* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download No Slide Title
Agarose gel electrophoresis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Molecular evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA vaccination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
List of types of proteins wikipedia , lookup
Molecular cloning wikipedia , lookup
Community fingerprinting wikipedia , lookup
Genetic engineering wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Section 13-1 Interest Grabber • We have discussed some of the ways in which the structure of DNA can be changed in individuals through mutation and how DNA changes from generation to generation through recombination and independent assortment during meiosis and sexual reproduction. • For thousands of years humans have used selective breeding in agriculture, horticulture and what was once quaintly called "animal husbandry" to obtain and maintain desired inheritable traits with many species of plants and animals. In this sense, we have been manipulating genes for far longer than we have even known what "genes" are. We have taken advantage of the capabilities of many organisms to manufacture foods and beverages we like – yogurt making, beer and wine manufacturing and cheese are all examples of natural "biotechnology" which produces things we humans find useful. Drugs, such as penicillin are products of fungi, used for human benefit. The streptomycin drugs are bacterial derivatives. Penicillium mold was one of the first organisms deliberately "mutated" to produce better strains of the penicillin drug. Section Outline Section 13-1 13–1 Changing the Living World A.Selective Breeding 1. Hybridization 2. Inbreeding B.Increasing Variation 1. Producing New Kinds of Bacteria 2. Producing New Kinds of Plants Go to Section: • Selective Breeding – allows only those organisms that have desired traits to produce offspring. This has led to our current breeds of plants and animals. • Fact: Pigeon breeding is very big business. Some pigeons are so inbreed that they no longer fly or eat normally with their beaks. Two ways: 1. Hybridization – cross two different types of a species to produce traits of each. They can produce “hardier” organisms. 2. Inbreeding – crossing like breeds of the same species to produce offspring which retain the traits of the parents. Excessive inbreeding can lead to defects in some organisms. Concept Map Section 13-1 Selective Breeding consists of Inbreeding Hybridization which crosses which crosses Similar organisms Dissimilar organisms Organism breed A Go to Section: for example for example Organism breed B Organism breed A which which Retains desired characteristics Combines desired characteristics Genetic and Biotechnology German shepherd Service dog Saint Bernard Rescue dog Husky Sled dog Labrador and poodle Polyploids – new species of plants produced due to lack of chromosome separation during meiosis. They have multiple copies of the chromosomes and may be stronger than the normal species from which they were derived. (Ex: strawberry) How do scientists induce mutations? Why? Chemicals and radiation can produce new strains of organisms. Many chemicals are now produced using strains of bacteria or fungi, genetically selected for their ability to produce quantities of the desired chemical, similar to the way the Penicillium mold (Flemming) was cultured to obtain a strain that produced good quantities of penicillin. It's much easier today, however, to find strains that produce the desired chemicals than it was in the 1940's. Interest Grabber Section 13-2 The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces? Go to Section: Section 13-2 Interest Grabber continued 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCT ACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Go to Section: Section 13-2 Section Outline 13–2 Manipulating DNA A. The Tools of Molecular Biology 1. DNA Extraction 2. Cutting DNA 3. Separating DNA B. Using the DNA Sequence 1. Reading the Sequence 2. Cutting and Pasting 3. Making Copies Manipulation of DNA • Genetic engineering (direct manipulation of genes) effects changes in the DNA molecule and/or in the organism in very precise and directed ways, for research and for industrial or commercial applications. • How do you extract DNA? DNA must be removed from cells (living or not). Soap and salt are used along with crushing of cells. It must be pure if analyzes will occur. Restrictive enzymes- cut DNA molecules at a specific site. The section of DNA can be analyzed and/or used. Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end DNA is cut into pieces (refined)…now what? Separate the DNA! DNA Analysis- Sequences of DNA are read or analyzed with computers. Current analysis methods use labeled nucleotides and tagging. Methods of analysis are changing every year due to better technology. (see diagram) Gel electrophoresis separates charged molecules based on their molecular weight. An electric current is used to "drive" molecules that are placed in wells made in the gel from the negative electrode of the gel chamber toward the positive electrode. The rate at which molecules move through the gel is relative to their molecular weight. As the molecules are separated they appear as distinct bands on the gel. DNA fragments have a strong negative charge in neutral pH so they are well suited for the technique of gel electrophoresis. Figure 13-6 Gel Electrophoresis Section 13-2 DNA plus restriction enzyme Power source Longer fragments Shorter fragments Mixture of DNA fragments Gel Genetics and Biotechnology The unique pattern created based on the size of the DNA fragment can be compared to known DNA fragments for identification. Gel electrophoresis Figure 13-7 DNA Sequencing Section 13-2 Fluorescent Single strand of dye DNA Strand broken after A Power source Strand broken after C Strand broken after G Strand broken after T Go to Section: Gel Once a gene has been located, researchers obtain multiple copies of the gene for their work. (This is kind of like artificial DNA replication) One method to obtain sufficient DNA (make copies) is the Polymerase Chain Reaction (PCR). PCR is very valuable when trying to do a detailed analysis of a DNA molecule. PCR is also valuable when there is just a tiny amount of DNA from which to start. (see diagram) Application: This is often the case when one is using DNA materials for potential evidence in criminal investigations, or when one is trying to reconstruct DNA from preserved and fossil materials. FYI: Kary Mullis won the Nobel prize in 1986 for his development of PCR. PCR uses alternating heating and cooling cycles starting with heated single-stranded DNA, primers that can join complementary DNA (nucleotides) and DNA polymerase isolated from thermophilic bacteria (heat loving) to synthesize new molecules. Figure 13-8 PCR Section 13-2 DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 2 3 4 5 etc. DNA copies 1 2 4 8 16 etc. Genetics and Biotechnology Genetically engineered organisms are used: to study the expression of a particular gene. to investigate cellular processes. to study the development of a certain disease. Genetically engineered bollworm to select traits that might be beneficial to humans. Section 13-3 Interest Grabber continued Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Section 13-3 Section Outline Review: Cell Transformation, first discovered by Griffith, occurs naturally in many bacteria, and is a good example of recombination. Bacteria have recombination using plasmids, small independent pieces of DNA incorporated into bacteria directly from the environment. A bacterium may have multiple copies of plasmids, and when the bacterium dies, its plasmids are released into the environment where they can be incorporated into a different bacterium. Recombination in bacteria is common. Bacterial recombination can also take place by transduction, a process involving virus vectors, which can bring bits of DNA which were broken off from a previous host's DNA molecule when the virus left that host and add that DNA to a new bacterium. DNA can also be exchanged directly from one bacterial cell to a second, called conjugation. Genetic marker – a gene makes it possible to distinguish bacteria that carry the modified plasmid or recombinant DNA (antibiotic resistance is often used) Section 13-3 Section Outline 13–3 Cell Transformation A.Transforming Bacteria B.Transforming Plant Cells C.Transforming Animal Cells Go to Section: Figure 13-9 Making Recombinant DNA for bacterial transformation Section 13-3 Recombinant DNA Gene for human growth hormone Gene for human growth hormone Human Cell Bacterial Cell Sticky ends DNA recombination DNA insertion Bacterial chromosome Plasmid Bacterial cell for containing gene for human growth hormone Figure 13-10 Plant Cell Transformation Section 13-3 Agrobacterium tumefaciens Gene to be transferred Cellular DNA Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Recombinant plasmid Plant cell colonies Transformed bacteria introduce plasmids into plant cells Complete plant is generated from transformed cell Section 13-3 Knockouts - In the1980’s researchers first succeeded in deactivating a good gene in mice so they could study the effects of a defective version. This has proved useful in studying specific genetic defects. This process is often called genetic knockouts. For example, such mice were used to study cystic fibrosis, Huntington's disease, Alzheimer's and some cancers. *Genes can also be "shot" directly into plant cells with a "gene gun". The gene gun injects coated DNA particles into the target plant cells. FYI: For the future, we can expect similar techniques to be used in conjunction with gene corrections of "defective" genes. A couple with a known genetic disorder can provide fertilized eggs for culture. Embryos can be grown in culture along with a vector that carries the normal gene sequence. Genetically corrected nuclei can be extracted from the embryo culture and implanted in enucleated (nucleus is removed) eggs from