analyzed and/or used.
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme
EcoRI cuts the DNA
into fragments.
Sticky end
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme
EcoRI cuts the DNA
into fragments.
Sticky end
DNA is cut into pieces (refined)…now what?
Separate the DNA!
DNA Analysis- Sequences of DNA are read or
analyzed with computers. Current analysis methods
use labeled nucleotides and tagging. Methods of
analysis are changing every year due to better
technology. (see diagram)
Gel electrophoresis separates charged molecules
based on their molecular weight. An electric current is
used to "drive" molecules that are placed in wells
made in the gel from the negative electrode of the gel
chamber toward the positive electrode. The rate at
which molecules move through the gel is relative to
their molecular weight. As the molecules are
separated they appear as distinct bands on the gel.
DNA fragments have a strong negative charge in
neutral pH so they are well suited for the technique of
gel electrophoresis.
Figure 13-6 Gel Electrophoresis
Section 13-2
DNA plus
restriction
enzyme
Power
source
Longer
fragments
Shorter
fragments
Mixture of DNA
fragments
Gel
Genetics and Biotechnology
 The unique pattern
created based on the
size of the DNA
fragment can be
compared to known
DNA fragments for
identification.
Gel electrophoresis
Figure 13-7 DNA Sequencing
Section 13-2
Fluorescent Single
strand of
dye
DNA
Strand
broken after
A
Power
source
Strand broken
after C
Strand broken
after G
Strand broken
after T
Go to
Section:
Gel
Once a gene has been located, researchers obtain multiple
copies of the gene for their work. (This is kind of like artificial
DNA replication)
One method to obtain sufficient DNA (make copies) is the
Polymerase Chain Reaction (PCR). PCR is very valuable
when trying to do a detailed analysis of a DNA molecule. PCR
is also valuable when there is just a tiny amount of DNA from
which to start. (see diagram)
Application: This is often the case when one is using DNA
materials for potential evidence in criminal investigations, or
when one is trying to reconstruct DNA from preserved and fossil
materials.
FYI: Kary Mullis won the Nobel prize in 1986 for his development
of PCR. PCR uses alternating heating and cooling cycles
starting with heated single-stranded DNA, primers that can join
complementary DNA (nucleotides) and DNA polymerase
isolated from thermophilic bacteria (heat loving) to synthesize
new molecules.
Figure 13-8 PCR
Section 13-2
DNA polymerase adds
complementary strand
DNA heated to
separate strands
DNA fragment
to be copied
PCR
cycles 1
2
3
4
5 etc.
DNA
copies 1
2
4
8
16 etc.
Genetics and Biotechnology
 Genetically engineered organisms are used:
 to study the expression of a particular gene.
 to investigate cellular
processes.
 to study the
development of a
certain disease.
Genetically engineered bollworm
 to select traits that might
be beneficial to humans.
Section
13-3
Interest Grabber continued
Sneaking In
You probably have heard of computer viruses. Once inside a computer,
these programs follow their original instructions and override instructions
already in the host computer. Scientists use small “packages” of DNA to
sneak a new gene into a cell, much as a computer virus sneaks into a
computer.
1. Computer viruses enter a computer attached to some other file. What are
some ways that a file can be added to a computer’s memory?
2. Why would a person download a virus program?
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to
what sort of molecule might they attach the DNA?
Section 13-3
Section Outline
Review: Cell Transformation, first discovered by Griffith, occurs naturally in
many bacteria, and is a good example of recombination.
Bacteria have recombination using plasmids, small independent pieces of DNA
incorporated into bacteria directly from the environment. A bacterium may
have multiple copies of plasmids, and when the bacterium dies, its plasmids
are released into the environment where they can be incorporated into a
different bacterium. Recombination in bacteria is common.
Bacterial recombination can also take place by transduction, a process involving
virus vectors, which can bring bits of DNA which were broken off from a
previous host's DNA molecule when the virus left that host and add that
DNA to a new bacterium. DNA can also be exchanged directly from one
bacterial cell to a second, called conjugation.
Genetic marker – a gene makes it possible to distinguish bacteria that carry the
modified plasmid or recombinant DNA (antibiotic resistance is often used)
Section 13-3
Section Outline
13–3 Cell Transformation
A.Transforming Bacteria
B.Transforming Plant Cells
C.Transforming Animal Cells
Go to
Section:
Figure 13-9 Making Recombinant DNA
for bacterial transformation
Section 13-3
Recombinant
DNA
Gene for human
growth hormone
Gene for human
growth hormone
Human Cell
Bacterial Cell
Sticky
ends
DNA
recombination
DNA
insertion
Bacterial
chromosome
Plasmid
Bacterial cell for
containing gene for
human growth hormone
Figure 13-10 Plant Cell
Transformation
Section 13-3
Agrobacterium
tumefaciens
Gene to be
transferred
Cellular
DNA
Inside plant cell,
Agrobacterium inserts part
of its DNA into host cell
chromosome
Recombinant
plasmid
Plant cell
colonies
Transformed bacteria
introduce plasmids into plant
cells
Complete plant is
generated from
transformed cell
Section 13-3
Knockouts - In the1980’s researchers first succeeded in deactivating a good
gene in mice so they could study the effects of a defective version. This
has proved useful in studying specific genetic defects. This process is
often called genetic knockouts. For example, such mice were used to
study cystic fibrosis, Huntington's disease, Alzheimer's and some
cancers.
