* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 15 Genetic Engeneering
Survey
Document related concepts
Maurice Wilkins wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
List of types of proteins wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Community fingerprinting wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA supercoil wikipedia , lookup
Molecular evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Transcript
Genetic Engineering Biology Ch.15 Selective Breeding • Selective breeding allows only those organisms with desired characteristics to produce the next generation. • Nearly all domestic animals and most crop plants have been produced by selective breeding. Copyright Pearson Prentice Hall Selective Breeding Copyright Pearson Prentice Hall http://www.wisdompanelpro.com/view/bin/images/dog_history_tree.jpg • Humans use selective breeding to pass desired traits on to the next generation of organisms. Selective Breeding • Hybridization – the crossing of dissimilar individuals to bring together the best of both organisms. – Hybrids, the individuals produced by such crosses, are often hardier than either of the parents. Copyright Pearson Prentice Hall Selective Breeding • Inbreeding – the continued breeding of individuals with similar characteristics. – Inbreeding helps to ensure that the characteristics that make each breed unique will be preserved. – Serious genetic problems can result from excessive inbreeding. http://www.geneticstimes.com/Images/German_shepherd.JPG Copyright Pearson Prentice Hall Increasing Variation • Breeders increase the genetic variation in a population by inducing mutations. • Mutations occur spontaneously, but breeders can increase the mutation rate by using radiation and chemicals. • Breeders can often produce a few mutants with desirable characteristics that are not found in the original population. Copyright Pearson Prentice Hall Increasing Variation • Producing New Kinds of Bacteria – Introducing mutations has allowed scientists to develop hundreds of useful bacterial strains, including bacteria that can clean up oil spills. Copyright Pearson Prentice Hall Increasing Variation • Producing New Kinds of Plants – Mutations in some plant cells produce cells that have double or triple the normal number of chromosomes. – This condition, known as polyploidy, produces new species of plants that are often larger and stronger than their diploid relatives. – Polyploidy in animals is usually fatal. Copyright Pearson Prentice Hall The Tools of Molecular Biology • Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules. Copyright Pearson Prentice Hall The Tools of Molecular Biology • Scientists use different techniques to: – extract DNA from cells – cut DNA into smaller pieces – identify the sequence of bases in a DNA molecule – make unlimited copies of DNA Copyright Pearson Prentice Hall The Tools of Molecular Biology • In genetic engineering, biologists make changes in the DNA code of a living organism. Copyright Pearson Prentice Hall The Tools of Molecular Biology • DNA Extraction – DNA can be extracted from most cells by a simple chemical procedure. – The cells are opened and the DNA is separated from the other cell parts. Copyright Pearson Prentice Hall The Tools of Molecular Biology • Cutting DNA – Most DNA molecules are too large to be analyzed, so biologists cut them into smaller fragments using restriction enzymes. • Enzymes found in bacteria used to destroy phage DNA Copyright Pearson Prentice Hall The Tools of Molecular Biology • Each restriction enzyme cuts DNA at a specific sequence of nucleotides. The Tools of Molecular Biology • Separating DNA – In gel electrophoresis, DNA fragments are placed at one end of a porous gel, and an electric voltage is applied to the gel. – When the power is turned on, the negatively-charged DNA molecules move toward the positive end of the gel. BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. The Tools of Molecular Biology • DNA Fingerprinting Dr. Alec Jeffreys – A method of developing a person’s DNA “profile,” similar to a fingerprint. – Pioneered in England in 1984 by Dr. Alec Jeffreys How does it work? • 99.9% of your DNA is the same as everyone else’s. • The 0.1% that differs are a combination of: – Gene differences (Differences in the genes themselves) – Differences in “polymorphic regions” between the genes on the DNA. How does it work? • Certain points between the genes on the DNA have repeating base sequences. – For example: ATTACGCGCGCGCGCGCGCTAGC – These are called variable number tandem repeats (VNTRs for short) How does it work? • Everyone has VNTRs at the same place in their DNA, but they are different lengths for different people. – For example: Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats) Person 2: ATTACGCGCGCGCGTAGC (5 repeats) Using the DNA Sequence Copyright Pearson Prentice Hall BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. • These enzymes also make it possible to take a gene from one organism and attach it to the DNA of another organism. • Such DNA molecules are sometimes called recombinant DNA. Using the DNA Sequence • Making Copies – Polymerase chain reaction (PCR) is a technique that allows biologists to make copies of genes. – A biologist adds short pieces of DNA that are complementary to portions of the sequence. Copyright Pearson Prentice Hall Using the DNA Sequence 5 • DNA is heated to separate its two strands, then cooled to allow the primers to bind to singlestranded DNA. • DNA polymerase starts making copies of the region between the primers. 