the mother. The genetically corrected egg can now be implanted and a "normal" child can result. It was recently announced that an embryo that carried gene markers for Alzheimer's had been "corrected" this way. Knockout Genes Section 13-3 Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Section Outline Section 134 13–4 Applications of Genetic Engineering A. Transgenic Organisms 1. Transgenic Microorganisms 2. Transgenic Animals 3. Transgenic Plants B. Cloning C. Stem Cells Go to Section: Section 13-4 Section Outline Transgenic organism – An organism that contains genes from another organism. These genes can even come from a very different type of organism. This shows the universal genetic code for life on earth. Ex: firefly tobacco plant Human genes bacteria to make insulin. Bovine Somatotropic Hormone (BST, also known as BGH) has been successfully introduced and its use approved. This hormone increases milk production. FYI -BST is also being investigated to see if it increases muscle development in cattle and pigs. We have a number of transgenic organisms into whose egg cells or early embryos a growth hormone has been injected. Such animals reach maturity much faster than normal so that they can be marketed sooner. FYI: Transgenic plants – They are engineered to resist insect, fungus, and herbicide attacks. A number of Transgenic food crops have been approved. It is estimated that as much as 70% of the foods on our grocery shelves contain ingredients from crops that are genetically modified. BT corn, rice, beans- Some of our crop plants have incorporated the protein from Bacillus thuringiensis bacteria. (BT) produces a toxin in the intestines of Lepidopteran larvae. This has greatly minimized the need for some pesticides. FYI- BT has been engineered into the strains of bacteria (Pseudomonas) that invade root tissue, so that roots can also have protection against larval pests. Golden rice, a transgenic rice that produces both iron and beta-carotene. What are round-up ready plants? Round up resistance is genetically engineered. Section 13-4 Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal. Cloning – an organism produced from a single cell (asexually). What is a clone? A member of a population of identical cells produced from a single cell (asexually). Bacteria are cloned easily, but multicellular animals have an extremely low survival rate. History of Cloning (Brief) FYI http://www.cloningresources.com/AnimalResearch.asp 1800’s Hans Dreisch, sea urchins 1997- Ian Wilmut, sheep (Dolly) (named after Dolly Parton)– the first sheep cloned in 1997. She died Feb. 2003 at 6 years of age. This type of sheep normally lives to be twice that old. She was formed from somatic nuclear transfer. 2001 The baby bull Gaur, Noah, lived 48 hours (endangered) 2002-Texas A&M a cat (cc) 2003 first horse (of 850 embryos- only 22 divided) Cloned Banteng calf (endangered) 2005- first dog clone- Snuppy (Afghan) see article Pet cloning- was/is a reality? www.savingsandclone.com- now closed down Types of Clones 1. Natural clones- When cells in a developing zygote become separated after the twocell stage and the results in identical twins. 2. Artificial clones- When an early embryo is separated into two individual cells in a Petri dish in a laboratory. Each cell develops on its own and then is implanted in to a surrogate mother. Figure 13-13 Cloning of the First Mammal Section 13-4 A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell Egg Cell The nucleus of the egg cell is removed. An egg cell is taken from an adult female sheep. The fused cell begins dividing normally. Embryo Cloned Lamb The embryo develops normally into a lamb—Dolly Foster Mother The embryo is placed in the uterus of a foster mother. Section Outline Section 13-4 How is this done? 1. Somatic Cell Nuclear Transfer (SCNT) Ex: Dolly Used when a clone is created from an adult organism. Preserves the genotype of the “parent.” Chromosomes are from one source-somatic cell nucleus (2N). Asexual reproduction Uses a surrogate mom. 2. Artificial Embryo Twinning Uses another cell not an adult organism. Does NOT preserve the genotype of the “parent.” There is a recombination between parental chromosomes. After this the fertilized egg splits creating twins. Sexual reproduction Uses a surrogate mom. Section Outline Section 13-4 What are stem cells? http://www.cnn.com/2004/HEALTH/02/12/science.clone/ Types of stem cells: 1. Totipotent- an early embryonic stem cell that can become any type of cell. 2. Pluripotent-a blastocyst embryonic cell (7 days after fertilization) or fetal cells (8th week of development) that can become almost any type of cell. 3. Multipotent-Stem cells from the umbilical cord of an infant or an adult the can become a limited range of cells. Mouse heart cells have been cultured from embryonic stem cells, and have been successfully transplanted into damaged heart tissue. There is promise that the technique could work in humans, too. Can this be done with humans? (online article) Why is this controversial?