*Genes can also be "shot" directly into plant cells with a "gene
gun". The gene gun injects coated DNA particles into the
target plant cells.
FYI: For the future, we can expect similar techniques to be used in conjunction
with gene corrections of "defective" genes. A couple with a known genetic
disorder can provide fertilized eggs for culture. Embryos can be grown in
culture along with a vector that carries the normal gene sequence.
Genetically corrected nuclei can be extracted from the embryo culture and
implanted in enucleated (nucleus is removed) eggs from the mother. The
genetically corrected egg can now be implanted and a "normal" child can
result. It was recently announced that an embryo that carried gene
markers for Alzheimer's had been "corrected" this way.
Knockout Genes
Section 13-3
Recombinant DNA
Flanking
sequences match
host
Host Cell DNA
Target gene
Recombinant DNA replaces
target gene
Modified Host Cell DNA
Section Outline
Section 134
13–4 Applications of Genetic
Engineering
A. Transgenic Organisms
1. Transgenic Microorganisms
2. Transgenic Animals
3. Transgenic Plants
B. Cloning
C. Stem Cells
Go to
Section:
Section 13-4
Section Outline
Transgenic organism – An organism that contains genes from another organism.
These genes can even come from a very different type of organism. This shows
the universal genetic code for life on earth.
Ex: firefly  tobacco plant
Human genes bacteria to make insulin.
Bovine Somatotropic Hormone (BST, also known as BGH) has been successfully introduced
and its use approved. This hormone increases milk production.
FYI -BST is also being investigated to see if it increases muscle development in cattle and pigs.
We have a number of transgenic organisms into whose egg cells or early embryos a
growth hormone has been injected. Such animals reach maturity much faster than
normal so that they can be marketed sooner.
FYI: Transgenic plants – They are engineered to resist insect, fungus, and herbicide
attacks. A number of Transgenic food crops have been approved. It is
estimated that as much as 70% of the foods on our grocery shelves contain
ingredients from crops that are genetically modified.
BT corn, rice, beans- Some of our crop plants have incorporated the protein from
Bacillus thuringiensis bacteria. (BT) produces a toxin in the intestines of
Lepidopteran larvae. This has greatly minimized the need for some pesticides.
FYI- BT has been engineered into the strains of bacteria (Pseudomonas) that
invade root tissue, so that roots can also have protection against larval pests.
Golden rice, a transgenic rice that produces both iron and beta-carotene.
What are round-up ready plants? Round up resistance is genetically engineered.
Section 13-4
Cloning
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an embryo.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.
Cloning – an organism produced from a single cell (asexually).
What is a clone?
A member of a population of identical cells produced from a single cell
(asexually). Bacteria are cloned easily, but multicellular animals have an
extremely low survival rate.
History of Cloning (Brief)
FYI http://www.cloningresources.com/AnimalResearch.asp
1800’s Hans Dreisch, sea urchins
1997- Ian Wilmut, sheep (Dolly) (named after Dolly Parton)– the first sheep
cloned in 1997. She died Feb. 2003 at 6 years of age. This type of sheep normally
lives to be twice that old. She was formed from somatic nuclear transfer.
2001 The baby bull Gaur, Noah, lived 48 hours (endangered)
2002-Texas A&M a cat (cc)
2003 first horse (of 850 embryos- only 22 divided)
Cloned Banteng calf (endangered)
2005- first dog clone- Snuppy (Afghan) see article
Pet cloning- was/is a reality? www.savingsandclone.com- now closed down
Types of Clones
1. Natural clones- When cells in a developing zygote become separated after the twocell stage and the results in identical twins.
2. Artificial clones- When an early embryo is separated into two individual cells in a
Petri dish in a laboratory. Each cell develops on its own and then is implanted in to a
surrogate mother.
Figure 13-13 Cloning of the First
Mammal
Section 13-4
A donor cell is taken
from a sheep’s udder.
Donor
Nucleus
These two cells are fused
using an electric shock.
Fused Cell
Egg Cell
The nucleus of the
egg cell is removed.
An egg cell is taken
from an adult female
sheep.
The fused cell
begins dividing
normally.
Embryo
Cloned Lamb
The embryo
develops normally
into a lamb—Dolly
Foster
Mother
The embryo is placed
in the uterus of a
foster mother.
Section Outline
Section 13-4
How is this done?
1. Somatic Cell Nuclear Transfer (SCNT) Ex: Dolly
Used when a clone is created from an adult organism.
Preserves the genotype of the “parent.”
Chromosomes are from one source-somatic cell nucleus (2N).
Asexual reproduction
Uses a surrogate mom.
2. Artificial Embryo Twinning
Uses another cell not an adult organism.
Does NOT preserve the genotype of the “parent.”
There is a recombination between parental
chromosomes.
After this the fertilized egg splits creating twins.
Sexual reproduction
Uses a surrogate mom.
Section Outline
Section 13-4
What are stem cells? http://www.cnn.com/2004/HEALTH/02/12/science.clone/
Types of stem cells:
1. Totipotent- an early embryonic stem cell that can become any type of cell.
2. Pluripotent-a blastocyst embryonic cell (7 days after fertilization) or fetal
cells (8th week of development) that can become almost any type of
cell.
3. Multipotent-Stem cells from the umbilical cord of an infant or an adult the
can become a limited range of cells.
Mouse heart cells have been cultured from embryonic stem cells,
and have been successfully transplanted into damaged heart tissue.
There is promise that the technique could work in humans, too.
Can this be done with humans? (online article)
Why is this controversial?