3 Target sequence Genomic DNA Denaturation: Heat briefly to separate DNA strands Cycle 1 yields 2 molecules Annealing: Cool to allow primers to form hydrogen bonds with ends of target sequence Extension: DNA polymerase adds nucleotides to the 3 end of each primer Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Copyright Pearson Prentice Hall 3 5 5 3 3 5 Primers New nucleotides • During transformation, a cell takes in DNA from outside the cell. The external DNA becomes a component of the cell's DNA. Copyright Pearson Prentice Hall http://biology200.gsu.edu/houghton/4564%20%2704/figures/lecture%203/transformati on.jpg Transforming Bacteria Transforming Bacteria • Foreign DNA is first joined to a small, circular DNA molecule known as a plasmid. • Plasmids are found naturally in some bacteria and have been very useful for DNA transfer. Copyright Pearson Prentice Hall Plasmids • Short, circular DNA molecules outside the chromosome • Carry genes that are beneficial but not essential • Replicate independently of chromosome en.wikipedia.org/?title=Plasmid Transforming Bacteria • The plasmid has a genetic marker—a gene that makes it possible to distinguish bacteria that carry the plasmid (and the foreign DNA) from those that don't. Copyright Pearson Prentice Hall Transforming Bacteria How do you know which cells have been transformed? Transforming Plant Cells • How can you tell if a transformation experiment has been successful? • If transformation is successful, the recombinant DNA is integrated into one of the chromosomes of the cell. Copyright Pearson Prentice Hall Transforming Plant Cells • In nature, a bacterium exists that produces tumors in plant cells. • Researchers can inactivate the tumorproducing gene found in this bacterium and insert a piece of foreign DNA into the plasmid. • The recombinant plasmid can then be used to infect plant cells. Copyright Pearson Prentice Hall Transforming Plant Cells • When their cell walls are removed, plant cells in culture will sometimes take up DNA on their own. • DNA can also be injected directly into some cells. • Cells transformed by either procedure can be cultured to produce adult plants. Copyright Pearson Prentice Hall Transforming Animal Cells • Many egg cells are large enough that DNA can be directly injected into the nucleus. • Enzymes may help to insert the foreign DNA into the chromosomes of the injected cell. • DNA molecules used for transformation of animal and plant cells contain marker genes. http://www.rikenresearch.riken.jp/images/figures/hi_3609.jpg Transforming Animal Cells • Gene Therapy http://library.thinkquest.org/28000/media/genetherapy/l_gene.therapy-ms.gif Copyright Pearson Prentice Hall – DNA molecules can be constructed with two ends that will sometimes recombine with specific sequences in the host chromosome. – The host gene normally found between those two sequences may be lost or replaced with a new gene. Applications of Genetic Engineering Transgenic Organisms Copyright Pearson Prentice Hall http://www.bio.miami.edu/~cmallery/150/handouts/D.zebra.htm http:// http://www.bio.miami.edu/~cmallery/150/handouts/c17 x5transgenic-tobacco.jpg • An organism described as transgenic, contains genes from other species. Transgenic Organisms • Genetic engineering has spurred the growth of biotechnology. – Transgenic animals and plants – The Human Genome Project – The production of vaccines, cancer drugs, and pesticides – Engineered bacteria that can clean up toxic wastes – Cloning • Organ replacement Copyright Pearson Prentice Hall • Transgenic bacteria produce important substances useful for health and industry. Transgenic bacteria have been used to produce: – insulin – growth hormone – clotting factor Copyright Pearson Prentice Hall BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. Transgenic Organisms • Transgenic animals have been used to study genes and to improve the food supply. • Mice have been produced with human genes that make their immune systems act similarly to those of humans. This allows scientists to study the effects of diseases on the human immune system. http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=cmed&part=A9538 Transgenic Organisms Copyright Pearson Prentice Hall Transgenic Animals • Nils Lonberg, director at Medarex, bred two genetically modified mice, creating a mouse with a humanized immune system. • In response to diseasecausing agents, these mice make human antibodies in their cells, some of which might be developed into drugs. http://images.businessweek.com/ss/06/01/critters/source/4.htm Transgenic Organisms • Researchers are trying to produce transgenic chickens that will be resistant to the bacterial infections that can cause food poisoning. Copyright Pearson Prentice Hall http://www.cals.ncsu.edu/agcomm/magazine/spring03/images/transgenic1.jpg Transgenic Organisms • Transgenic plants are now an important part of our food supply. • Many of these plants contain a gene that produces a natural insecticide, so plants don’t have to be sprayed with pesticides. Copyright Pearson Prentice Hall • Bt Corn – Engineering resistant corn. Following the insertion of a gene from the bacteria Bacillus thuringiensis, corn becomes resistant to corn borer infection. This allows farmers to use fewer insecticides http://www.bio.davidson.edu/people/kabernd/semin ar/2004/GMevents/LH/cornear.jpg Transgenic Plants http://www.scq.ubc.ca/bt-corn-is-it-worth-the-risk/ • “Golden rice” has been genetically modified to contain beta-carotene – This rice could help prevent vitamin A deficiency Figure 12.18B Cloning Dolly and Bonnie • A clone is a member of a population of genetically identical cells produced from a single cell. • In 1997, Ian Wilmut cloned a sheep called Dolly. Copyright Pearson Prentice Hall Cloning Cloning Copyright Pearson Prentice Hall http://resources.edb.gov.hk/biology/english/images/genetics/panda.gif • Researchers hope cloning will enable them to make copies of transgenic animals and help save endangered species. Cloning • Studies suggest that cloned animals may suffer from a number of genetic defects and health problems. – Abnormal gene expression – “old” DNA Copyright Pearson Prentice Hall DNA technology raises important ethical questions • Our new genetic knowledge will affect our lives in many ways • The deciphering of the human genome, in particular, raises profound ethical issues – Many scientists have counseled that we must use the information wisely Figure 12.21A-C Could transgenics harm human health or the environment? • Genetic engineering involves some risks – Possible ecological damage from pollen transfer between GM and wild crops – Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars Figure 12.20A, B