* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download - Cal State LA - Instructional Web Server
X-inactivation wikipedia , lookup
Gene desert wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene expression wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene regulatory network wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genome evolution wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genomic imprinting wikipedia , lookup
Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes Kendra Baughman York Marahrens’ Lab UCLA Overview Goal Background Prior Studies Strategy Results Remaining Tasks Future Directions Goal Determine if there are motifs present among Alu elements near highly expressed genes, and missing from Alu elements near poorly expressed genes, that might contribute to gene expression Background – Alu Elements Repetitive sequence Transposons (DNA sequences that make copies of themselves and insert elsewhere in the genome) Over 1 million in human genome ~50 subfamilies categorized by sequence differences Prior Studies “Repetitive sequence environment distinguishes housekeeping genes” Eller, Daniel et al. submitted “Alu abundance positively correlates with gene expression level” C.D. Eller et. al. submitted Alu 15 10 5 0 Percent 20 p= 2e-45 HK TS RS Higher Alu concentration near widely expressed genes Higher Alu concentration near highly expressed genes # Alu in the Subfamily Alu Subfamilies Subfamily Data Human gene expression levels from microarray data (Stan Nelson’s lab, UCLA) Alu information from UCSC Genome Browser, Repeat masker tracks Goal, reiterated Determine if there are motifs present among Alu elements near highly expressed genes, and missing from Alu elements near poorly expressed genes, that might contribute to gene expression Strategy Find Alu “near” high and low expression genes (within 20kb) Perform multiple sequence alignment on Alu sequences Identify motifs preferentially conserved around highly expressed genes (these motifs could help the genes be highly expressed) Strategy Find Alu “near” high and low expression genes (within 20kb) Perform multiple sequence alignment on Alu sequences Identify motifs preferentially conserved around highly expressed genes (these motifs could help the genes be highly expressed) Screening the genes… Expression Level Used Perl scripts to extract information from MySQL databases Grouped genes by expression level in R Chose genes in top and bottom 20% Genes Screening the Alu… Used MySQL queries to determine flanking region Used Perl scripts to screen Alu located within 20kb of genes Omitted Alu in overlapping flanking regions PERCENTAGES OF ALU THROWNOUT Chrom1 1st 20mb Chrom10 Chrom19 1st 20mb 10kb 3% 6% 20% 20kb 7% 7% 28% 50kb 17% 11% 50% LO-gene HI-gene HI-Alu ??-Alu LO-Alu Strategy Find Alu “near” high and low expression genes (within 20kb) Perform multiple sequence alignment on Alu sequences Identify motifs preferentially conserved around highly expressed genes (these motifs could help the genes be highly expressed) Alignment Process… First alignment tool: Clustalw – Slow, inaccurate Second alignment tool: T-COFFEE – Can’t handle hundreds of sequences Third alignment tool: MUSCLE Aligning thousands of sequences = big gaps and processing limitations Chose to analyze by subfamily (S, Sp/q) – – – – Aligned elements around highly expressed genes Aligned elements around poorly expressed genes Profile high/low alignment Consensus sequence alignment Alignment viewed in Jalview Alignments of Alu Sp/q and AluS Elements High conserv. Low conserv. High Alu AluSp-q EPS AluSp/q AluS Strategy Find Alu “near” high and low expression genes (within 20kb) Perform multiple sequence alignment on Alu sequences Identify motifs preferentially conserved around highly expressed genes (these motifs could help the genes be highly expressed) AluS Frequency of consensus base Alu consensus sequence Frequency of consensus base Alu w/ a base: *5547666896759699995769699999999999*9989979 All Alu: 0444762289674300448576809499545545409449808 High Alu: TATCCACGCCTGCAAAATCTCAGCCACTCCCAAAGTTGCTGCG Low Alu CANCC-CGCCT-CGTAATCCCAA--------AATGTT--TG-G All Alu: 76044 55899 37444989894 Alu w/ a base: 77488 66899 67444999995 454045 455645 98 8 98 9 AluSp/q Frequency of consensus base Alu consensus sequence Frequency of consensus base Alu w/ a base: 596**65559458765699999978999999966566****** All Alu: 0860005458443600233333323333333345400000000 High Alu: TGCTCAGAAATTTCTCGGCTCACTGCAACCTCCGTATCACCCC Low Alu: CG---A-AA--------------------CTCCGT--T---CT All Alu: 55 4 58 444544 0 77 Alu w/ a base: 56 5 69 555655 6 99 Remaining Tasks Analyze the remaining sub-families Determine whether identified motifs agree across subfamilies BLAST motifs against all Alu sequences and correlate alignment scores with expression level Future Directions Cluster alignments into a relationship tree to see if HI and LO Alu groups cluster differently from each other – Create a matrix of pairwise alignments and cluster these into a tree using nearest neighbour clustering Use Hidden Markov Models or Gibbs sampling to identify sequence motifs (nonmultiple sequence alignment method of motif finding) Acknowledgements Danny Eller York Marahrens Marc Suchard Chiara Sabatti SoCalBSI NIH/NSF